CN110819645B - Fancy carp Gtpch2 gene, coded protein and application thereof - Google Patents
Fancy carp Gtpch2 gene, coded protein and application thereof Download PDFInfo
- Publication number
- CN110819645B CN110819645B CN201911021373.6A CN201911021373A CN110819645B CN 110819645 B CN110819645 B CN 110819645B CN 201911021373 A CN201911021373 A CN 201911021373A CN 110819645 B CN110819645 B CN 110819645B
- Authority
- CN
- China
- Prior art keywords
- gtpch2
- gene
- koi
- protein
- race
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/14—Hydrolases (3)
- C12N9/78—Hydrolases (3) acting on carbon to nitrogen bonds other than peptide bonds (3.5)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/70—Vectors or expression systems specially adapted for E. coli
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y305/00—Hydrolases acting on carbon-nitrogen bonds, other than peptide bonds (3.5)
- C12Y305/04—Hydrolases acting on carbon-nitrogen bonds, other than peptide bonds (3.5) in cyclic amidines (3.5.4)
- C12Y305/04025—GTP cyclohydrolase II (3.5.4.25)
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
- G01N33/573—Immunoassay; Biospecific binding assay; Materials therefor for enzymes or isoenzymes
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N2333/00—Assays involving biological materials from specific organisms or of a specific nature
- G01N2333/90—Enzymes; Proenzymes
- G01N2333/914—Hydrolases (3)
- G01N2333/978—Hydrolases (3) acting on carbon to nitrogen bonds other than peptide bonds (3.5)
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A40/00—Adaptation technologies in agriculture, forestry, livestock or agroalimentary production
- Y02A40/80—Adaptation technologies in agriculture, forestry, livestock or agroalimentary production in fisheries management
- Y02A40/81—Aquaculture, e.g. of fish
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Engineering & Computer Science (AREA)
- Genetics & Genomics (AREA)
- Organic Chemistry (AREA)
- Wood Science & Technology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Biomedical Technology (AREA)
- Zoology (AREA)
- General Engineering & Computer Science (AREA)
- Biotechnology (AREA)
- Biochemistry (AREA)
- Molecular Biology (AREA)
- General Health & Medical Sciences (AREA)
- Microbiology (AREA)
- Immunology (AREA)
- Medicinal Chemistry (AREA)
- Physics & Mathematics (AREA)
- Urology & Nephrology (AREA)
- Hematology (AREA)
- Cell Biology (AREA)
- Plant Pathology (AREA)
- Biophysics (AREA)
- Food Science & Technology (AREA)
- Analytical Chemistry (AREA)
- General Physics & Mathematics (AREA)
- Pathology (AREA)
- Peptides Or Proteins (AREA)
- Preparation Of Compounds By Using Micro-Organisms (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The invention discloses a fancy carpGtpch2Gene, coded protein and application thereof, belonging to the technical field of genetic engineering. The technical scheme of the invention is as follows: fancy carpGtpch2Gene, the koiGtpch2The nucleotide sequence of the gene is shown as SEQ ID NO. 2, and the koi is also disclosed as containing the koiGtpch2Recombinant expression vector of gene, recombinant strain and application thereof in detection of fishGtpch2Immunoblotting and immunohistochemical applications. The invention clones and obtains the fancy carp for the first timeGtpch2Gene, constructing expression vector and recombinant colibacillus strain with the gene, obtaining large amount of expressed koi carp in vitro with recombinant colibacillus strainGtpch2The protein can be used for immunohistochemical and immunoblotting and other histoimmunological experiments, detection and analysisGtpch2Expression and localization in proteinfish tissue.
Description
Technical Field
The invention belongs to the technical field of genetic engineering, and in particular relates to a koi carpGtpch2Genes, coded proteins and applications thereof.
Background
Body color is one of the important phenotypic traits of fish, formed by pigment cells. The type, number and distribution of pigment cells in fish skin and scales affect the body color. Pigment cells are formed by differentiation of ectodermal neural crest cells. During embryonic development, neural crest cells differentiate into different types of cells including pigment cells along the dorsiflexion axis. The fish has six pigment cells, including melanocytes, red pigment cells, yellow pigment cells, iridescent cells, blue pigment cells and white pigment cells, relative to mammals having only one type of melanocytes. Pteridine metabolic pathway is carried out on zebra fishDanio rerio) Flower-mixing killiformPoecilia reticulata) The fish are an important metabolic pathway for regulating and controlling the body color change. The end products of the pteridine metabolic pathway are yellow and reddish pteridine pigments. The dish pyridine is a heterocyclic complex composed of pyrimidine and pyrazine rings, and can be classified into pterin and Huang Suliang types according to structures. The pteridine pigments are obtained by converting GTP serving as a substrate through the pathway, and Gtpch (GTP cyclohydrolase) is a key enzyme of the pteridine synthesis pathway and plays an important role in regulating and controlling the synthesis of pigments such as yellow pigment, pteridine, drosophila pterin and the like. Gtpch is involved in three pathways for the synthesis of BH4 and pteridine pigment compounds: de novo synthesis of BH4, a salvage synthesis pathway for oxidizing BH4 and participation in the production of yellow purine pigment/red pteridine pigment.
Koi carp (fancy carp)Cyprinus carpiovar. Koi) belonging to the family CypriridaeCyprinidae) The carp belongs toCyprinus) The animal model has rich body color and diversified combination forms, is popular, and is an important model animal for researching the color change of fish and even vertebrates. All koi strains are basically bred by hybridizationObtained. However, the properties of the fancy carp bred by hybridization are very unstable, and few fancy carp individuals with higher ornamental value are obtained. The Gtpch protein is involved in the production of yellow purine pigment/red pteridine pigment. By analysis ofGtpch2The function of the gene determines the function of the gene in the formation of the yellow pigment and the red pigment of the fancy carp, is favorable for directionally culturing the fancy carp with stable body color genetic characters, reduces the breeding cost of the fancy carp, improves the ornamental value of ornamental fishes, and has important significance for the fancy carp and even ornamental fish breeding industry.
Disclosure of Invention
The invention aims to provide a fancy carpGtpch2Gene, recombinant expression vector containing gene, recombinant strain and application of recombinant expression vector and recombinant strain in detection of fishGtpch2Immunoblotting、Application in immunohistochemistry and tissue localization distribution.
The invention adopts the following technical proposal to realize the purposes thatGtpch2A gene characterized in that: the fancy carpGtpch2The nucleotide sequence of the gene is shown as SEQ ID NO. 2.
The invention clones fancy carpGtpch2Genes, and a 3'UTR and a part of 5' UTR were obtained. The cloning method is a conventional gene cloning method, degenerate primers are designed by utilizing the gene alignment of homologous species, a middle fragment is obtained after PCR, then two downstream primers of 5'RACE and two upstream primers of 3' RACE are respectively designed according to the sequence of the middle fragment, and 5 'and 3' nested PCR is carried out by utilizing universal primers UPM-L and UPM-S to obtainGtpch2Is selected from the group consisting of ORF, 5'UTR and 3' UTR. Finally, designing a primer for cloning the ORF, and connecting the target gene to a pMD-19 vector after PCR to obtain pMD-19-gtpch2。
The invention constructs a fancy carp-containing foodgtpch2Is expressed by the escherichia coli expression vector, the construction method of the vector is to utilize the vector pMD-19 which is constructed by the method per se according to the conventional methodgtpch2The koi carp with enzyme digestion joint is synthesized by a PCR method by taking the koi carp as a templateGtpch2The gene is cut, separated and purified and then is connected between BamH I and Sac I which are the corresponding cutting sites of the existing vector pET32a, thus the required fancy carp-containing gene is constructedGtpch2Gene expression vector pET32a-gtpch2。
The inventionThe above materials are used for treating common carpGtpch2Construction of corresponding expression vector of gene for high efficiency expression of koigtpch2E.coli recombinant strain of the gene.
The invention can express the fancy carpGtpch2The colibacillus recombinant strain is prepared from cyprinus carpioGtpch2Gene expression vector pET32a-gtpch2A strain obtained by transforming E.coli BL21 was designated pET32a-gtpch2-BL21。
The invention also provides a method for producing koi carp by using the escherichia coli recombinant strainGtpch2Is a method of (2). Inoculating the strain into LB liquid medium, culturing at 37 ℃ for 200 r/min until OD600 reaches 0.4-0.6, adding IPTG to a final concentration of 1mM, culturing at 37 ℃ for 4 hours at 200 r/min, centrifuging at 5000g for 10min to collect thalli, ultrasonically crushing, centrifuging at 12000g for 10min to collect supernatant, and separating and purifying to obtain recombinant koi Gtpch2 protein.
The fancy carp has higher economic value, and the common genetic engineering technology can be utilizedgtpch2Gene recombinant strain pET32a-gtpch2BL21, the recombinant koi Gtpch2 protein is produced, and the distribution and the positioning of the Gtpch2 protein in fish tissues can be further detected by an immunohistochemical and immunoblotting method.
Compared with the prior art, the invention has the following beneficial effects:
the invention clones and obtains the fancy carp for the first timeGtpch2Gene, constructing expression vector and recombinant colibacillus strain with the gene, obtaining large amount of expressed koi carp in vitro with recombinant colibacillus strainGtpch2The protein can be used for immunohistochemical and immunoblotting and other histoimmunological experiments, detection and analysisGtpch2Expression and localization in proteinfish tissue.
Drawings
FIG. 1 shows PCR amplification using reverse transcription cDNA of cotton carp as templateGtpch2Gel electrophoresis analysis of the ORF product, wherein M: a Marker;1 and 2: PCR amplification products;
FIG. 2 is a PCR electrophoretogram of 5'RACE and 3' RACE; a is a gel electrophoresis pattern of the 5' RACE first round product, where M: a Marker;1: PCR amplification products; b is the first round of 3' RACEGel electrophoresis diagram of the material, wherein M: a Marker;1: PCR amplification products; c is a gel electrophoresis pattern of the 5' RACE second round product, wherein M: a Marker;1: PCR amplification products; d is a cloneGtpch2Gel electrophoresis diagram of intermediate fragment products, wherein M: a Marker;1: PCR amplification products; e is a gel electrophoresis pattern of the 3' RACE second round product, wherein M: a Marker;1: PCR amplification products;
FIG. 3A shows the site with cleavageGtpch2In (2), wherein M: a Marker; 1. 2: PCR amplification products; b is an electrophoresis identification chart of PCR amplification products; c is recombinant plasmid pET32a-gtpch2Is characterized by a gel electrophoresis analysis chart, wherein M: a Marker;1: pET32a-gtpch2BamH I and SacI double enzyme digestion; 2: pET32a-gtpch2Enzyme cutting is not performed;
FIG. 4A shows recombinant pET32a-gtpch2BL21 expression productsGtpch2SDS-PAGE electrophoretic analysis of (C), wherein: m: protein markers; 1: no load; 2: non-induced bacterial liquid; 3: recombinant strain pET32agtpch2-BL21 expression product; 4: purified recombinant strain pET32a-gtpch2-BL21 expression product; b is a Western blot detection Gtpch2 antiserum identification map; wherein M: protein markers; 1. 2 and 3 are the expressions of Gtpch2 in fin, scale and skin of pure red koi; 4. 5, 6 are the expressions of Gtpch2 in the fin, scale and skin of the koi; c is recombinant koiGtpch2The monoclonal antibody ECL color chart of (c).
Detailed Description
The above-described matters of the present invention will be described in further detail by way of examples, but it should not be construed that the scope of the above-described subject matter of the present invention is limited to the following examples, and all techniques realized based on the above-described matters of the present invention are within the scope of the present invention.
Example 1
Gtpch2Cloning of Gene intermediate fragments
For reported nile tilapiaOreochromis niloticus) Sword tail fish（Xiphophorus maculatus）A kind of beautiful medakaPoecilia formosa) Zebra fishDanio rerio) Obtained in (3)Gtpch2Sequencing intoLine alignment, find relatively conserved regions, design gram Long JinliGtpch2A pair of degenerate primers for the middle segment of the sequence, the upstream primer being 5'GGCAGAACTGAACGGTTTGT 3' and the downstream primer being 5'CTCCACGCATGACCATACAC 3'; and (3) performing PCR by using cDNA subjected to reverse transcription of the total RNA of the koi as a template. The PCR conditions were: 94 ℃ for 3min;94 ℃ for 30s,60 ℃ for 30s,72 ℃ for 2min,35 cycles; 72 ℃ for 5min;4 ℃ is infinity. The gel electrophoresis pattern after the PCR reaction is shown in FIG. 1.
Example 2
Gtpch2Genes 5'RACE and 3' RACE
Two primers, 5'RACE and 3' RACE, were designed based on the intermediate fragment sequences that had been obtained and used the universal primers UPM-L and UPM-S, respectively.
The 5' race out primers were:
AAP：5'ACATCGTAGATGGTCTCGTGGTAGC 3'、
the 5' RACE in primers were:
R1：5'ACTGTCAGCTCGCTAAAGCCGTTAC3'；
the 3' race out primers were:
F1：5'GATGGTCTCGTGGTAGCCTTTGGTC3'；
3' race in primer:
R1 5'CAAGCTTACTGAGGCCAACGACCTT3'。
and (3) performing PCR by using cDNA subjected to reverse transcription of the total RNA of the koi as a template. The PCR conditions were: 94 ℃ for 3min;94℃30s,56℃30s,72℃60s,35 cycles; 72 ℃ for 10min;4 ℃ is infinity. The gel electrophoresis pattern after the PCR reaction is shown as A, B, C, D, E in FIG. 2.
Example 3
Gtpch2Cloning of ORF
Based on the results of example 1 and example 2, a pair of clones was designedGtpch2The nucleotide sequence of the primer of ORF, the nucleotide sequence of the upstream primer F-ORF is 5 'ATGGAATACCAAGGCGGCAGA 3', the nucleotide sequence of the downstream primer R-ORF is 5 'TCACTTCTGCACGCCACGCATA 3', and cDNA after reverse transcription of the total RNA of koi is used as a template for PCR. The PCR conditions were: 94 ℃ for 3min;94℃30s,61℃30s,72℃2min,35 cycles; 72 ℃ for 2min;12 ℃ is infinity. The obtained product is connected with a pMD-19 vector to form pMD-19-Gtpch2. The gel electrophoresis pattern after the PCR reaction is shown in FIG. 3A.
Example 4
Epinephelus coioides with enzyme cutting sitesGtpch2Gene synthesis
According to fancy carp cloned by oneselfGtpch2The sequence of the gene, the recognition sequences of restriction enzymes BamHI and SacI and the protecting base are designed and synthesized into a pair of specific primers, and the upstream primer F is 5 'CGGGATCCGAGGCGTACACAACCATCCT' 3Gtpch2The BamH I restriction enzyme recognition site and the 6×HIS tag are added before the mature peptide sequence of the gene, and the downstream primer R is 5 'CGAGCTCAAGCTTACTGAGTGAGGCAACGA3' which isGtpch2The protective base and SacI enzyme cleavage recognition site are added after the mature peptide sequence of the gene. By means of self-constructed pMD-19-Gtpch2Performing PCR reaction for the template, wherein the PCR reaction conditions are as follows: 94 ℃ for 3min;94℃for 30s,60℃for 30s,72℃for 2min,35 cycles; 72 ℃ for 5min;12 ℃ is infinity. The electrophoretically identified pattern of PCR amplified products is shown in FIG. 3B.
Example 5
Fancy carpGtpch2Gene E.coli expression vector pET32a-Gtpch2Construction of (3)
The PCR product was digested with the restriction enzymes BamHI and SacI，The cleavage product was cleaved with E.Z.N.A. ® Gel Extraction Kit, separating and purifying the Gtpch2 gene fragment of the koi by agarose gel electrophoresis; the vector plasmid pET32a is subjected to double digestion by restriction enzymes BamH I and SacI, then is separated and purified, is mixed with the separated and purified Epinephelus coioides Gtpch2 gene fragment, is connected with T4 ligase at 16 ℃ overnight, is transferred into escherichia coli DH5a by a standard calcium chloride transformation method, is screened by an LB plate to obtain transformants with Ampicillin resistance, is extracted by a standard method, and is subjected to double digestion by restriction enzymes BamH I and SacI to obtain a large fragment and a small fragment which are respectively matched with the size of the fancy carpGtpch2The gene and the expression vector pET32a have the same size, which proves that the koi isGtpch2The gene is cloned into an escherichia coli expression vector pET32a, and the recombinant plasmid is named pET32a-Gtpch2. The analysis of the enzyme digestion is shown as C in FIG. 3.
Example 6
Can efficiently express fancy carpGtpch2E.coli recombinant strain pET32a-Gtpch2Construction of BL21
The prepared recombinant plasmid pET32a-gtpch2The cells were transformed into competent cells of E.coli BL21 by heat shock and cultured on LB plates containing Ampicillin at 37 ℃. After overnight, growing monoclonal, picking up the monoclonal, and screening out the high-efficiency expression koi by induction culture and identificationGtpch2E.coli recombinant strain pET32a-Gtpch2-BL21。
Example 7
pET32a by using escherichia coli genetic engineering bacteriaGtpch2Production of recombinant koi by BL21Gtpch2
E.coli engineering bacteria pET32a-Gtpch2-BL21 single colony is selected and inoculated in 10ml LB liquid medium, cultured at 37 ℃ for 200 revolutions per minute for overnight, then inoculated in 1L LB liquid medium according to the proportion of 1:100, cultured at 37 ℃ for 200 revolutions per minute until the OD600 is 0.4-0.6, then added with IPTG to make the final concentration of 1mM, cultured at 37 ℃ for 4 hours, centrifuged at 5000g for 10min to collect thalli, centrifuged at 12000g for 10min to collect supernatant after ultrasonic crushing, and the recombinant fancy carp Gtpch2 protein is obtained through separation and purification. Adding 2 Xelectrophoresis loading buffer solution into 3 μl bacterial liquid, boiling for 10min, running SDS-PAGE gel electrophoresis according to standard method, and processing negative control according to the same method. The negative control is a bacterial liquid after monoclonal culture which is grown after BL21 is transformed by empty plasmid pET32 a. The results are shown in FIG. 4 at A. pET32a-Gtpch2BL21 expression after disruption the supernatant was purified by His-bind Resin from Novagen, and the results are shown in FIG. 4A.
And (3) identifying the recombinant koi Gtpch2 protein by adopting an immunoblotting (Western blot) method. The primary antibody was a murine anti-HIS monoclonal antibody (available from Novagen) and the secondary antibody was goat anti-murine IgG-HRP (available from soribao bioengineering limited). The results are shown in FIG. 4B.
Example 8
Recombinant fancy carpGtpch2Monoclonal antibody preparation of (2)
Fancy carpGtpch2Preparation of antisera: to be purifiedGtpch2After the fusion protein and the equal volume Freund's complete adjuvant are thoroughly mixed, each mouse is injected with the fusion protein 300 subcutaneously and intraperitoneallyμg; the immunization was boosted 1 time 4 weeks after the primary immunization, and then the antibody titer was detected by blood sampling of the eyeball after 1 week. Separating serum, and storing at-20deg.C. Western blot detectionGtpch2Antisera: protein extracted from skin, fin and scale of koi is loaded in 25 μg protein amount, and after SDS-PAGE gel electrophoresis, membrane is turned, koi diluted according to 1:100 is added in sequenceGtpch2Polyclonal antibodies and secondary anti-HRP goat anti-mouse IgG, and ECL developed and observed. The results are shown in FIG. 4C.
While the basic principles, principal features and advantages of the present invention have been described in the foregoing examples, it will be appreciated by those skilled in the art that the present invention is not limited by the foregoing examples, but is merely illustrative of the principles of the invention, and various changes and modifications can be made without departing from the scope of the invention, which is defined by the appended claims.
Sequence listing
<110> university of Henan teachers and students
<120> fancy carp Gtpch2 gene, encoding protein and application thereof
<130> 2019
<141> 2019-10-25
<160> 13
<170> SIPOSequenceListing 1.0
<210> 1
<211> 209
<212> PRT
<213> Artificial sequence (artificial sequence)
<400> 1
Met Glu Tyr Gln Lys Ala Ala Glu Leu Asn Gly Leu Cys Asn Gly Lys
1 5 10 15
Ile Val Thr Glu Tyr Leu Cys Arg Asn Gly Phe Ser Glu Leu Thr Val
20 25 30
Asp Ala Lys Lys Val Ala Val Gln His Lys Asn Glu Thr Ser Arg Lys
35 40 45
Glu Ala Glu Asp Glu Ser Arg Leu Pro Ala Leu Glu Glu Ala Tyr Thr
50 55 60
Thr Ile Leu Arg Gly Leu Gly Glu Asn Thr Asp Arg Gln Gly Leu Leu
65 70 75 80
Lys Thr Pro Leu Arg Ala Ala Lys Ala Met Gln Phe Leu Thr Lys Gly
85 90 95
Tyr His Glu Thr Ile Tyr Asp Val Leu Asn Asp Ala Ile Phe Asp Glu
100 105 110
Asp His Glu Glu Leu Val Ile Val Lys Asp Ile Asp Met Glu Thr Phe
115 120 125
Ser Leu Cys Glu His His Leu Val Pro Phe Phe Gly Lys Val His Ile
130 135 140
Gly Tyr Leu Pro Ser Lys Lys Val Val Gly Leu Ser Lys Leu Ala Arg
145 150 155 160
Ile Val Glu Ile Tyr Ser Arg Arg Leu Gln Val Gln Glu Arg Leu Thr
165 170 175
Lys Gln Ile Ala Met Glu Thr Ala Ile Ser Glu Ala Leu Gln Pro Val
180 185 190
Gly Val Ala Val Val Ile Glu Ala Ala Phe Thr Cys Val Trp Leu Cys
195 200 205
Val Ala Cys Arg Arg
210
<210> 2
<211> 630
<212> DNA
<213> Artificial sequence (artificial sequence)
<400> 2
atggaatacc aaaaggcggc agaactgaac ggtttgtgca atggcaaaat tgtcacagag 60
tatctctgcc gtaacggctt tagcgagctg acagtcgatg cgaagaaagt cgccgtacag 120
cacaaaaacg agacatcccg gaaagaggcg gaggatgagt cgcggttacc tgctctggag 180
gaggcgtaca caaccatcct gcgaggtctg ggagagaaca cggaccgaca ggggctcctc 240
aaaaccccgc tccgtgcagc aaaggccatg cagttcctga ccaaaggcta ccacgagacc 300
atctacgatg tccttaatga tgccatcttt gatgaagacc acgaggagct tgttattgtg 360
aaagatattg acatgttttc actttgtgaa catcatctag taccattttt tggcaaggtt 420
cacattggat atctgccaag taaaaaggtc gttggcctca gtaagcttgc aaggattgtt 480
gaaatttaca gtcgcagact tcaagttcaa gagcgcctaa caaagcaaat agcaatggca 540
atctctgagg ccttgcagcc tgtcggtgtg gcagttgtca tcgaggcagc tttcacatgt 600
gtatggttat gcgtggcgtg cagaagatga 630
<210> 3
<211> 20
<212> DNA
<213> Artificial sequence (artificial sequence)
<400> 3
ggcagaactg aacggtttgt 20
<210> 4
<211> 20
<212> DNA
<213> Artificial sequence (artificial sequence)
<400> 4
ctccacgcat gaccatacac 20
<210> 5
<211> 22
<212> DNA
<213> Artificial sequence (artificial sequence)
<400> 5
ctaatacgac tcactatagg gc 22
<210> 6
<211> 45
<212> DNA
<213> Artificial sequence (artificial sequence)
<400> 6
ctaatacgac tcactatagg gcaagcagtg gtatcaacgc agagt 45
<210> 7
<211> 25
<212> DNA
<213> Artificial sequence (artificial sequence)
<400> 7
actgtcagct cgctaaagcc gttac 25
<210> 8
<211> 25
<212> DNA
<213> Artificial sequence (artificial sequence)
<400> 8
gatggtctcg tggtagcctt tggtc 25
<210> 9
<211> 25
<212> DNA
<213> Artificial sequence (artificial sequence)
<400> 9
caagcttact gaggccaacg acctt 25
<210> 10
<211> 23
<212> DNA
<213> Artificial sequence (artificial sequence)
<400> 10
atggaatacc aaaaggcggc aga 23
<210> 11
<211> 23
<212> DNA
<213> Artificial sequence (artificial sequence)
<400> 11
tcatcttctg cacgccacgc ata 23
<210> 12
<211> 28
<212> DNA
<213> Artificial sequence (artificial sequence)
<400> 12
cgggatccga ggcgtacaca accatcct 28
<210> 13
<211> 27
<212> DNA
<213> Artificial sequence (artificial sequence)
<400> 13
cgagctcaag cttactgagg ccaacga 27
Claims (5)
1. Fancy carpGtpch2A gene characterized in that: the fancy carpGtpch2The nucleotide sequence of the gene is shown as SEQ ID NO. 2; the gene is obtained by a gene cloning method, and the specific method comprises the following steps: designing degenerate primers by utilizing gene comparison of homologous species, obtaining an intermediate fragment after PCR, respectively designing two pairs of downstream primers of the 5'RACE specific to the koi and two pairs of upstream primers of the 3' RACE according to the sequence of the intermediate fragment, and performing 5 'and 3' nested PCR by utilizing universal primers UPM-L and UPM-S and the 5'RACE and 3' RACE primers specific to the koi to obtain ORF, 5'UTR and 3' UTR of Gtpch2; finally, designing clone koigtpch2The obtained target gene is connected to a pMD-19 vector to be pMD-19-gtpch2 after PCR; the nucleotide sequences of the two specific downstream primers of 5'RACE and the two specific upstream primers of 3' RACE are shown below, respectively:
the 5' race out primers were:
AAP：5'ACATCGTAGATGGTCTCGTGGTAGC 3'、
the 5' RACE in primers were:
R1：5'ACTGTCAGCTCGCTAAAGCCGTTAC3'；
the 3' race out primers were:
F1：5'GATGGTCTCGTGGTAGCCTTTGGTC3'；
3' race in primer:
R1 5'CAAGCTTACTGAGGCCAACGACCTT3'。
2. a koi according to claim 1Gtpch2The gene coded koi Gtpch2 protein is characterized in that: the amino acid sequence of the koi Gtpch2 protein is shown as SEQ ID NO. 1.
3. A fancy carp comprising the fancy carp of claim 1Gtpch2A recombinant expression vector of a gene, characterized in that: the recombinant expression vector is an expression vector pET32a-Gtpch2 containing a gene for encoding the protein Gtpch2 of the koi.
4. A koi according to claim 3Gtpch2The application of the recombinant expression vector of the gene in the preparation of the recombinant koi Gtpch2 protein is characterized in that the preparation process of the recombinant koi Gtpch2 protein is as follows: e.coli recombinant strain pET32a-Gtpch2-BL21 obtained by transforming E.coli BL21 with expression vector pET32a-Gtpch2 containing gene for encoding koi Gtpch2 protein; inoculating the recombinant strain into LB liquid medium, culturing at 37deg.C for 20 r/min until OD600 reaches 0.4-0.6, adding IPTG to a final concentration of 1mM, culturing at 37deg.C for 6 hr at 200 r/min, centrifuging for 10min to collect thallus 5000g, ultrasonically crushing, centrifuging for 10min 12000g to collect supernatant, and separating and purifying to obtain recombinant fancy carpGtpch2And (3) protein.
5. Use of the koi Gtpch2 protein according to claim 2 for detecting fish Gtpch2 immunoblots and immunohistochemistry for detecting and analyzing expression and localization in fish tissue of Gtpch2 protein.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201911021373.6A CN110819645B (en) | 2019-10-25 | 2019-10-25 | Fancy carp Gtpch2 gene, coded protein and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201911021373.6A CN110819645B (en) | 2019-10-25 | 2019-10-25 | Fancy carp Gtpch2 gene, coded protein and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN110819645A CN110819645A (en) | 2020-02-21 |
| CN110819645B true CN110819645B (en) | 2023-08-15 |
Family
ID=69550813
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201911021373.6A Active CN110819645B (en) | 2019-10-25 | 2019-10-25 | Fancy carp Gtpch2 gene, coded protein and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN110819645B (en) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110714017B (en) * | 2019-11-06 | 2023-09-01 | 河南师范大学 | Koi ptps gene, coded protein and application |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US5846775A (en) * | 1997-04-22 | 1998-12-08 | Incyte Pharmaceuticals, Inc. | GTP cyclohydrolase I regulatory protein |
| CN107937408A (en) * | 2017-10-24 | 2018-04-20 | 中山大学 | Epinephelus coioides insulin genes, encoding proteins and its application |
| CN109942694A (en) * | 2019-04-03 | 2019-06-28 | 河南师范大学 | Grass carp Akirin1 gene, coding albumen and its application |
| CN110055259A (en) * | 2019-05-09 | 2019-07-26 | 河南师范大学 | Grass carp Akirin2 gene, coding albumen and its application |
-
2019
- 2019-10-25 CN CN201911021373.6A patent/CN110819645B/en active Active
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US5846775A (en) * | 1997-04-22 | 1998-12-08 | Incyte Pharmaceuticals, Inc. | GTP cyclohydrolase I regulatory protein |
| CN107937408A (en) * | 2017-10-24 | 2018-04-20 | 中山大学 | Epinephelus coioides insulin genes, encoding proteins and its application |
| CN109942694A (en) * | 2019-04-03 | 2019-06-28 | 河南师范大学 | Grass carp Akirin1 gene, coding albumen and its application |
| CN110055259A (en) * | 2019-05-09 | 2019-07-26 | 河南师范大学 | Grass carp Akirin2 gene, coding albumen and its application |
Non-Patent Citations (1)
| Title |
|---|
| GenBank.NCBI Reference Sequence: XP_026078455.1.GenBank.2018,序列. * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN110819645A (en) | 2020-02-21 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| KR100316347B1 (en) | Recombinant microorganisms expressing a fusion protein of Escherichia coli enterotoxin II signal peptide and fusion protein of human growth hormone and a method of producing human growth hormone using the same | |
| CN112851792B (en) | Preparation method and application of grass carp TNF-alpha recombinant protein | |
| CN110551732A (en) | Trachinotus ovatus antimicrobial peptide LEAP-2 gene and application thereof | |
| CN101302526A (en) | Recombinant soluble streptococcus hemolyticus haemolysin O gene, recombinant protein and preparation thereof | |
| CN110819645B (en) | Fancy carp Gtpch2 gene, coded protein and application thereof | |
| CN107937408B (en) | Epinephelus coioidesinsulinGene, encoded protein and application thereof | |
| CN109942694A (en) | Grass carp Akirin1 gene, coding albumen and its application | |
| CN108892718B (en) | Epinephelus coioides antibacterial peptide and application thereof | |
| CN108840951A (en) | A kind of fusion protein and preparation method thereof being made of pig albumin, Porcine interferon-gamma and porcine interferon alpha | |
| CN103864939A (en) | mGM-CSF/beta hCG fusion protein, and preparation method and application thereof | |
| EP0377540A1 (en) | Recombinant fish hormone proteins | |
| CN108840934B (en) | Recombinant sheep long-acting interferon tau, fusion protein for preparing long-acting interferon tau and preparation method of fusion protein | |
| CN110714017B (en) | Koi ptps gene, coded protein and application | |
| CN110055259A (en) | Grass carp Akirin2 gene, coding albumen and its application | |
| CN113683707B (en) | Antigen fusion protein, encoding gene and application thereof | |
| CN102121010B (en) | Takifugu obscures B lymphocyte stimulating factor cDNA and cloning method and recombination application thereof | |
| CN108864305A (en) | A kind of fusion protein and preparation method thereof being made of sheep albumin, sheep interferon gamma and sheep interferon-tau | |
| CN108794645A (en) | A kind of fusion protein and preparation method thereof being made of bovine albumin, Bov IFN γ and Bov IFN α | |
| CN108794644A (en) | A kind of fusion protein and preparation method thereof being made of cattle interleukins-2 2, Bov IFN γ and Bov IFN α | |
| CN109706160A (en) | Recombinant human protein's kinases Nek2 Protein expression and purification method | |
| CN109694858A (en) | A kind of phytic acid enzyme mutant | |
| CN114621959B (en) | Gene for encoding paralichthys olivaceus IGF2 soluble protein, protein recombinant expression method and application | |
| CN113943355B (en) | Weever rhabdovirus G2-2M recombinant protein and application thereof | |
| CN114106142B (en) | Monopteri albi growth prolactin antiserum and preparation method and application thereof | |
| CN101880320B (en) | Neuropeptide Y nucleotide sequence of epinephelus coioides and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |