CN110004153A - Chicken recombinant C EBP γ albumen, its DNA sequences encoding and application - Google Patents
Chicken recombinant C EBP γ albumen, its DNA sequences encoding and application Download PDFInfo
- Publication number
- CN110004153A CN110004153A CN201910304047.XA CN201910304047A CN110004153A CN 110004153 A CN110004153 A CN 110004153A CN 201910304047 A CN201910304047 A CN 201910304047A CN 110004153 A CN110004153 A CN 110004153A
- Authority
- CN
- China
- Prior art keywords
- recombinant
- chicken
- cebp
- ebp
- protein
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
- C07K14/465—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from birds
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/70—Vectors or expression systems specially adapted for E. coli
Landscapes
- Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Zoology (AREA)
- Engineering & Computer Science (AREA)
- General Engineering & Computer Science (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Biophysics (AREA)
- Wood Science & Technology (AREA)
- Molecular Biology (AREA)
- General Health & Medical Sciences (AREA)
- Biochemistry (AREA)
- Biotechnology (AREA)
- Biomedical Technology (AREA)
- Gastroenterology & Hepatology (AREA)
- Physics & Mathematics (AREA)
- Toxicology (AREA)
- Plant Pathology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Microbiology (AREA)
- Medicinal Chemistry (AREA)
- Preparation Of Compounds By Using Micro-Organisms (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Peptides Or Proteins (AREA)
Abstract
The invention discloses a kind of DNA sequence dnas for encoding chicken recombinant C EBP γ albumen, also disclose the recombinant expression carrier containing above-mentioned DNA sequence dna and transgenosis recombination bacillus coli.The invention also discloses breeder recombinant C EBP γ albumen and the preparation method and application thereof.Compared with the prior art, the gene DNA sequence of chicken Cebp γ provided by the present invention can realize its solubility expression in Escherichia coli at corresponding temperature and inducer concentrations, the preparation method of recombinant protein has easy to implement the method, it is easy to operate, expression quantity is high, low in cost, provided method, can be obtained the higher chicken CEBP γ recombinant protein of purity through the invention.
Description
Technical field
The present invention relates to the prokaryotic expression of recombination in genetic engineering field and purification process, in particular to chicken CEBP γ
Method of the recombinant protein in expression in escherichia coli and purifying.
Technical background
Mcknight and its colleague are in the first discovery CEBPs family in rat liver in 1987, i.e. CCAAT enhancer knot
Hop protein (CCAAT enhancer binding protein, CEBPs) is one group and belongs to basic leucine zipper (basic
Region leucine zipper, bZIP) family transcription regulatory factor, have now been found that 6 members: α, β, γ, δ, ε and
ζ, CEBPs there are many function, they heteromultimers can have both been formed by C/EBPs family member or combine other transcriptions because
Corresponding controlling element is acted on after son, to play its special effect in specific tissue or cell, and forms one again
Miscellaneous and fine regulated and control network, cell Proliferation, differentiation, signal transduction, tumour occur and the immune of body, stress reaction,
Energetic supersession, blood generation etc. play a significant role.The a member of CEBP γ as CEBPs family, it contains close to C-terminal
One DNA binding structural domain, but lack the transactivation domain of CEBPs family protein, homodimer cannot be formed, and only
Heterodimer can be formed with others CEBPs family member, to inhibit the transcriptional activity for the CEBPs being combined, CEBP γ
The increment of cell, inhibition aging can be promoted by forming heterodimer with CEBP β.CEBP β is by PPAR γ in fat cell
Early growth and atomization important role.In poultry production, fat deposition mainly by the increase of fat cell and
In fat cell caused by the reasons such as increase of cell caused by the accumulation of fat drips, fat deposition over-deposit will affect the strong of animal
Health, reproduction breeding, lean meat output capacity, influence production efficiency.Therefore, the structure of chicken CEBP γ is understood and its in fat cell life
Function in long differentiation is beneficial to solve chicken in raising production process due to excessive Fat Accumulation band in genetic breeding level
The numerous adverse effects come.The present invention expresses chicken recombinant protein c EBP γ using genetic engineering in Escherichia coli system, can be with
It deeply parses its molecular structure and prepares the antigen of recombination for Antibody preparation, for further effect of the research CEBP γ in poultry
Important material guarantee is provided.
Summary of the invention
Goal of the invention: the first purpose of the invention is to provide the DNA sequence dnas of a breeder CEBP γ recombinant protein.
It is another object of the present invention to provide a breeder CEBP γ recombinant proteins.
A further object of the present invention is to provide a kind of recombination of DNA sequence dna containing the chicken CEBP γ recombinant protein
Expression vector.
What a further object of the present invention was to provide a kind of DNA sequence dna containing the chicken CEBP γ recombinant protein turns base
Because of recombination bacillus coli.
A further object of the present invention is to provide the preparation method and applications of a breeder CEBP γ recombinant protein.
Technical solution: to solve the above-mentioned problems, the present invention provides the DNA sequence dna of a breeder CEBP γ recombinant protein,
Its nucleotide sequence is as shown in SEQ ID NO:1.
Chicken CEBP γ recombinant protein of the present invention, amino acid sequence is as shown in SEQ ID NO:2.
Above-mentioned DNA sequence dna is inserted into expression chicken CEBP γ recombinant protein obtained in coli expression carrier
The recombinant expression carrier of DNA.Wherein, the coli expression carrier is pET30a.
A kind of transgenosis recombinant escherichia coli strain, the recombination large intestine bacterial strain is to convert the recombinant expression carrier
Into BL21 (DE3) bacterial strain, screening obtains transgenosis recombinant escherichia coli strain.
The preparation method of one breeder CEBP γ recombinant protein, comprising the following steps:
(1) according to the protein sequence for the chicken Cebp γ gene announced in GenBank, by optimizing the password in the gene
Son redesigns the nucleotide sequence (particular sequence is shown in seq1) of its gene, adapts it to wanting for the translation system of Escherichia coli
It asks;
(2) the genetic fragment insertion Bacillus coli expression of the chicken CEBP γ polypeptide of synthesis is carried into pET30a, and is added in C-terminal
6 His labels obtain recombinant expression carrier pET30a-gCebp γ-hc;
(3) recombinant expression carrier pET30a-gCebp γ-hc converts e. coli bl21 (DE3), and passes through kanamycins
Screening obtains transgenosis recombinant escherichia coli strain BL21 (DE3)-pET30a-gCebp γ-hc;
(4) the soluble table of chicken CEBP γ recombinant protein is realized by the optimization to temperature and IPTG induced concentration condition
It reaches;Affinity chromatography one-step method is established to purify to obtain the chicken CEBP γ recombinant protein of high-purity.
The invention also discloses application of the above-mentioned chicken CEBP γ recombinant protein in terms of chicken herding research and production.
The utility model has the advantages that the present invention compared with the existing technology, has the advantage that the base of chicken Cebp γ provided by the present invention
Because DNA sequence dna can realize its solubility expression in Escherichia coli, recombinant protein at corresponding temperature and inducer concentrations
Preparation method have easy to implement the method, easy to operate, expression quantity is high, low in cost, through the invention provided by method, can obtain
To the higher chicken CEBP γ recombinant protein of purity.Its main advantage is: realized by the optimization of chicken Cebp γ genetic fragment,
Its expression in Escherichia coli is improved, and realizes the expression of soluble recombinant protein, passes through nickel ion affinity chromatograph one
Method of purification is walked, the chicken C/EBP γ recombinant protein of high-purity can be obtained.
Detailed description of the invention
Fig. 1: chicken Cebp γ gene optimization segment G/C content analyzes result, and (Y-axis indicates site G/C content (window size
For 30bp), X-axis is oligonucleotide residues site);
Fig. 2: chicken Cebp γ gene optimization segment codon adaptation indexI analyzes result, and (Y-axis is codon in Escherichia coli
In relative application frequency, X-axis indicates each codon corresponding position in genetic fragment);
Fig. 3: (M is Premixed Protein to the expression analysis result of recombinant protein after chicken Cebp γ gene optimization
Marker;1~4 it is respectively 0.05mmol/L, induces under the conditions of 37 DEG C of 0.1mmol/L, 0.5mmol/L, 1.0mmol/L IPTG
Total bacterium lysate of 4h, A are the recombinant bacterium of chicken C gene native gene building, and B is the building of chicken C/EBP γ gene optimization segment
Recombinant bacterium);
Fig. 4: the solubility expression of recombinant protein analyzes result (M Premixed after chicken Cebp γ gene optimization
Protein Marker;1 is total bacterium crack protein, and 2 be cellular lysate supernatant, and 3 precipitate for cellular lysate;A, B, C respectively exist
Under the conditions of 18 DEG C, the induction result of various concentration IPTG (final concentration is followed successively by 0,0.05,1.0mmol/L));
Fig. 5: (M is Premixed Protein Marker to chicken CEBP γ recombinant protein purification result;1 is BL21 (DE3)-
PET 30a blank bacterial strain inducing cracks total protein (control), and the 2 cellular lysate total proteins not induced for recombinant bacterium, 3 be recombinant bacterium
The cellular lysate total protein of induction, the 4 cellular lysate supernatants induced for recombinant bacterium, 5 be Ni column purification prick post liquid, and 6 be cleaning solution,
7~10 be respectively the imidazole elution of various concentration (imidazole concentration is followed successively by 150,200,250,300mmol/L);Induce item
Part: 18 DEG C, the final concentration of 0.05mmol/L of IPTG, 12h is induced);
The Western blot qualification result of Fig. 6: recombinant protein c EBP γ.
Specific embodiment
The application is explained in detail combined with specific embodiments below.
The Optimal Expression and preparation method thereof of 1: one breeder CEBP γ recombinant protein of embodiment
1. the optimization and synthesis of the expressed sequence of chicken Cebp γ gene
According to GenBank database provide chicken Cebp γ gene (NM_206859.1) cDNA and protein sequence, into
The analysis of row sequence, with protein in Escherichia coli optimal codon, eliminate the genetic transcription into RNA template secondary structure and negative
Property regulating and controlling sequence be principle, the coding region sequence of the cDNA sequence of chicken Cebp γ gene is optimized, Fig. 1-2 is detailed in, according to
For diagram as it can be seen that the G/C content of the genetic fragment of optimization is 51% or so, it is close that selected codon is biased to commonly using for Escherichia coli
Numeral.Sequence is shown in SEQ ID NO:1, and adds Nde I and Xho I restriction enzyme site sequence respectively 5 ' and 3 ', is cloned into
PET30a expression plasmid obtains recombinant plasmid pET30a-gCebp γ-hc.
SEQ ID NO:1
ATGAGCAAAACCAGCCCGCAAAATACCGCAACCGATGCAAACGGCGTTAGCGTTATCCATACCCAAGC
ACATAGTAGCGGTCTGCAACAAGTTCCGCAACTGGTTCCGGTTTCTCCGGGTGGTGGCGGTAAAGCAGTTCCGCCG
AGTAAACAGGGCAAAAAGAACAGCTTCGTCGACCGCAACTCAGACGAATATCGTCAGCGTCGCGAACGTAACAACA
TGGCGGTCAAAAAATCCCGCCTGAAAAGCAAACAGAAAGCGCAGGATACCCTGCAACGCGTTACCCAACTGAAAGA
AGAGAACGAGCGCCTGGAAGCGAAAATCAAACTGCTGACCAAAGAGCTGAGCGTCCTGAAAGACCTGTTTCTGGAA
CACGCACATAGCCTGGCAGATAACGTTCA ACCGGTTGGTACCGAAAGCACCACCACCTCTGCAGAAAATAGCGGT
CAACTCGAGCACCACCACCACCACCACTGA
2. the building of chicken Cebp γ DNA recombinant expression bacterium BL21 (DE3)-pET30a-gCebp γ-hc
Utilize CaCl2Method enters recombinant plasmid transformed in BL21 (DE3) Escherichia coli, the kanamycins of 50 μ g/mL
(kana) resistance screening.Picking positive bacterium colony after 37 DEG C of culture 4h, collects the bacterium solution of 50 μ L, 100 DEG C of heating 15min, and 12,
000rpm is centrifuged 3min, cracks bacterium solution as template using this, is identified with PCR method.
3. the inducing expression of chicken CEBP γ recombinant protein
Picking PCR detection positive bacteria is inoculated in LB culture medium of the 5mL containing 50 μ g/mL kana, 37 DEG C, 225rpm oscillation
12h is cultivated, is seeded in the fresh LB culture medium of 3mL (kana containing 50 μ g/mL) with the ratio of 1:25 by bacterium solution is cultivated, 37
DEG C, 225rpm shaken cultivation to OD600About 0.6-0.8 adds the IPTG of different final concentrations, continues in 37 DEG C, 225rpm oscillation
4h is cultivated, 100 μ L culture solutions are taken, 12,000rpm centrifugation 3min abandon supernatant, collect thallus, it is slow that 100 μ L 1 × SDS loadings are added
Fliud flushing, 100 DEG C of heating 15min, 12,000rpm centrifugation 3min take supernatant, with 10% SDS-PAGE polyacrylamide gel into
Row electroresis appraisal, as a result as shown in figure 3, the expression quantity of recombinant protein dramatically increases, and day after the optimized processing of Cebp γ gene
Right genetic fragment does not detect the expression of recombinant protein substantially in Escherichia coli.Then respectively with 0.05mmol/L and
IPTG induction BL21 (the DE3)-pET30a-gCebp γ-hc of 1.0mmol/L induces table in (18 DEG C) progress recombinant proteins of low temperature
Up to 12h, the solubility expression detection of recombinant protein is carried out, although as a result as shown in figure 4, recombinant protein major part forms and forgives
Body, but the clearly visible recombinant protein in cracking supernatant, and the resulting soluble recombination egg under 0.05mmol/L inductive condition
It is white to be apparently higher than what 0.1mmol/L was induced.
4. the purifying of chicken CEBP γ recombinant protein
Solubility CEBP γ protein 12 h is expressed in 18 DEG C of induction recombinant bacteriums by the IPTG of 0.05mmol/L, 4 DEG C 12,000g
It is centrifuged 10min, collects bacterial sediment.Then with equilibration buffer (50mmol/L phosphate buffer, 0.5mol/L NaCl,
1mmol/L MgCl2, 80mmol/L imidazoles, 1mmol/L PMSF, 1mmol/L MgCl2, 0.5%Tween-20, pH 7.2) it and will
After cell washing one time, thallus is resuspended with the equilibration buffer (i.e. lysate) containing 2mg/mL lysozyme, on ice oscillation digestion
After 45min, under 550w power, then ultrasound works time 2sec, operation range 4sec, total 10min are stood in ice-water bath
It is primary that above-mentioned ultrasound is repeated after 10min.4 DEG C, 12,000rpm centrifugation 45min;Supernatant collects supernatant with 0.45 μm of membrane filtration.
Balance 10 column volumes of Ni-NTA affinity column are washed with equilibrium liquid, sample is flowed through into the absorption recombination of Ni-NTA affinity column
Albumen removes the foreign protein of non-specific adsorption with the equilibration buffer solution of 10 column volume imidazoles containing 100mmol/L, then
Respectively with containing 150,200,250, eluent (50mmol/L phosphate buffer, the 0.5mol/L NaCl, pH of 300mmol/L imidazoles
7.2) it elutes, collect destination protein.Purification result is as shown in figure 5, Ni-NTA can adsorb the soluble recombination egg in lysate
White, when imidazole concentration reaches 200mmol/L, the recombinant protein of absorption is eluted outflow, and the increase of the concentration with imidazoles, weight
Histone elution increases, and purity is 99% or more.
To chicken CEBP γ recombinant protein Western blot identification after purification, as a result as shown in Figure 6, wherein 1 is BL21
(DE3)-pET 30a blank bacterial strain inducing cracking total protein (control), the 2 cellular lysate total proteins not induced for recombinant bacterium, 3 are
The cellular lysate total protein of recombinant bacterium induction, the 4 cellular lysate supernatants induced for recombinant bacterium, 5 be Ni column purification prick post liquid, and 6 are
Cleaning solution, 7~10 be respectively the imidazole elution of various concentration (imidazole concentration is followed successively by 150,200,250,300mmol/L);
Primary antibody is 6 × His of rabbit-anti polypeptide antibody, and the position that testing result is shown in 20KDa obtains test strip, illustrates the CEBP γ of chicken
The success of recombinant protein expression and purity.
Sequence table
<110>Changshu Institute of Technology
<120>chicken recombinant C EBP γ albumen, its DNA sequences encoding and application
<160> 2
<170> SIPOSequenceListing 1.0
<210> 1
<211> 477
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 1
atgagcaaaa ccagcccgca aaataccgca accgatgcaa acggcgttag cgttatccat 60
acccaagcac atagtagcgg tctgcaacaa gttccgcaac tggttccggt ttctccgggt 120
ggtggcggta aagcagttcc gccgagtaaa cagggcaaaa agaacagctt cgtcgaccgc 180
aactcagacg aatatcgtca gcgtcgcgaa cgtaacaaca tggcggtcaa aaaatcccgc 240
ctgaaaagca aacagaaagc gcaggatacc ctgcaacgcg ttacccaact gaaagaagag 300
aacgagcgcc tggaagcgaa aatcaaactg ctgaccaaag agctgagcgt cctgaaagac 360
ctgtttctgg aacacgcaca tagcctggca gataacgttc aaccggttgg taccgaaagc 420
accaccacct ctgcagaaaa tagcggtcaa ctcgagcacc accaccacca ccactga 477
<210> 2
<211> 156
<212> PRT
<213>artificial sequence (Artificial Sequence)
<400> 2
Met Ser Lys Thr Ser Pro Gln Asn Thr Ala Thr Asp Ala Asn Gly Val
1 5 10 15
Ser Val Ile His Thr Gln Ala His Ser Ser Gly Leu Gln Gln Val Pro
20 25 30
Gln Leu Val Pro Val Ser Pro Gly Gly Gly Gly Lys Ala Val Pro Pro
35 40 45
Ser Lys Gln Gly Lys Lys Asn Ser Phe Val Asp Arg Asn Ser Asp Glu
50 55 60
Tyr Arg Gln Arg Arg Glu Arg Asn Asn Met Ala Val Lys Lys Ser Arg
65 70 75 80
Leu Lys Ser Lys Gln Lys Ala Gln Asp Thr Leu Gln Arg Val Thr Gln
85 90 95
Leu Lys Glu Glu Asn Glu Arg Leu Glu Ala Lys Ile Lys Leu Leu Thr
100 105 110
Lys Glu Leu Ser Val Leu Lys Asp Leu Phe Leu Glu His Ala His Ser
115 120 125
Leu Ala Asp Asn Val Gln Pro Val Gly Thr Glu Ser Thr Thr Thr Ser
130 135 140
Ala Glu Asn Ser Gly Gln His His His His His His
145 150 155
Claims (7)
1. a kind of DNA sequence dna for encoding chicken recombinant C EBP γ albumen, which is characterized in that its nucleotide sequence such as SEQ ID NO:1
It is shown.
2. a kind of recombinant expression carrier containing chicken recombinant C EBP γ protein DNA sequence described in claim 1.
3. a kind of transgenosis recombinant escherichia coli strain containing chicken recombinant C EBP γ protein DNA sequence described in claim 1.
4. application of the chicken recombinant C EBP γ protein DNA sequence described in claim 1 in preparation chicken SIRT1 recombinant protein.
5. a breeder recombinant C EBP γ albumen, which is characterized in that amino acid sequence is as shown in SEQ ID NO:2.
6. the preparation method of chicken recombinant C EBP γ albumen described in claim 5, which comprises the following steps:
(1) according to chicken Cebp γ gene encode amino acid polypeptide sequence, preferences of combining cipher in Escherichia coli and
The analysis of RNA secondary structure optimizes the cDNA segment of chicken Cebp γ gene;
(2) pET30a-gCebp γ-hc recombinant expression carrier is constructed with the segment synthesized in step (1);
(3) BL21 (DE3)-pET30a-gCebp γ-hc recombinant bacterial strain is constructed;
(4) inducing expression, purifying and the identification of chicken CEBP γ recombinant protein.
7. application of the chicken CEBP γ recombinant protein in terms of production described in claim 5.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201910304047.XA CN110004153A (en) | 2019-04-16 | 2019-04-16 | Chicken recombinant C EBP γ albumen, its DNA sequences encoding and application |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201910304047.XA CN110004153A (en) | 2019-04-16 | 2019-04-16 | Chicken recombinant C EBP γ albumen, its DNA sequences encoding and application |
Publications (1)
Publication Number | Publication Date |
---|---|
CN110004153A true CN110004153A (en) | 2019-07-12 |
Family
ID=67172199
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CN201910304047.XA Pending CN110004153A (en) | 2019-04-16 | 2019-04-16 | Chicken recombinant C EBP γ albumen, its DNA sequences encoding and application |
Country Status (1)
Country | Link |
---|---|
CN (1) | CN110004153A (en) |
Cited By (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO2022121509A1 (en) * | 2020-12-11 | 2022-06-16 | 石河子大学 | Transcription factor c/ebpz for regulating adipocyte formation and application of transcription factor |
CN115028705A (en) * | 2022-05-09 | 2022-09-09 | 常熟理工学院 | HNF6 polypeptide fragment and expression and purification method thereof |
Citations (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO2004028339A2 (en) * | 2002-09-27 | 2004-04-08 | Brigham And Women's Hospital, Inc. | Treatment of patients with multiple sclerosis based on gene expression changes in central nervous system tissues |
-
2019
- 2019-04-16 CN CN201910304047.XA patent/CN110004153A/en active Pending
Patent Citations (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO2004028339A2 (en) * | 2002-09-27 | 2004-04-08 | Brigham And Women's Hospital, Inc. | Treatment of patients with multiple sclerosis based on gene expression changes in central nervous system tissues |
Non-Patent Citations (4)
Title |
---|
BAGLIA LA: "CCAAT/enhancer-binding protein gamma [Gallus gallus]", 《ACCESSION:NP_996741》 * |
徐小静: "《生物技术原理与实验》", 31 July 2005, 中央民族大学出版社 * |
王晓佳: "《蛋白质技术在病毒学研究中的应用》", 31 August 2015 * |
王秀利等: "《基因工程》", 31 March 2014, 华中科技大学出版社 * |
Cited By (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO2022121509A1 (en) * | 2020-12-11 | 2022-06-16 | 石河子大学 | Transcription factor c/ebpz for regulating adipocyte formation and application of transcription factor |
CN115028705A (en) * | 2022-05-09 | 2022-09-09 | 常熟理工学院 | HNF6 polypeptide fragment and expression and purification method thereof |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
US20230167421A1 (en) | Variants of a DNA Polymerase of the Polx Family | |
Nishimiya et al. | Co‐operative effect of the isoforms of type III antifreeze protein expressed in Notched‐fin eelpout, Zoarces elongatus Kner | |
CN108239633B (en) | Mutant of D-psicose-3-epimerase with improved catalytic activity and application thereof | |
CN110643612B (en) | Trachinotus ovatus antimicrobial peptide NK-lysin gene and application thereof | |
CN111394333B (en) | Ochratoxin detoxification enzyme, and coding gene, recombinant vector and application thereof | |
CN112851792B (en) | Preparation method and application of grass carp TNF-alpha recombinant protein | |
CN110004153A (en) | Chicken recombinant C EBP γ albumen, its DNA sequences encoding and application | |
CN109402134A (en) | A kind of preparation method and applications of the engineering bacteria of high efficient expression growth hormone | |
CN103409400A (en) | Beta-elemene synthetase, encoding gene thereof, carrier, engineering bacterium and application of beta-elemene synthetase | |
CN110564756A (en) | method for prokaryotic expression of recombinant chicken angiopoietin-like protein 4 and application thereof | |
CN112322599B (en) | Transaminase UPTA, preparation method and application | |
CN113234132A (en) | Scylla paramamosain C-type lectin and preparation method and application thereof | |
CN101525617A (en) | Eriocheir sinensis Crustin-1 gene and in-vitro recombination expression | |
CN114478776B (en) | Polyclonal antibody for resisting chicken TLR15 protein and preparation method thereof | |
CN107602686B (en) | Polypeptide with resistance to gram-positive bacteria | |
CN109371047A (en) | Method for constructing and expressing heat-resistant antibacterial peptide fusion protein by using protein IHF- α | |
CN101705231A (en) | Apis cerana royal jelly antibacterial peptide AccRoyalisin gene and encoded polypeptide thereof and application thereof | |
CN114908113A (en) | Preparation method of human interleukin-5 recombinant protein | |
CN112522222B (en) | Novel tryptophan hydroxylase mutant and application thereof | |
CN107254472A (en) | HEGF's hEGF gene optimization sequences and its preparation method and application | |
CN110819645B (en) | Fancy carp Gtpch2 gene, coded protein and application thereof | |
CN106119258A (en) | Wax insect Antifreeze protein gene ep afp and the aminoacid sequence of coding thereof | |
CN106929512A (en) | The preparation of ST2 antigens and its own coding DNA molecular | |
CN111607575A (en) | Transaminase PHTA, preparation method and application | |
Xie et al. | Expression of cecropin CMIV fusion protein in E. coli under T7 promoter |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
PB01 | Publication | ||
PB01 | Publication | ||
SE01 | Entry into force of request for substantive examination | ||
SE01 | Entry into force of request for substantive examination | ||
RJ01 | Rejection of invention patent application after publication |
Application publication date: 20190712 |
|
RJ01 | Rejection of invention patent application after publication |