CN114410671A - Aquilaria sinensis sesquiterpene synthase gene ASS15, and encoding product and application thereof - Google Patents
Aquilaria sinensis sesquiterpene synthase gene ASS15, and encoding product and application thereof Download PDFInfo
- Publication number
- CN114410671A CN114410671A CN202210099188.4A CN202210099188A CN114410671A CN 114410671 A CN114410671 A CN 114410671A CN 202210099188 A CN202210099188 A CN 202210099188A CN 114410671 A CN114410671 A CN 114410671A
- Authority
- CN
- China
- Prior art keywords
- ass15
- aquilaria sinensis
- germplasm
- gene
- sesquiterpene synthase
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/88—Lyases (4.)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/70—Vectors or expression systems specially adapted for E. coli
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
- C12P5/00—Preparation of hydrocarbons or halogenated hydrocarbons
- C12P5/007—Preparation of hydrocarbons or halogenated hydrocarbons containing one or more isoprene units, i.e. terpenes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y402/00—Carbon-oxygen lyases (4.2)
- C12Y402/03—Carbon-oxygen lyases (4.2) acting on phosphates (4.2.3)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/13—Plant traits
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Wood Science & Technology (AREA)
- Zoology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Biotechnology (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Biochemistry (AREA)
- Microbiology (AREA)
- Analytical Chemistry (AREA)
- Biomedical Technology (AREA)
- Molecular Biology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Physics & Mathematics (AREA)
- Biophysics (AREA)
- Mycology (AREA)
- Botany (AREA)
- Immunology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- General Chemical & Material Sciences (AREA)
- Plant Pathology (AREA)
- Medicinal Chemistry (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention provides an aquilaria sinensis sesquiterpene synthase gene ASS15, and a coding product and application thereof, wherein the ASS15 gene can be used for identifying and screening the germplasm of a Sinkiang Machilus, can be used for identifying the germplasm of the Sinkiang Machilus and breeding high-quality Sinkiang Machilus, saves the breeding time of the high-quality Sinkiang Machilus germplasm, lays a foundation for the development of functional molecular markers of the aquilaria sinensis germplasm and the breeding of excellent edgeworthia chinensis germplasm, provides theoretical basis and gene source for breeding new high-quality Sinkiang Machilus germplasm, and is beneficial to developing the source of the Sinkiang Machilus germplasm; the aquilaria sinensis sesquiterpene synthase gene ASS15 can be expressed in a large amount and induce the formation of the aquilaria sinensis when the germplasm of the aquilaria sinensis is induced by injury, the formation of the aquilaria sinensis can be controlled by regulating the expression of the ASS15 gene, and the aquilaria sinensis sesquiterpene synthase gene ASS15 has great significance for the research of the artificial aquilaria sinensis producing technology of high-quality aquilaria sinensis.
Description
Technical Field
The invention relates to the technical field of biological gene engineering, in particular to an aquilaria sinensis sesquiterpene synthase gene ASS15, and a coding product and application thereof.
Background
Aquilaria sinensis (lour.) Gilg is a tropical and subtropical evergreen forest tree of Aquilaria of Thymelaeaceae, and is the only basic plant for Chinese Aquilaria sinensis. The healthy aquilaria sinensis tree does not produce agilawood, and agilawood can be formed in the stem only after the aquilaria sinensis tree is damaged. Lignum Aquilariae Resinatum is a traditional rare medicine, and has effects of activating qi-flowing, relieving pain, warming middle energizer, relieving vomit, absorbing qi and relieving asthma. Modern medical research also proves that the agilawood can be used for treating symptoms such as chest and abdomen swelling and pain, stomach cold and vomiting, kidney deficiency, asthma and the like, and has good effects of analgesia, anti-inflammation, anti-tumor and the like. In recent years, the aquilaria wood is produced by adopting a mode of inducing aquilaria sinensis to produce fragrance by artificial damage, and a wild tree species which is easy to produce fragrance after damage, and has excellent quality and fragrance producing performance is found in the process of producing fragrance by drilling. After grafting and breeding, the tree species can well keep the fragrance-forming property, can be bred in large quantities, and is named as a machilus nanmu germplasm. The traditional germplasm breeding method is difficult to breed the nanmu germplasm with excellent fragrance-forming performance from a plurality of aquilaria sinensis germplasm, and in the previous work, a plurality of nanmu germplasm and the aquilaria sinensis germplasm can be well identified by an MCID (manual cumulative identification diagram) method established by RAPD molecular markers, but the method needs a large number of samples to construct an MCID map, cannot identify the advantages and the disadvantages of the germplasm fragrance-forming, and seriously restricts the cultivation and the efficient utilization of the nanmu germplasm.
Sesquiterpene is one of the main components of agilawood, and healthy aquilaria sinensis stems do not contain sesquiterpene substances and can be synthesized and accumulated only after being injured. The performance of the Kyara germplasm knot incense is superior to that of the common aquilaria sinensis germplasm, which shows that the synthesis regulation mechanism of sesquiterpenes in the Kyara germplasm is remarkably superior to that of the common aquilaria sinensis germplasm after injury, but no report is provided for the synthesis difference molecular regulation mechanism of sesquiterpenes in two germplasms knot incense. Sesquiterpene synthase is a key catalytic enzyme for injury-induced synthesis of agarwood sesquiterpene, and can catalyze farnesene pyrophosphate (FPP) to form a sesquiterpene skeleton in a plant. Therefore, the research on the expression difference of the sesquiterpene synthase gene in the Sinkiang akebia germplasm and the common aquilaria sinensis germplasm can reveal a molecular regulation mechanism of two germplasm damage induced sesquiterpene synthesis differences, and lays a foundation for the development of a new method for identifying and breeding the excellent edgeworthia chrysantha germplasm.
Disclosure of Invention
The invention aims to research the effect of an aquilaria sinensis sesquiterpene synthase gene in the synthesis process of an aquilaria sinensis volatile product and the difference of injury induced expression in the germplasm of a Machilus thunbergii and the germplasm of common aquilaria sinensis, and provides an aquilaria sinensis sesquiterpene synthase gene ASS15, an encoding product thereof and application thereof in the germplasm of the Machilus thunbergii.
The technical scheme of the invention is realized as follows:
an Aquilaria sinensis sesquiterpene synthase gene ASS15, wherein the ASS15 gene is derived from the germplasm of a Kyara tree (Aquilaria sinensis (Lour.) Spreng.), and the nucleotide sequence of the gene is shown as SEQ ID NO. 1.
Preferably, the amino acid sequence of the encoded product of the ASS15 gene is shown in the 11 th to 613 th positions in SEQ ID NO. 2.
The invention also provides application of the ASS15 gene and the coded product thereof in the germplasm of a Machilus.
Preferably, the application comprises the application in screening of the machilus nannieri germplasm or regulation and control of the formation of the agilawood.
Preferably, the screening of the phoebe nana germplasm is to perform injury induction on aquilaria sinensis tree species, detect the expression condition of ASS15 gene 0-24 h after induction, and screen out the phoebe nana germplasm.
Preferably, the screening criterion is that the germplasm of the syzygium cumini is determined by a tree species in which the ASS15 gene is significantly expressed after injury induction compared with that before injury induction, and the germplasm of the other aquilaria sinensis is determined by the screening criterion.
Preferably, the agilawood in the formation of the agilawood regulation and control is the agilawood produced by the machilus nanensis germplasm.
The aquilaria sinensis sesquiterpene synthase gene ASS15 is remarkably higher in gene expression amount in Sinkiang aquilaria sinensis germplasm than in common Sinkiang aquilaria sinensis germplasm, and can be expressed in a large amount and induce the formation of Sinkiang aquilaria sinensis when the Sinkiang aquilaria sinensis germplasm is induced by damage.
Compared with the prior art, the invention has the beneficial effects that:
the invention provides an aquilaria sinensis sesquiterpene synthase gene ASS15, and a coded product and application thereof, wherein the gene can be used for identifying and screening the germplasm of a Machilus thunbergii, can be used for identifying and breeding the germplasm of the Machilus thunbergii, saves the breeding time of the germplasm of the Machilus thunbergii, lays a foundation for developing functional molecular markers of the germplasm of the aquilaria sinensis and breeding excellent germplasm of the Chinese eaglewood, provides theoretical basis and gene source for breeding new varieties of high-quality Machilus thunbergii, and is beneficial to developing the source of the germplasm of the Machilus thunbergii.
The aquilaria sinensis sesquiterpene synthase gene ASS15 can be expressed in a large amount and induce the formation of the aquilaria sinensis when the germplasm of the aquilaria sinensis is induced by injury, the formation of the aquilaria sinensis can be controlled by regulating the expression of the ASS15 gene, and the aquilaria sinensis sesquiterpene synthase gene ASS15 has great significance for the research of the artificial aquilaria sinensis producing technology of high-quality aquilaria sinensis.
Drawings
FIG. 1 is an amplified band of ASS15 gene in example 1 of the present invention;
FIG. 2 is a diagram showing the structure prediction of proteins expressed from ASS15 gene in example 2 of the present invention;
FIG. 3 is the analysis of the conserved sequence of ASS15 gene in example 2 of the present invention;
FIG. 4 is a phylogenetic tree of ASS15 gene in example 2 of the present invention;
FIG. 5 is an electrophoretogram of ASS15 after cleavage of prokaryotic cloning vector in example 3 of the present invention;
FIG. 6 shows the staining results of Coomassie brilliant blue of ASS15 recombinant protein induced expression in example 3;
FIG. 7 is an image of a gel imager in prokaryotic expression of ASS15 recombinant protein in example 3 of the present invention;
FIG. 8 is a GC-MS map of ASS15 for in vitro enzyme functional verification in example 3 of the present invention;
FIG. 9 shows the expression of ASS15 gene in different tissues of Aquilaria sinensis in example 4 according to the present invention;
FIG. 10 shows the expression of ASS15 gene induced by injury at different times in example 4 of the present invention;
FIG. 11 shows the expression of ASS15 gene in different cultivars of Aquilaria sinensis in example 4 of the present invention;
FIG. 12 shows the expression of different sesquiterpene synthase genes in common aquilaria sinensis germplasm and Sinkiang Photinia germplasm in example 5 of the present invention;
Detailed Description
In order that the technical content of the invention may be better understood, specific examples are provided below and the invention is further described.
Example 1 ASS15 Gene clone acquisition
Selecting 3-year-old healthy Machilus thunbergii germplasm with the diameter (d) of (1.2 +/-0.2) cm, carrying out full stem-cutting injury treatment on stems, respectively cutting 2cm stems at the wound after 0, 2, 6 and 24 hours of injury, freezing and grinding the stems into powder by using liquid nitrogen, and extracting total RNA of the stems.
Mu.g of RNA was used
First-Strand cDNA Synthesis SuperMix (Trans, China) carries out reverse transcription to synthesize a First cDNA Strand, a PCR amplification template is used, specific primers (F: ATGTCTTGCTTCCAAGCTCTT; R: ATAAGGGATTGGATCTACAAGTATG) are designed according to the full-length sequence of ASS15 CDS in transcriptome data, and the First cDNA Strand is amplified by using Premix PrimeStar HS (Takara, Japan) and is 20 mu L; and (3) amplification procedure: pre-denaturation at 94 ℃ for 5 min; denaturation at 94 deg.C for 20s, annealing at 56 deg.C for 1min, extension at 72 deg.C for 2min, and circulating for 35 times; finally 72 ℃ for 10 min. The amplified products were recovered with a gel recovery kit (Tiangen, China), ligated to a Blunt Simple T vector (Trans, China), transformed E.coli Trans1-T1 competent (Trans, China), and single colonies were sequenced (Elegano Biotechnology, Guangzhou).
The gene sequence of 1 1812bp is cloned from the harm stem of the machilus nana germplasm and codes 603 amino acids, and the gene sequence is similar to germacrene synthetase sequences of various plants through blastp comparison of NCBI, which indicates that the amplification gene is an aquilaria sinensis sesquiterpene synthase gene and is named as ASS15, the nucleotide sequence of the ASS15 gene is shown as SEQ ID NO.1, and the amino acids of the protein coded by the ASS15 gene are shown as 11 th to 613 th positions in SEQ ID NO. 2.
Example 2 ASS15 bioinformatics analysis
Functional structural domain, protein physicochemical property and homologous evolution analysis are carried out aiming at ASS15 gene sequence with correct sequencing, an online tool InterProScan is utilized to analyze the protein functional domain coded by the gene, an online tool Protparam provided by ExPASy Proteomics Server is utilized to predict the characteristics of ASS15 protein, and the ASS15 protein molecular formula is presumed to be C3118H4858N834O903S24The relative molecular mass is 69.16kD, the isoelectric point is 5.92, the average hydrophilicity coefficient is-0.301, and the protein is predicted to be hydrophilic protein; the instability coefficient was calculated as 45.35, the protein being unstable. TRMHMM Server v.2.0(http:// www.cbs.dtu.dk/services/TMHMM) is adopted to predict that ASS15 encoded protein has no transmembrane domain and is extracellular protein; the prediction of the use of SignalP 4.1Server shows that the ASS15 protein has no signal peptide in the amino acid sequence and is a non-secreted protein, and the Plant-mPoloc (http:// www.csbio.sjtu.edu.cn/bioinf/Plant-multi /) predicts that the protein is positioned in chloroplast;
the amino acid sequence of ASS15 was aligned with the BlastP tool in NCBI to find that ASS15 has conserved domains RPx8W (59-69) and DDxxD (352-356) of higher plant sesquiterpene synthases, and has 62.66% homology with Eucalyptus (Eucalyptus crandis), kapok (Gossypium arboreum), Populus trichocarpa (Populus trichocarpa) and Morus chinensis (Morus nodabis). An ASS15 phylogenetic tree is constructed by an adjacent connection method of MEGA7.0 software, and clustering relation analysis is carried out, as shown in fig. 3, among 17 phylogenetic trees of plants, ASS15 is clustered as one branch independently and then clustered with a clustering branch of Artemisia annua (Artemisia annua), sunflower (Helianthus annuus), goldenrod (Solidago canadensis) and a branch of woody cotton (Gossypium arboreum) Jatropha (Jatropha curcas), which shows that ASS15 protein is relatively close to the relativity of sesquiterpene synthase proteins of the five plants and may have similar functions.
Example 3 expression of ASS15 and functional verification thereof
3.1 prokaryotic expression of ASS15
(1) The ASS15 sequence with correct sequencing is subjected to codon optimization by prokaryotic expression codon optimization software, 8 rare codons in the ASS15 sequence are optimized according to the expression preference of escherichia coli on the premise of not changing an amino acid sequence, and two restriction enzyme sites of NdeI and Xba I are introduced, wherein the optimized sequence is synthesized by Nanjing Belding Biotech company. Optimized ASS15 was ligated to pCzn1 vector, and the ligation product was then transferred into BL21(DE)3PlyssTMAnd performing induction expression in the competence of the escherichia coli, selecting monoclonal bacteria liquid for PCR identification, and further extracting recombinant plasmid for double enzyme digestion verification. As shown in FIG. 5, the recombinant plasmid was cut into 2 pieces and was consistent with the size of the desired fragment and the vector, indicating that the desired fragment was successfully inserted into the pCzn1 vector.
(2) The overnight shaken recombinant plasmid-containing BL21(DE)3PlyssTMBacterial liquid, according to the proportion of 1: 100 was inoculated into 30mL LB medium of 50. mu.g/mL Amp, and shake-cultured at 37 ℃ and 220r/min to OD600When the concentration is 0.6-0.8, IPTG is added to the final concentration of 0.4mM, and the mixture is shaken for 4h at 37 ℃ and 220r/min and overnight at 11 ℃ respectively to induce the expression of the fusion protein. 10000r/min, 2min, collecting the thalli by centrifugation, and suspending the thalli precipitate by using 0.2M PBS buffer solution. And (4) carrying out ultrasonic crushing on the resuspension solution, and adding a sample buffer solution into the supernatant and the precipitation solution for resuspension respectively. The analysis was carried out by 12% SDS-PAGE, and a band was visualized by Coomassie blue staining, and a specific protein band appeared on the 66.2KD side, but the target protein was precipitated in the pellet as inclusion body protein. And obtaining the recombinant protein by renaturation treatment and purification of the inclusion body protein.
(3) In order to verify the accuracy of the expressed recombinant protein, the HIS tagged protein antibody is used for western blot detection. Preparing SDS-PAGE gel with corresponding concentration, taking 0.5ml of recombinant protein, adding 5 Xloading buffer solution, fully mixing uniformly, boiling at 100 ℃ for 10min, loading and carrying out electrophoresis. After electrophoresis, the membrane was transferred to 300mA for 1h at constant flow, the protein in the gel was transferred to PVDF membrane, and the membrane was taken out and washed with TBST for 4 times, 5min each time. Sealing with 5% skimmed milk powder for 1 hr. Using TBST 1: HIS-tagged murine monoclonal antibody was diluted 1000, and PVDF membrane was placed in the diluted HIS antibody and incubated overnight at 4 ℃. The following day, TBST was washed 4 times, rabbit anti-mouse IgG antibody (1: 10000) was incubated for 1h, and the membrane was washed 4 times with TBST after secondary antibody incubation. Color was developed using ECL and imaged using a gel imager. The result shows that the recombinant protein can be specifically combined with the HIS antibody, the successful expression of the ASS15 prokaryotic protein is proved, and the amino acid sequence is shown as SEQ ID NO. 2.
3.2 in vitro enzyme functional validation
200ul of reaction system (25mmol/L of Tirs-Hcl PH7.0, 10% glycerol, 10mmol/L MgSO 2) is prepared in a 2ml centrifuge tube45mmol/L DTT,46umol/L FPP and 50umol/L recombinant protein) are mixed evenly by vortex and are subjected to water bath at 30 ℃ for 2h for catalytic reaction.
The catalytic product was detected using solid phase microextraction, CG-MS conditions: ionization mode EI, electron energy 70eV, carrier gas Ne, flow rate 1ml/min, injection port temperature 250 deg.C, initial temperature 80 deg.C, rising to 220 deg.C at 5 deg.C/min, maintaining for 10min, rising to 240 deg.C at 10 deg.C/min, maintaining for 3min, and scanning mass range 30-50 amu.
The products of the in vitro catalytic reaction are detected by GC-MS, and compared with the products of the blank sample, the products of the in vitro catalytic reaction show a peak at 15.907min, and compared with a NIST database, the products of the in vitro catalytic reaction are Nerolidol (tertiary orange alcohol), which indicates that the enzyme generated by the ASS15 gene code is a functional enzyme gene capable of catalyzing FPP to generate sesquiterpene substances.
Example 4 analysis of expression characteristics of ASS15
Method for determining expression of ASS 15: the ASS15 gene expression characteristics were clarified by qRT-PCR. Using the LightCycle 96(Roche Switzerland) detection system, 20 μ L reaction: 1ul cDNA template, 1ul of ASS15 specific forward and reverse primers, 10ul 2 × SYBR Premix ex TaqTM (Trans, China), ddH2O7 ul, 3 replicates per sample. The reactions all use glyceraldehyde triphosphate dehydrogenase Gene (GADPH) as an internal reference gene, and the primer sequences are F: TGCTAAAGAAGAGGTGAAAAGGG, respectively; r: CCGCAAGGTCGTCATAGAGC are provided. The qRT-PCR procedure was as follows: 95 deg.C for 5 min; 95 deg.C, 10s, 56 deg.C, 15s, 72 deg.C, 20s, cycle by cycleThe loop was 40 times.
a. Taking samples of different tissues of common aquilaria sinensis germplasm and machilus nana germplasm, extracting total RNA, and determining the expression condition of ASS15 gene in different tissues (roots, stems, leaves, seeds and fruits);
b. performing injury induction on common aquilaria sinensis germplasm and a syzygium buergerianum germplasm (a top-penetrating green germplasm and a concave germplasm) by adopting a physical peeling and scratching method, respectively taking stems after 0h, 6h and 24h of induction, extracting total RNA, and determining the expression condition of the ASS15 gene after injury induction in different germplasms;
c. taking the stems of healthy common aquilaria sinensis and Qinan germplasm varieties (sugared knot, thermal family No.1 agilawood, wavil, Jinsha leaf and Ru lake), extracting total RNA, and determining the expression condition of ASS15 gene in different germplasm and varieties.
As shown in FIGS. 9-11, by comparing the expression conditions in the stems of common aquilaria sinensis and Machilus thunbergii germplasm, the ASS15 gene expression in the healthy stems of various Machilus thunbergii germplasm is higher than that in the common aquilaria sinensis germplasm, and the ASS15 gene in the healthy common aquilaria sinensis variety is obviously lower than that in the rest Machilus thunbergii germplasm.
The expression quantity of ASS15 of the two Photinia fraseri germplasms of green penetrating top and concave body is gradually increased within 24h after peeling and scratching injury, while the common aquilaria sinensis is not obviously changed, and the expression of the ASS15 gene in the Photinia fraseri germplasms after injury treatment is obviously higher than that of the aquilaria sinensis, which shows that the Photinia fraseri germplasms and the common aquilaria sinensis germplasms can be identified by detecting the expression condition of the ASS15 gene after injury induction.
Example 5 analysis of expression characteristics of different sesquiterpene synthase genes
The expression of genes ASS1, ASS2, ASS15, ASS17, ASS20 and ASS23 in healthy common aquilaria sinensis germplasm and chia germplasm (recessed body) was measured by qRT-PCR, and the expression level of each gene was measured again after 30 days of peeling scratch injury induction.
PCR primers and annealing temperature for each gene:
note: the PCR conditions were the same as those of ASS15 except for the annealing temperatures shown in the table, and are described in example 4;
sesquiterpene synthase is less expressed in aquilaria sinensis germplasm, and the expression level is greatly increased after injury induction. The inula lappa bunge contains a plurality of sesquiterpene synthases, the injury induction expression conditions of the inula lappa bunge and the Sinkiang Phoebia germplasm are compared, the injury induction expression modes of the 6 sesquiterpene synthases in the two germplasms are obviously different (figure 12), but only ASS15 has the relative expression quantity in healthy and injured Sinkiang Phoebia japonica stems which is obviously higher than that of the inula lappa bunge germplasm, the expression of ASS15 genes can be effectively distinguished, the common inula lappa bunge germplasm and the Sinkiang Phoebia japonica germplasm can be researched, and the research on the cloning, the function identification and the expression characteristic difference of the ASS15 gene can lay a foundation for the development of functional molecular markers of the inula lappa bunge germplasm and the breeding of excellent edgeworts germplasm.
The above description is only for the purpose of illustrating the preferred embodiments of the present invention and is not to be construed as limiting the invention, and any modifications, equivalents, improvements and the like that fall within the spirit and principle of the present invention are intended to be included therein.
Sequence listing
<120> aquilaria sinensis sesquiterpene synthase gene ASS15, and encoding product and application thereof
<160> 2
<170> SIPOSequenceListing 1.0
<210> 1
<211> 1812
<212> DNA/RNA
<213> Aquilaria sinensis (Lour.) Spreng.
<400> 1
atgtcttgct tccaagctct tcttcccgca gcagcacccg ctgcatttcc agttccccag 60
cgcgctggtg ctgcgagcaa caggtcttgc ttccgagatt cggttcttgg aacaacatca 120
gctgtagttc gaaatcgagt tcgtgccaag gctgtgactc aagacgacca gcctcgtcgg 180
ttggctgatt ttcatcccga tatctggggt gaccgcttcc ttgccccctc tcctaatgct 240
tcggctaatg aaatggaaat attggagcat gaaaagctaa agcaagaggt gaggaagatg 300
ataattgcag gcattgaaga tccttcaaag aatatggact tggttgatac aatacaaagg 360
ttgggcgtct cttatcattt tgaggaggag atcaaggagt tattggagag aatgcaccgc 420
aatcttgatg catttgttaa ggataatgct gatgatcttc accaaatctc actttgcttt 480
aggttactaa ggcaacaggg ctacaaagtt tcgagtggtg aaatgtttaa cagcttcaaa 540
tatgatgagg gaaactttaa gcaatccctt acagaagacg gaaaaggact actaagcctc 600
tacgaagcca cacacttaag gattcatgga gaagatattc tagagaaagc attcactttt 660
agtgttgctc aactcaaatc cgtcgcattg aataatgcaa gtatgctact tacaagacaa 720
atcaatcatg ctttgaggtt tcccatccag aggaccatac cacggcttgt ggcaaggttc 780
tacatctcta tgtatcaaga gaagccttca cacaacccac gggttttgaa attttcaaaa 840
ttggatttta atatcttaca aaagcagtac caaaaggagc tcagccaaat atcaaggaga 900
tggtggaaag aattggatgt taaaaccaat ttcccatttg caagggacag aatggtggaa 960
gtatactttt gtatgatgca aatatatttt gagcctcagt atgccttggg cagggcaata 1020
ttaagcaaag ctattgctat ggcatctatc caggatgaca tatatgacgc ttatggtaca 1080
cctgaggagc tcgagcctct aactgaggca attcagcgga ggtgggatcc cgatgtggcg 1140
aatcaactac caggctacat caaaaatttc tacagagcac tcttgggttt gtacaacgaa 1200
attgaagatg aaattgctgc agaaggaaag ttatacaaag ttcagtatgc taaagaagag 1260
gtgaaaaggg tagctaaagc ttacatgaga gaagttaaat ggttccagca aaactataca 1320
cccaccatgg acgagtacat ggaagttgga cttgtgacct ctggctgtac acctatattg 1380
accgtggcct ttgctggagt tttgggggaa attgtaacta aaacaacttt tgaatggctt 1440
gtcaacttcc cgaagatagt cgtcgctacg tcaacgcttg gtaggctcta tgacgacctt 1500
gcggatcatg tccatgagat tgagcaagtg agggggcatg taccctcggc ggtggaatgt 1560
tacatgaaac agtatggggt gaccgaacat gaagcagttg aagaactctc caaattgatg 1620
gaaggtgcat ggaaagacat caatgaagaa tatcttggcc tctcaaaaac aatccctatg 1680
tctcttctca cgccaataat caattacgtg cgcctggggc cagttctcta ccatgaacgt 1740
gatggattca ctaatcctca tgctgttaaa gattttgtaa cttccatact tgtagatcca 1800
atcccttatt aa 1812
<210> 2
<211> 613
<212> PRT
<213> Aquilaria sinensis (Lour.) Spreng.
<400> 2
Met Asn His Lys Val His His His His His Met Ser Cys Phe Gln Ala
1 5 10 15
Leu Leu Pro Ala Ala Ala Pro Ala Ala Phe Pro Val Pro Gln Arg Ala
20 25 30
Gly Ala Ala Ser Asn Arg Ser Cys Phe Arg Asp Ser Val Leu Gly Thr
35 40 45
Thr Ser Ala Val Val Arg Asn Arg Val Arg Ala Lys Ala Val Thr Gln
50 55 60
Asp Asp Gln Pro Arg Arg Leu Ala Asp Phe His Pro Asp Ile Trp Gly
65 70 75 80
Asp Arg Phe Leu Ala Pro Ser Pro Asn Ala Ser Ala Asn Glu Met Glu
85 90 95
Ile Leu Glu His Glu Lys Leu Lys Gln Glu Val Arg Lys Met Ile Ile
100 105 110
Ala Gly Ile Glu Asp Pro Ser Lys Asn Met Asp Leu Val Asp Thr Ile
115 120 125
Gln Arg Leu Gly Val Ser Tyr His Phe Glu Glu Glu Ile Lys Glu Leu
130 135 140
Leu Glu Arg Met His Arg Asn Leu Asp Ala Phe Val Lys Asp Asn Ala
145 150 155 160
Asp Asp Leu His Gln Ile Ser Leu Cys Phe Arg Leu Leu Arg Gln Gln
165 170 175
Gly Tyr Lys Val Ser Ser Gly Glu Met Phe Asn Ser Phe Lys Tyr Asp
180 185 190
Glu Gly Asn Phe Lys Gln Ser Leu Thr Glu Asp Gly Lys Gly Leu Leu
195 200 205
Ser Leu Tyr Glu Ala Thr His Leu Arg Ile His Gly Glu Asp Ile Leu
210 215 220
Glu Lys Ala Phe Thr Phe Ser Val Ala Gln Leu Lys Ser Val Ala Leu
225 230 235 240
Asn Asn Ala Ser Met Leu Leu Thr Arg Gln Ile Asn His Ala Leu Arg
245 250 255
Phe Pro Ile Gln Arg Thr Ile Pro Arg Leu Val Ala Arg Phe Tyr Ile
260 265 270
Ser Met Tyr Gln Glu Lys Pro Ser His Asn Pro Arg Val Leu Lys Phe
275 280 285
Ser Lys Leu Asp Phe Asn Ile Leu Gln Lys Gln Tyr Gln Lys Glu Leu
290 295 300
Ser Gln Ile Ser Arg Arg Trp Trp Lys Glu Leu Asp Val Lys Thr Asn
305 310 315 320
Phe Pro Phe Ala Arg Asp Arg Met Val Glu Val Tyr Phe Cys Met Met
325 330 335
Gln Ile Tyr Phe Glu Pro Gln Tyr Ala Leu Gly Arg Ala Ile Leu Ser
340 345 350
Lys Ala Ile Ala Met Ala Ser Ile Gln Asp Asp Ile Tyr Asp Ala Tyr
355 360 365
Gly Thr Pro Glu Glu Leu Glu Pro Leu Thr Glu Ala Ile Gln Arg Arg
370 375 380
Trp Asp Pro Asp Val Ala Asn Gln Leu Pro Gly Tyr Ile Lys Asn Phe
385 390 395 400
Tyr Arg Ala Leu Leu Gly Leu Tyr Asn Glu Ile Glu Asp Glu Ile Ala
405 410 415
Ala Glu Gly Lys Leu Tyr Lys Val Gln Tyr Ala Lys Glu Glu Val Lys
420 425 430
Arg Val Ala Lys Ala Tyr Met Arg Glu Val Lys Trp Phe Gln Gln Asn
435 440 445
Tyr Thr Pro Thr Met Asp Glu Tyr Met Glu Val Gly Leu Val Thr Ser
450 455 460
Gly Cys Thr Pro Ile Leu Thr Val Ala Phe Ala Gly Val Leu Gly Glu
465 470 475 480
Ile Val Thr Lys Thr Thr Phe Glu Trp Leu Val Asn Phe Pro Lys Ile
485 490 495
Val Val Ala Thr Ser Thr Leu Gly Arg Leu Tyr Asp Asp Leu Ala Asp
500 505 510
His Val His Glu Ile Glu Gln Val Arg Gly His Val Pro Ser Ala Val
515 520 525
Glu Cys Tyr Met Lys Gln Tyr Gly Val Thr Glu His Glu Ala Val Glu
530 535 540
Glu Leu Ser Lys Leu Met Glu Gly Ala Trp Lys Asp Ile Asn Glu Glu
545 550 555 560
Tyr Leu Gly Leu Ser Lys Thr Ile Pro Met Ser Leu Leu Thr Pro Ile
565 570 575
Ile Asn Tyr Val Arg Leu Gly Pro Val Leu Tyr His Glu Arg Asp Gly
580 585 590
Phe Thr Asn Pro His Ala Val Lys Asp Phe Val Thr Ser Ile Leu Val
595 600 605
Asp Pro Ile Pro Tyr
610
Claims (9)
1. An aquilaria sinensis sesquiterpene synthase gene ASS15 is characterized in that the nucleotide sequence of the ASS15 gene is shown in SEQ ID No. 1.
2. Aquilaria sinensis sesquiterpene synthase gene ASS15 according to claim 1, wherein the ASS15 gene is derived from the germplasm of the phoenix tree (Aquilaria sinensis (Lour.) Spreng).
3. The encoded product of an aquilaria sinensis sesquiterpene synthase gene ASS15 according to claim 1, wherein the amino acid sequence of the encoded product of ASS15 is shown in SEQ ID No.2 at positions 11-613.
4. Application of an aquilaria sinensis sesquiterpene synthase gene ASS15 and a coded product thereof is characterized in that the ASS15 gene is applied to machilus nanensis germplasm.
5. Use of aquilaria sinensis sesquiterpene synthase gene ASS15 according to claim 4 and the encoded product thereof in screening of Machilus thunbergii germplasm.
6. The application of aquilaria sinensis sesquiterpene synthase gene ASS15 and the encoding product thereof according to claim 5, wherein the screening method comprises performing injury induction on aquilaria sinensis tree species, detecting the expression condition of ASS15 gene 0-24 h after induction, and screening the germplasm of Machilus nanensis.
7. The application of aquilaria sinensis sesquiterpene synthase gene ASS15 and the encoded product thereof according to claim 6, wherein the screening criteria is that the seeds significantly expressing the ASS15 gene after the induction of injury are the Sinkiang germplasm and vice versa the other aquilaria sinensis germplasm compared to the pre-induction of injury.
8. Use of an aquilaria sinensis sesquiterpene synthase gene ASS15 according to claim 4 and the products encoded thereby, wherein the ASS15 gene is used for the regulation of agilawood formation.
9. The application of aquilaria sinensis sesquiterpene synthase gene ASS15 and the encoded product thereof according to claim 8, wherein the agilawood is produced by Sinkia specie.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202210099188.4A CN114410671B (en) | 2022-01-27 | 2022-01-27 | Aquilaria sinensis sesquiterpene synthase gene ASS15, and encoding product and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202210099188.4A CN114410671B (en) | 2022-01-27 | 2022-01-27 | Aquilaria sinensis sesquiterpene synthase gene ASS15, and encoding product and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN114410671A true CN114410671A (en) | 2022-04-29 |
| CN114410671B CN114410671B (en) | 2023-06-27 |
Family
ID=81278895
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202210099188.4A Active CN114410671B (en) | 2022-01-27 | 2022-01-27 | Aquilaria sinensis sesquiterpene synthase gene ASS15, and encoding product and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN114410671B (en) |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104342426A (en) * | 2014-11-04 | 2015-02-11 | 广东省微生物研究所 | Novel aquilaria sinensis sesquiterpenes synthetase, encoding gene and application thereof |
| CN109879946A (en) * | 2019-03-26 | 2019-06-14 | 中国医学科学院药用植物研究所 | Suspension culture of Aquilaria sinensis AsWRKY44 transcription factor and its application |
-
2022
- 2022-01-27 CN CN202210099188.4A patent/CN114410671B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104342426A (en) * | 2014-11-04 | 2015-02-11 | 广东省微生物研究所 | Novel aquilaria sinensis sesquiterpenes synthetase, encoding gene and application thereof |
| CN109879946A (en) * | 2019-03-26 | 2019-06-14 | 中国医学科学院药用植物研究所 | Suspension culture of Aquilaria sinensis AsWRKY44 transcription factor and its application |
Also Published As
| Publication number | Publication date |
|---|---|
| CN114410671B (en) | 2023-06-27 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN110540993B (en) | Clone of lilium tenuifolium salt-tolerant gene LpNAC20 and application thereof | |
| CN111675755B (en) | Bermuda grass transcription factor CdWRKY50 for regulating and controlling plant salt tolerance and application thereof | |
| CN103409400A (en) | Beta-elemene synthetase, encoding gene thereof, carrier, engineering bacterium and application of beta-elemene synthetase | |
| CN114921474A (en) | BpbHLH10 gene for improving salt tolerance of white birch and protein coded by same | |
| CN112961229B (en) | Rubber tree transcription factor HbICE4 and coding gene and application thereof | |
| CN114410671A (en) | Aquilaria sinensis sesquiterpene synthase gene ASS15, and encoding product and application thereof | |
| CN110452917B (en) | Wild grape VyGOLS gene and application of encoding protein thereof in drought stress | |
| CN104745560A (en) | Eggplant chalcone synthase SmCHS1 protein and coding gene thereof | |
| CN101787074A (en) | Leymus chinensis aquaporin and encoding gene and application thereof | |
| CN114317562B (en) | Coding gene PvEXO70 of common fusarium solani wilt disease resistance related protein and application thereof | |
| CN102925458B (en) | ABC transporter PgPDR2 gene and encoding protein and application of ABC transporter gene PgPDR2 | |
| CN110004153A (en) | Chicken recombinant C EBP γ albumen, its DNA sequences encoding and application | |
| CN112795580B (en) | Pitaya gene HuAAE3 and application thereof in regulation and control of high temperature stress resistance of plants | |
| CN108018292B (en) | A kind of Drought-tolerant gene and its application for being used to prepare drought-enduring genetically modified plants | |
| CN109207446A (en) | glucose oxidase mutant | |
| CN110982828A (en) | Nitrate transport protein gene specifically induced by rice arbuscular mycorrhiza and application thereof | |
| CN101892212B (en) | Tomato phosphoenolpyruvate carboxykinase as well as coding gene and application thereof | |
| CN108118063B (en) | Mulberry potassium ion channel related gene MaKCO5 and application thereof | |
| CN112359051A (en) | Phenylalanine ammonia lyase gene ThPAL from radix tetrastigme and application thereof | |
| CN111394359A (en) | Cloning, prokaryotic expression and protein purification method of carminespider mite calmodulin gene | |
| CN112778408A (en) | Rubber tree transcription factor HbICE2 and coding gene and application thereof | |
| CN102925460B (en) | PgPDR1 gene for regulating translocation and accumulation of ginsenoside, coding protein and application of PgPDR1 gene | |
| CN103333868A (en) | Agapanthus praecox gibberellin synthesis dioxygenase APGA20ox protein and coding gene and probe thereof | |
| WO2006062266A1 (en) | Genes of a korean isolate rbiv and a vaccine against rbiv | |
| CN112410354B (en) | Cinnamic acid-4-hydroxylase gene ThC4H and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |