CN110564756A - method for prokaryotic expression of recombinant chicken angiopoietin-like protein 4 and application thereof - Google Patents
method for prokaryotic expression of recombinant chicken angiopoietin-like protein 4 and application thereof Download PDFInfo
- Publication number
- CN110564756A CN110564756A CN201910899778.3A CN201910899778A CN110564756A CN 110564756 A CN110564756 A CN 110564756A CN 201910899778 A CN201910899778 A CN 201910899778A CN 110564756 A CN110564756 A CN 110564756A
- Authority
- CN
- China
- Prior art keywords
- concentration
- protein
- angptl4
- recombinant
- chicken
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61D—VETERINARY INSTRUMENTS, IMPLEMENTS, TOOLS, OR METHODS
- A61D7/00—Devices or methods for introducing solid, liquid, or gaseous remedies or other materials into or onto the bodies of animals
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/475—Growth factors; Growth regulators
- C07K14/515—Angiogenesic factors; Angiogenin
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/70—Vectors or expression systems specially adapted for E. coli
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2319/00—Fusion polypeptide
- C07K2319/20—Fusion polypeptide containing a tag with affinity for a non-protein ligand
- C07K2319/21—Fusion polypeptide containing a tag with affinity for a non-protein ligand containing a His-tag
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Genetics & Genomics (AREA)
- Engineering & Computer Science (AREA)
- Organic Chemistry (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- General Health & Medical Sciences (AREA)
- Biophysics (AREA)
- Molecular Biology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- Biochemistry (AREA)
- Biotechnology (AREA)
- Biomedical Technology (AREA)
- Veterinary Medicine (AREA)
- Public Health (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Medicinal Chemistry (AREA)
- Physics & Mathematics (AREA)
- Animal Behavior & Ethology (AREA)
- Toxicology (AREA)
- Vascular Medicine (AREA)
- Plant Pathology (AREA)
- Gastroenterology & Hepatology (AREA)
- Microbiology (AREA)
- Peptides Or Proteins (AREA)
Abstract
The invention provides a method for prokaryotic expression of recombinant chicken ANGPTL4 protein, which comprises the following steps: (1) artificially synthesizing a gene sequence of recombinant chicken ANGPTL4, constructing the gene sequence into a prokaryotic expression vector, and constructing a recombinant prokaryotic expression vector; (2) transforming the recombinant prokaryotic expression vector into escherichia coli E.coli competent cells, and screening positive colonies; (3) carrying out amplification culture on the single colony of the recombinant positive plasmid, and adding an inducer for induction expression; (4) adopting a dilution renaturation method to carry out inclusion body renaturation; (5) purifying the inclusion body renaturation protein. According to the invention, the prokaryotic expression vector of the recombinant chicken ANGPTL4 is constructed, so that the recombinant chicken ANGPTL4 is efficiently expressed in escherichia coli, the expressed recombinant protein exists in the form of inclusion bodies, and the correct folding of the protein is promoted and the expression quantity of the fusion protein is improved through inclusion body renaturation and renaturation protein purification. The recombinant chicken ANGPTL4 protein can regulate the fat metabolism of broiler chickens, and provides a good test material for the development of the functional research of chicken ANGPTL4 in the future.
Description
Technical Field
The invention relates to the technical field of biology, in particular to a method for prokaryotic expression of recombinant chicken angiopoietin-like protein 4 and application thereof.
background
With the wide use of feed additives and the continuous improvement of the nutritional level of feed, the fat deposition capacity of broiler chickens is gradually increased, but the medium connecting nutritional factors with broiler chicken fat metabolism and the action mechanism thereof are not clear at present. Angiopoietin-like protein 4 (ANGPTL 4), also known as PPAR angiopoietin-related protein and fasting inducing factor, is a secreted protein with high biological activity, and its secretion can be influenced by microorganisms and fasting factors. In recent years, research shows that when the conditioned medium with different ANGPTL4 is used for culturing the human liver cancer cell line HepG2, the expression of genes related to fat metabolism in the cells can be changed, and in addition, the content of ANGPTL4 in the blood of broiler chickens can be changed along with the change of fat metabolism capability of the broiler chickens.
Therefore, the ANGPTL4 is suspected to have the function of changing the fat metabolism of the broiler chickens and can be used as a medium for connecting nutritional factors with the fat metabolism of the broiler chickens. Recombinant ANGPTL4 protein products expressed by a eukaryotic expression system (HEK293) are available on mice and humans, but the ANGPTL4 protein sequence and other species have low homology on chickens, so that the inventors try to use the eukaryotic expression system (HEK293) to express recombinant chicken ANGPTL4 without success, and at present, the report of successful expression of recombinant chicken ANGPTL4 protein is not available.
The invention obtains the recombinant chicken ANGPTL4 protein by a prokaryotic expression method, and the obtained recombinant chicken ANGPTL4 protein can regulate the fat metabolism of broilers: the lipolysis in the fat tissues of the broilers is increased, the lipolysis of the breast muscles of the broilers is promoted, the FAS mRNA expression and the enzyme activity of the livers of the broilers are improved, the MTTP mRNA expression of the livers is reduced, good test materials are provided for the development of the functional research of the chicken ANGPTL4 in the future, and meanwhile, theoretical basis is provided for the elucidation of the action mechanism of the chicken ANGPTL4 in the fat metabolism regulation and control of the broilers.
Disclosure of Invention
The invention provides a method for prokaryotic expression of recombinant chicken ANGPTL4 protein, which realizes the high-efficiency expression of recombinant chicken ANGPTL4 in Escherichia coli E.coli by constructing a prokaryotic expression vector pET21a-His-SUMO-ANGPTL4 of recombinant chicken ANGPTL4, wherein the expressed recombinant protein exists in the form of inclusion bodies, and high-concentration mesh protein with biological activity is obtained by inclusion body renaturation and renaturation protein purification; the recombinant chicken ANGPTL4 protein can regulate the fat metabolism of broiler chickens.
the invention provides a method for prokaryotic expression of recombinant chicken ANGPTL4 protein, which comprises the following steps:
(1) Artificially synthesizing a gene sequence of recombinant chicken ANGPTL4, constructing the gene sequence into a prokaryotic expression vector, and constructing a recombinant prokaryotic expression vector;
(2) Transforming the recombinant prokaryotic expression vector into escherichia coli E.coli competent cells, and screening positive colonies;
(3) Carrying out amplification culture on the single colony of the recombinant positive plasmid, and adding an inducer for induction expression;
(4) adopting a dilution renaturation method to carry out inclusion body renaturation;
(5) purifying the inclusion body renaturation protein.
The recombinant chicken ANGPTL4 gene sequence comprises a His-SUMO gene sequence and a chicken ANGPTL4 gene sequence, and the recombinant chicken ANGPTL4 gene sequence is shown as SEQ ID No.1 or SEQ ID No. 2.
In the embodiment of the invention, the gene sequence of the recombinant chicken ANGPTL4 protein is as follows:
ATGGGTCATCATCACCATCATCATGGTAGCCTGCAGGATAGCGAAGTTAATCAAGAAGCAAAACCGGAAGTTAAGCCGGAAGTGAAACCTGAAACACATATTAACCTGAAAGTGAGTGATGGCAGCAGCGAAATCTTCTTCAAAATCAAAAAAACCACACCGCTGCGTCGTCTGATGGAAGCATTTGCAAAACGTCAGGGTAAAGAAATGGATAGCCTGCGTTTTCTGTATGATGGTATTCGTATTCAGGCAGATCAGGCACCGGAAGATCTGGATATGGAAGATAACGATATTATCGAAGCACATCGTGAGCAGATTGGTGGTGCAGGTCCGGCACCTGGCACAGGTCGTGCAGGCACCGAACGTCGTACCGCAGCAGCCGGTGGTAAAGAACGTCGTGCACAGTTTGCAAGCTGGGATGAAGTTAATGTTATTGCACATGGTCTGCTGCAGTTAGGTCATGGTCTGAAAGAACATGTTGATCGTACCAAAGGTCAGATGCGTGAACTGGGTAGCCGTCTGAGCGCACATAATAGCAGCATGGGTCGTCTGCTGCGTCAGGCACGTGAAACCCAAGAACAGGGTGAACTGCTGCGTGCAAGCGTGCGCGAACTGGAAGGTCGTGGTCGTCAGCTGTTTAATCTGAGCGAAGCACTGCGTCAGCGTCTGGAAGAAGTTGCAGCAGATAAAGCAGAAATTCAGGGTCGCCTGGAACAGCTGGAAGGCCGTGTTCGCCAGGCACTGCAGGCACGTCCGGCAGAAAATCAGAGCAGCAAAGATCTGGGTGCACTGCAGACCCTGATGGATGCACAGAATAGCCGTATTGAAGAACTGCTTCAGAAGATCAAACAGCAGCAGTATAAACTGGATAAACAGAACCTGCAGATTAAAAGCCTGCAGAGCAAAGTTAATCTGCTGATTCCGCTGCATCCGAAAGATAACAAAACCCAGAGTCCGAAATGGAAAATCAACCCGAAAAAAAGCTTTAGCCATACCAATCAGAGCCATAATGTTAGCGTTGAACCGGCACTGCCGCATAAACTGCCGGAAGATTGTCAGCAGCTGTTTCTGGCAGGTCAGCAGAGCAGTGGTGTTTTTCAGGTTCAGCCGAGCGGTAGCCAGCCGTTTAAAGTTTATTGTGATATGACCGCAGAAGGTGGTTGGACCGTTATTCAGCGTCGCACCGATGGTAGCGTGGATTTTGATCAGCTGTGGGATGCCTATAAAAACGGTTTTGGTGATCTGCATGGCGATTTTTGGCTGGGCTTAGAAAAAATTCATCATCTGGTTCAAGAGGGTCGTTATGACCTGCTGATTGAGCTGGAAGATTGGGAAGGTAATAGCCAAGAAATCCAGTTTGAATTTAGCTTAGGTGGTGAAAGCACCGCATATACCCTGAATCTGCTGGGTCCTCTGAGCGGTGAACTGGAAAATGCAATTGGTGATTTTCGCCAGCTGCCGTTTAGCACCCGTGATCGTGATCATGACCTGAAAGCAGATACCAATTGTGCAAAACATCTGAGTGGTGGTTGGTGGTTTAGTACCTGTGGTCATGCAAATCTGAACGGTAAATACTTTCGTAGCATTCCGCGTCAGCGCCATGAACGTAAACAGGGTATTTTTTGGAAAACCTGGAAAGGTCGTTACTATCCGCTGAAAAGTACCACCATGAAAATTCAGCCTGCAGCACTGGAAGCAGAACCGTAA(SEQ ID NO.1)
or the like, or, alternatively,
ATGGGTCATCATCACCATCATCATGGTAGCCTGCAGGATAGCGAAGTTAATCAAGAAGCAAAACCGGAAGTTAAGCCGGAAGTGAAACCTGAAACACATATTAACCTGAAAGTGAGTGATGGCAGCAGCGAAATCTTCTTCAAAATCAAAAAAACCACACCGCTGCGTCGTCTGATGGAAGCATTTGCAAAACGTCAGGGTAAAGAAATGGATAGCCTGCGTTTTCTGTATGATGGTATTCGTATTCAGGCAGATCAGGCACCGGAAGATCTGGATATGGAAGATAACGATATTATCGAAGCACATCGTGAGCAGATTGGTGGTGGTAGCGCAGGTCCGGCACCTGGCACAGGTCGTGCAGGCACCGAACGTCGTACCGCAGCAGCCGGTGGTAAAGAACGTCGTGCACAGTTTGCAAGCTGGGATGAAGTTAATGTTATTGCACATGGTCTGCTGCAGTTAGGTCATGGTCTGAAAGAACATGTTGATCGTACCAAAGGTCAGATGCGTGAACTGGGTAGCCGTCTGAGCGCACATAATAGCAGCATGGGTCGTCTGCTGCGTCAGGCACGTGAAACCCAAGAACAGGGTGAACTGCTGCGTGCAAGCGTGCGCGAACTGGAAGGTCGTGGTCGTCAGCTGTTTAATCTGAGCGAAGCACTGCGTCAGCGTCTGGAAGAAGTTGCAGCAGATAAAGCAGAAATTCAGGGTCGCCTGGAACAGCTGGAAGGCCGTGTTCGCCAGGCACTGCAGGCACGTCCGGCAGAAAATCAGAGCAGCAAAGATCTGGGTGCACTGCAGACCCTGATGGATGCACAGAATAGCCGTATTGAAGAACTGCTTCAGAAGATCAAACAGCAGCAGTATAAACTGGATAAACAGAACCTGCAGATTAAAAGCCTGCAGAGCAAAGTTAATCTGCTGATTCCGCTGCATCCGAAAGATAACAAAACCCAGAGTCCGAAATGGAAAATCAACCCGAAAAAAAGCTTTAGCCATACCAATCAGAGCCATAATGTTAGCGTTGAACCGGCACTGCCGCATAAACTGCCGGAAGATTGTCAGCAGCTGTTTCTGGCAGGTCAGCAGAGCAGTGGTGTTTTTCAGGTTCAGCCGAGCGGTAGCCAGCCGTTTAAAGTTTATTGTGATATGACCGCAGAAGGTGGTTGGACCGTTATTCAGCGTCGCACCGATGGTAGCGTGGATTTTGATCAGCTGTGGGATGCCTATAAAAACGGTTTTGGTGATCTGCATGGCGATTTTTGGCTGGGCTTAGAAAAAATTCATCATCTGGTTCAAGAGGGTCGTTATGACCTGCTGATTGAGCTGGAAGATTGGGAAGGTAATAGCCAAGAAATCCAGTTTGAATTTAGCTTAGGTGGTGAAAGCACCGCATATACCCTGAATCTGCTGGGTCCTCTGAGCGGTGAACTGGAAAATGCAATTGGTGATTTTCGCCAGCTGCCGTTTAGCACCCGTGATCGTGATCATGACCTGAAAGCAGATACCAATTGTGCAAAACATCTGAGTGGTGGTTGGTGGTTTAGTACCTGTGGTCATGCAAATCTGAACGGTAAATACTTTCGTAGCATTCCGCGTCAGCGCCATGAACGTAAACAGGGTATTTTTTGGAAAACCTGGAAAGGTCGTTACTATCCGCTGAAAAGTACCACCATGAAAATTCAGCCTGCAGCACTGGAAGCAGAACCGTAA(SEQ ID NO.2)
in the step (1): the prokaryotic expression vector is pET21a (+), and the constructed recombinant prokaryotic expression vector is pET21a-His-SUMO-ANGPTL 4.
In the step (3), the inducer is isopropyl-beta-D-thiogalactoside; preferably, the concentration of the isopropyl-beta-D-thiogalactoside is 0.1mmol/L-1mmol/L, and the induction temperature is 16 ℃ to 37 ℃.
The dilution renaturation method in the step (4) comprises the following specific steps:
(1) After the target protein is induced to express, fully washing the inclusion body by using a washing buffer solution, centrifuging to take a precipitate, solubilizing by using a solubilizing buffer solution, centrifuging to take a supernatant for inclusion body renaturation;
the washing buffer solution is a Tris-HCl buffer solution containing NaCl, EDTA and TritonA-100, the pH value is 8.0, the concentration of the Tris-HCl buffer solution is 20mmol/L, the concentration of the NaCl is 50mmol/L, the concentration of the EDTA is 5mmol/L, and the volume concentration of the Triton X-100 is 1%;
The solubilization buffer solution is a Tris-HCl buffer solution containing Gua-HCl and DTT, the pH value is 8.0, the concentration of the Tris-HCl buffer solution is 50mmol/L, the concentration of Gua-HCl is 6mol/L, and the concentration of DTT is 10 mmol/L;
(2) dropwise adding the inclusion body solubilization solution into a renaturation buffer solution, and carrying out renaturation at 4 ℃ for 24 h;
preferably, the renaturation buffer solution contains NaCl, KCl and MgCl2、CaCl2The pH of the phosphate buffer solution of sucrose, arginine, Triton X-100, GSH and GSSG is 6.5, the concentration of the phosphate buffer solution is 20mmol/L, the concentration of NaCl is 240mmol/L, and the concentration of KCl is 10mmol/L, MgCl2The concentration is 2mmol/L, CaCl2the concentration is 2mmol/L, the sucrose concentration is 0.4mol/L, the arginine concentration is 0.5mol/L, the volume concentration of Triton X-100 is 0.05%, and the GSH concentration is 1mmol/L, GSSG and is 0.1 mmol/L.
The renaturation protein purification of step (5) uses a chemical SFF affinity chromatography column, and the specific steps are as follows: balancing the column with a balance buffer solution, eluting the target protein with an imidazole-containing elution buffer solution, and collecting the eluate;
The balance buffer solution is Tris-HCl buffer solution containing NaCl, the pH value is 8.0, the concentration of the Tris-HCl buffer solution is 20mmol/L, and the concentration of the NaCl is 500 mmol/L;
The elution buffer solution is a Tris-HCl buffer solution containing NaCl and imidazole, the pH value is 8.0, the concentration of the Tris-HCl buffer solution is 20mmol/L, the concentration of NaCl is 500mmol/L, and the concentration of imidazole is 50-500 mmol/L; preferably, the concentration of the imidazole is 500 mmol/L;
Preferably, the collected eluate components are dialyzed into Tris-HCl buffer solution containing NaCl, glycerol and DTT, wherein the concentration of the Tris-HCl buffer solution is 20mmol/L, the concentration of the NaCl is 500mmol/L, the volume concentration of the glycerol (glycerol) is 10% and the concentration of the DTT is 1mmol/L, and the pH value is 8.5, so that the recombinant chicken ANGPTL4 fusion protein is obtained.
The invention also provides the inclusion body or the recombinant chicken ANGPTL4 protein prepared by the method.
The amino acid sequence of the recombinant chicken ANGPTL4 protein is shown as SEQ ID NO.3 or SEQ ID NO. 4.
In the embodiment of the invention, the amino acid sequence of the recombinant chicken ANGPTL4 protein is as follows:
MGHHHHHHGSLQDSEVNQEAKPEVKPEVKPETHINLKVSDGSSEIFFKIKKTTPLRRLMEAFAKRQGKEMDSLRFLYDGIRIQADQAPEDLDMEDNDIIEAHREQIGGAGPAPGTGRAGTERRTAAAGGKERRAQFASWDEVNVIAHGLLQLGHGLKEHVDRTKGQMRELGSRLSAHNSSMGRLLRQARETQEQGELLRASVRELEGRGRQLFNLSEALRQRLEEVAADKAEIQGRLEQLEGRVRQALQARPAENQSSKDLGALQTLMDAQNSRIEELLQKIKQQQYKLDKQNLQIKSLQSKVNLLIPLHPKDNKTQSPKWKINPKKSFSHTNQSHNVSVEPALPHKLPEDCQQLFLAGQQSSGVFQVQPSGSQPFKVYCDMTAEGGWTVIQRRTDGSVDFDQLWDAYKNGFGDLHGDFWLGLEKIHHLVQEGRYDLLIELEDWEGNSQEIQFEFSLGGESTAYTLNLLGPLSGELENAIGDFRQLPFSTRDRDHDLKADTNCAKHLSGGWWFSTCGHANLNGKYFRSIPRQRHERKQGIFWKTWKGRYYPLKSTTMKIQPAALEAEP(SEQ ID NO.3)
Or the like, or, alternatively,
MGHHHHHHGSLQDSEVNQEAKPEVKPEVKPETHINLKVSDGSSEIFFKIKKTTPLRRLMEAFAKRQGKEMDSLRFLYDGIRIQADQAPEDLDMEDNDIIEAHREQIGGGSAGPAPGTGRAGTERRTAAAGGKERRAQFASWDEVNVIAHGLLQLGHGLKEHVDRTKGQMRELGSRLSAHNSSMGRLLRQARETQEQGELLRASVRELEGRGRQLFNLSEALRQRLEEVAADKAEIQGRLEQLEGRVRQALQARPAENQSSKDLGALQTLMDAQNSRIEELLQKIKQQQYKLDKQNLQIKSLQSKVNLLIPLHPKDNKTQSPKWKINPKKSFSHTNQSHNVSVEPALPHKLPEDCQQLFLAGQQSSGVFQVQPSGSQPFKVYCDMTAEGGWTVIQRRTDGSVDFDQLWDAYKNGFGDLHGDFWLGLEKIHHLVQEGRYDLLIELEDWEGNSQEIQFEFSLGGESTAYTLNLLGPLSGELENAIGDFRQLPFSTRDRDHDLKADTNCAKHLSGGWWFSTCGHANLNGKYFRSIPRQRHERKQGIFWKTWKGRYYPLKSTTMKIQPAALEAEP(SEQ ID NO.4)
The invention also provides application of the recombinant chicken ANGPTL4 protein in regulation of broiler fat metabolism.
The invention also provides a method for regulating fat metabolism of broiler chickens, which comprises the step of injecting the recombinant chicken ANGPTL4 protein into the broiler chickens intravenously; preferably, the dose of the recombinant ANGPTL4 protein is 20ng/kg-12500 ng/kg.
the invention fuses chicken ANGPTL4 protein and His-SUMO label, realizes the high-efficiency expression of recombinant chicken ANGPTL4 in Escherichia coli E.coli by constructing prokaryotic expression vector pET21a-His-SUMO-ANGPTL4 of recombinant chicken ANGPTL4, the expressed recombinant protein exists in the form of inclusion body, and the target protein with biological activity is obtained by inclusion body renaturation and renaturation protein purification, and the concentration is as high as 0.1 mg/mL.
The recombinant chicken ANGPTL4 protein can regulate the fat metabolism of broiler chickens and promote the fat decomposition of broiler chickens pectoralis:
1. the recombinant protein can increase lipolysis in broiler adipose tissues in a fasting state, can obviously improve the contents of VLDL, TG and NEFA in broiler serum, and has the effect of increasing the contents of TG, VLDL and NEFA in the blood by a primary linear curve and a secondary curve along with the increase of the injection concentration of recombinant chicken ANGPTL4 protein;
2. The recombinant protein provided by the invention can be used for remarkably improving the NEFA content of broiler chicken serum, has the functions of improving the expression of ATGL mRNA of broiler chicken breast muscle and reducing the expression of LPL mRNA of the breast muscle, and can be used for promoting the lipolysis of the broiler chicken breast muscle.
3. The chicken ANGPTL4 recombinant protein has the effects of improving chicken liver FAS mRNA expression and enzyme activity and reducing liver ME and ACC mRNA expression: as the injection concentration of recombinant chicken ANGPTL4 protein increased, hepatic FAS mRNA expression exhibited a linear and quadratic curve increasing effect, and hepatic ACC mRNA expression exhibited a linear and quadratic curve decreasing effect;
The recombinant ANGPTL4 protein provided by the invention can obviously improve the activity of liver FAS enzyme of broiler chicken, and the activity of liver FAS enzyme presents the effect of increasing a primary linear curve and a secondary curve along with the increase of the injection concentration of recombinant chicken ANGPTL4 protein.
4. the chicken ANGPTL4 recombinant protein has the function of reducing the expression of liver MTTP mRNA.
Drawings
In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings used in the description of the embodiments or the prior art will be briefly described below, it is obvious that the drawings in the following description are only some embodiments of the present invention, and for those skilled in the art, other drawings can be obtained according to the drawings without creative efforts.
FIG. 1-double restriction enzyme identification of recombinant plasmid pET21a-His-SUMO-ANGPTL 4.
FIG. 2 shows the SDS-PAGE result of the recombinant chicken ANGPTL4 protein expressed by 3 hours at 37 ℃, Lane A is not induced into the whole bacteria; lane B-induced whole bacteria (B1, B2, B3 are 3 different positive clones); lane C, lysis supernatant; lane D, cracking and precipitating; MK is protein molecular weight marker.
FIG. 3 shows the SDS-PAGE result of the overnight expression of recombinant chicken ANGPTL4 protein induced at 16 deg.C, Lane A is not induced into the whole bacteria; lane B-induced whole bacteria (B1, B2, B3 are 3 different positive clones); lane C, lysis supernatant; lane D, cracking and precipitating; MK is protein molecular weight marker.
FIG. 4 shows the results of Ni column purification (SDS-PAGE), Lane A: loading; lane B, flow through; lane C20 mmol/L imidazole elution; lane D, E, 50mmol/L imidazole elution; lane F, G, H, 500mmol/L imidazole; MK is protein molecular weight marker.
FIG. 5 Effect of recombinant chicken ANGPTL4 protein on serum NEFA levels.
FIG. 6 shows the effect of recombinant chicken ANGPTL4 protein on expression of genes related to fat metabolism of broiler breast muscle.
FIG. 7. effect of recombinant chicken ANGPTL4 protein on broiler chicken pectoralis HSL enzyme activity.
FIG. 8 shows the effect of recombinant chicken ANGPTL4 protein on the expression of genes related to the fat metabolism of broiler chicken liver.
FIG. 9 shows the effect of recombinant chicken ANGPTL4 protein on the activity of enzyme related to fat metabolism of broiler chicken liver.
Detailed Description
The technical solutions in the embodiments of the present invention will be clearly and completely described below with reference to the drawings in the embodiments of the present invention, and it is obvious that the described embodiments are only a part of the embodiments of the present invention, and not all of the embodiments. All other embodiments, which can be derived by a person skilled in the art from the embodiments given herein without making any creative effort, shall fall within the protection scope of the present invention.
Materials, reagents and the like used in the following examples are commercially available unless otherwise specified. The experimental procedures in the following examples are, unless otherwise specified, conventional in the art.
Prokaryotic expression vectors pET21a (+), E.coli BL21(DE3) were purchased from Shanghai offshore science and technology, Inc.; restriction enzymes Nde I and Xho I, plasmid extraction kit were purchased from TaKaRa corporation.
Example 1 preparation of recombinant Chicken ANGPTL4 protein
Searching an amino acid sequence (the serial number is F1NUQ4) and a signal peptide part (1-18 amino acids) of chicken ANGPTL4 by UniProt, removing the signal peptide, adding a His-SUMO label at the N end, comparing the preference codons of escherichia coli, modifying a gene sequence for encoding the His-SUMO-ANGPTL4 according to the degeneracy of codons on the basis of not changing the amino acid composition and the arrangement sequence, replacing the codon with the codon favored by the escherichia coli to obtain a new gene sequence (SEQ ID NO.2) for encoding the His-SUMO-ANGPTL4, wherein the protein amino acid sequence is SEQ ID NO.4, sending the Weijie (Shanghai) trade company for whole-gene synthesis, and constructing a pET21a (+) expression vector by using Nde I and Xho I enzyme cutting sites.
2. Transformation of the expression Strain
The recombinant prokaryotic expression plasmid pET21a-His-SUMO-ANGPTL4 was transformed into E.coli BL21(DE3) competent cells, and cultured overnight in an inverted culture at 37 ℃ on LB solid medium containing 50. mu.g/mL ampicillin. Selecting a single colony with better growth vigor, inoculating the single colony in an LB liquid culture medium, carrying out shake culture on a shaking table at 37 ℃, extracting recombinant plasmids, carrying out Nde I and Xho I double enzyme digestion identification (figure 1), submitting a clone with correct enzyme digestion identification to the sequencing of Weijie Jie base (Shanghai) trade company Limited, wherein the sequencing result is completely consistent with the designed His-SUMO-ANGPTL4 gene sequence.
3. induced expression of positive recombinant bacteria
a single colony containing the recombinant positive plasmid was selected and inoculated into 1mL of LB medium (Amp 50. mu.g/mL), cultured overnight at 37 ℃ and 180rpm, amplified by 1% (v/v) the next day, cultured at 37 ℃ and 180rpm to OD600 nminduction was performed with different concentrations of isopropyl- β -D-thiogalactoside (IPTG) added 0.6-0.8. The induction conditions were set as follows: the concentration of IPTG is 1mmol/L, the induction temperature is 37 ℃, and the induction time is 3 h; IPTG concentration 0.1mmol/L, induction temperature 16 deg.C, induction overnight.
After protein expression was induced according to the above conditions, the collected cells were suspended in buffer PBS and sonicated at 4 ℃ until the solution was clear. After centrifugation at 12000rpm for 20min, the supernatant and the precipitate were separated and analyzed by SDS-PAGE. After 1h of staining with Coomassie brilliant blue staining solution, the solution is placed in a destaining solution for destaining for several hours until the blue background disappears.
SDS-PAGE results (FIGS. 2 and 3) showed that there were 1 distinct protein bands after induction compared to the mycoprotein before induction. After the induced bacterial liquid is subjected to ultrasonic crushing, supernatant and sediment are respectively taken for SDS-PAGE analysis, and most of recombinant protein is shown in the sediment, which shows that the target protein is mainly expressed in an inclusion body form.
4. Renaturation of inclusion bodies
After the target protein is induced to express, the inclusion body is fully washed by using a washing buffer solution, the sediment is obtained by centrifugation, the solubilization buffer solution is used for solubilization, and the supernatant is obtained by centrifugation and is used for inclusion body renaturation.
The washing buffer solution is a Tris-HCl buffer solution containing NaCl, EDTA (ethylene diamine tetraacetic acid) and TritonX-100, the pH value is 8.0, the concentration of the Tris-HCl buffer solution is 20mmol/L, the concentration of NaCl is 50mmol/L, the concentration of EDTA is 5mmol/L, and the volume concentration of Triton X-100 is 1%;
The solubilization buffer solution is Tris-HCl buffer solution containing Gua-HCl (guanidine hydrochloride) and DTT (dithiothreitol), the pH is 8.0, the concentration of the Tris-HCl buffer solution is 50mmol/L, the concentration of Gua-HCl is 6mol/L, and the concentration of DTT is 10 mmol/L.
The inclusion body renaturation adopts a dilution renaturation method: 2mL of inclusion body solubilization solution is added dropwise into 100mL of renaturation buffer solution, and the mixture is placed at 4 ℃ for renaturation for 24 h.
the renaturation buffer solution contains NaCl, KCl and MgCl2、CaCl2Sucrose, arginine, Triton X-100, GSH (glutathione), GSSG (oxidized glutathione) phosphate buffer solution with pH of 6.5, concentration of phosphate buffer solution of 20mmol/L, concentration of NaCl of 240mmol/L, and concentration of KCl of 10mmol/L, MgCl2The concentration is 2mmol/L, CaCl2the concentration is 2mmol/L, the sucrose concentration is 0.4mol/L, the arginine concentration is 0.5mol/L, the volume concentration of Triton X-100 is 0.05%, and the GSH concentration is 1mmol/L, GSSG and is 0.1 mmol/L.
5. Purification of renaturated proteins
and (3) purifying the renatured protein (the pH of the buffer solution is adjusted to 8.0) by using a chemical SFF (Ni) affinity chromatographic column, balancing the column by using an equilibrium buffer solution, eluting the target protein by using elution buffer solutions with gradient imidazole concentrations respectively, collecting eluent, and carrying out SDS-PAGE detection.
The balance buffer solution is Tris-HCl buffer solution containing NaCl, the pH value is 8.0, the concentration of the Tris-HCl buffer solution is 20mmol/L, and the concentration of the NaCl is 500 mmol/L;
The elution buffer solution is Tris-HCl buffer solution containing NaCl and imidazole, the pH value is 8.0, the concentration of the Tris-HCl buffer solution is 20mmol/L, the concentration of NaCl is 500mmol/L, and the concentration of imidazole is 20/50/500 mmol/L.
SDS-PAGE showed that elution with imidazole at 50 and 500mmol/L gave a protein band corresponding to the expected protein (65kDa), but that elution with imidazole at 500mmol/L gave a protein amount of more than 50mmol/L imidazole (FIG. 4), and thus elution of the protein of interest with imidazole at 500mmol/L gave a protein of interest.
Dialyzing 500mmol/L imidazole elution components into Tris-HCl buffer solution with pH of 8.5 and containing NaCl, glycerol and DTT, wherein the concentration of the Tris-HCl buffer solution is 20mmol/L, the concentration of the NaCl is 500mmol/L, the volume concentration of the glycerol (glycerol) is 10%, and the concentration of the DTT is 1mmol/L, namely obtaining the recombinant chicken ANGPTL4 fusion protein, and determining the protein concentration to be 0.1mg/mL by using a Bradford method. The final yield of the protein of interest was 0.1mg/mL × 4mL — 0.4 mg.
Example 2 influence of recombinant chicken ANGPTL4 protein with different concentrations on biochemical indexes of blood of broilers
1. Design of experiments
36 AA roosters with 35 days of age and similar body weight under a healthy fasting state (fasting state for 12h) are selected for the test, and are randomly divided into 6 treatments, wherein each treatment is 6 times of repetition, and each treatment is 1 chicken of repetition. The treatment of each group comprises the steps of respectively injecting recombinant chicken ANGPTL4 protein 0,20,100,500,2500 and 12500ng/kg intravenously according to the weight of broiler chickens, collecting fasting blood of test broiler chickens 30min after injection, separating serum, preserving at-20 ℃, determining blood biochemical indexes such as Triglyceride (TG), Total Cholesterol (TC), High Density Lipoprotein (HDL) and Low Density Lipoprotein (LDL) by a full-automatic biochemical analyzer, determining the content of Very Low Density Lipoprotein (VLDL) by an enzyme-linked immunoassay method, and determining the content of free fatty acid (NEFA) by a free fatty acid test kit (Nanjing institute of bioengineering).
2. Statistical analysis of data
Data were analyzed using one-way ANOVA in SAS 9.2 software and multiple comparisons were performed using Duncan's method. The treatment effect of different recombinant chicken ANGPTL4 protein levels is analyzed by linear regression and quadratic curve regression by adopting an orthogonal polynomial analysis method. P <0.05 was significantly different.
3. Results
as can be seen from Table 1, intravenous injection of recombinant chicken ANGPTL4 protein has no significant effect on TC, HDL and LDL contents in blood of broilers (P > 0.05). However, the blood VLDL content of the group with 2500ng/kg recombinant chicken ANGPTL4 protein and 12500ng/kg recombinant chicken ANGPTL4 protein is obviously improved compared with that of the control group (P <0.05), and the blood TG and NEFA content of the group with 12500ng/kg recombinant chicken ANGPTL4 protein is obviously improved compared with that of the control group (P < 0.05). As the concentration of recombinant chicken ANGPTL4 protein injection was increased from 0 to 12500ng/kg, the blood TG, VLDL and NEFA levels all exhibited a linear and quadratic curve increasing effect (P < 0.05).
TABLE 1 Effect of different concentrations of recombinant chicken ANGPTL4 protein on biochemical indicators of blood of broilers
The non-letter or data shoulder marks the same letter on the same row to indicate that the difference is not significant (P >0.05), and the different lower case letters to indicate that the difference is significant (P < 0.05). The following table is the same.
Serum lipids and lipoproteins can reflect the stability of the body's metabolism, and in particular, the basic regulation of fatty acid circulation between adipose tissue and the liver. Most of the lipid transport in blood is in the form of lipoproteins, in which HDL is mainly involved in reverse transport of TC, LDL is mainly involved in transport of endogenous TC, and VLDL is mainly involved in transport of endogenous TG and TC. According to the invention, the high VLDL content in the broiler blood serum of 2500 and 12500ng/kg recombinant chicken ANGPTL4 protein group and the high TG content in the broiler blood serum of 12500ng/kg recombinant chicken ANGPTL4 protein group indicate that the intravenous injection of a certain dose of recombinant chicken ANGPTL4 protein can influence the transport of broiler TG in blood in a fasting state. The reason for this may be that ANGPTL4 has an inhibitory effect on LPL enzyme activity, resulting in a hindrance to LPL's ability to catalyze the hydrolysis of TG carried by VLDL in blood to glycerol and fatty acids. NEFA is mainly produced by hydrolysis of TG in adipose tissue, and its concentration can reflect lipolytic activity in adipose tissue. According to the invention, the high NEFA content in the serum of the broiler chicken in the 12500ng/kg recombinant chicken ANGPTL4 proteome shows that the lipolysis in the fat tissue of the broiler chicken in the fasting state can be increased by injecting a certain dose of recombinant chicken ANGPTL4 protein intravenously.
Example 3 Effect of recombinant Chicken ANGPTL4 protein on skeletal muscle fat metabolism of broiler chickens
The research shows that the purpose can be achieved by adding clostridium butyricum, but the molecular mechanism of the clostridium butyricum is not clear. The ANGPTL4 is a protein closely related to animal skeletal muscle fat metabolism, and is an important vector for connecting intestinal microorganisms and host skeletal muscle fat metabolism, and animal experiments of the inventor in the early period find that Clostridium butyricum can cause the reduction of the ANGPTL4 level in ileum and serum of broilers, so that the ANGPTL4 is presumed to play an important role in the directionality of the Clostridium butyricum to improve the content of the skeletal muscle fat of the broilers. To further confirm the hypothesis, the test part takes prokaryotic expression recombinant chicken ANGPTL4 protein as a main research object, and the animal test is used for intensively researching the influence of ANGPTL4 on the skeletal muscle fat metabolism of broilers.
1. Design of experiments
18 healthy AA roosters with similar weight at 35 days of age are selected for the test and are randomly divided into 3 treatments, each treatment is 6 times repeated, and each treatment is 1 chicken. Group 1 was treated with i.v. sterile saline, group 2 was treated with i.v. His-SUMO tag, and group 3 was treated with i.v. chicken ANGPTL4 recombinant protein (12.5 μ g/kg body weight). Collecting fasting blood of the broiler chickens to be tested and separating serum at-1 d and 30min of the test respectively, wherein the serum is used for measuring the content of TG, TC and NEFA in the serum; the jugular vein is killed by bleeding at 30min of the test, and a right pectoral tissue sample at the same part is quickly frozen by liquid nitrogen and stored at-80 ℃ for measuring the gene expression and the enzyme activity related to fat metabolism.
2. Statistical analysis of data
Data were analyzed using One-way ANOVA in SAS 9.2 software, multiple comparisons were performed using Duncan's method, and test data were expressed as mean ± standard error. P <0.05 was significantly different.
3. Results
3.1 Effect of recombinant Chicken ANGPTL4 protein on serum NEFA content
As can be seen from FIG. 5, after 12.5. mu.g/kg of chicken ANGPTL4 recombinant protein was injected intravenously for 30min according to the weight of broiler chickens, the broiler chicken serum NEFA content was significantly increased (P <0.05), but there was no significant difference between the His-SUMO tag group and the normal saline group in the broiler chicken serum NEFA content (P > 0.05).
3.2 Effect of chicken ANGPTL4 recombinant protein on expression of related gene of fat metabolism of broiler breast muscle
As can be seen from fig. 6, after 12.5 μ g/kg of chicken ANGPTL4 recombinant protein was intravenously injected for 30min according to the weight of broiler chickens, the broiler breast muscle ATGL mRNA expression was significantly improved (P <0.05) compared to broiler chickens injected with physiological saline and His-SUMO tags, and the broiler breast muscle LPL mRNA expression was significantly reduced (P <0.05) compared to broiler chickens injected with physiological saline and His-SUMO tags, but the broiler breast muscle ATGL and LPL mRNA expression difference between physiological saline and His-SUMO tag groups was not significant (P > 0.05). The expression of CPT1mRNA of broiler chicken breast muscle is remarkably improved by intravenous injection of chicken ANGPTL4 recombinant protein and His-SUMO label (P is less than 0.05), but the difference of the expression of CPT1mRNA of broiler chicken breast muscle between chicken ANGPTL4 recombinant protein and His-SUMO label is not significant (P is more than 0.05).
3.3 Effect of chicken ANGPTL4 recombinant protein on broiler chicken pectoralis HSL enzyme Activity
As can be seen from FIG. 7, both the ANGPTL4 recombinant protein and the His-SUMO tag of the intravenous injection chicken had no significant effect on the HSL enzyme activity of the breast muscle of broiler chicken (P > 0.05).
4. Discussion of the related Art
Since NEFA is mainly produced by hydrolysis of triglyceride in adipose tissue, and its concentration can reflect the lipolytic activity in adipose tissue, in the study of the effect of ANGPTL4 on skeletal muscle fat metabolism of broilers by intravenous injection of chicken ANGPTL4 recombinant protein into chickens, serum NEFA was first selected as an index for screening the optimal injection dose of chicken ANGPTL4 recombinant protein, and it was finally determined that the broiler serum NEFA content was significantly increased 30min after intravenous injection of 12.5 μ g/kg of chicken ANGPTL4 recombinant protein according to the weight of broilers (see table 1 data of example 2). In order to exclude the influence of the His-SUMO label on the chicken ANGPTL4 recombinant protein, the experiment of the embodiment establishes a physiological saline group, a His-SUMO label group and a chicken ANGPTL4 recombinant protein (12.5 mug/kg of body weight) group, and the chicken serum NEFA is measured 30min after injection, and as a result, the chicken ANGPTL4 recombinant protein group has obviously improved chicken serum NEFA content, but the chicken NEFA content of the His-SUMO label group and the physiological saline group has no obvious difference, and further proves that the chicken ANGPTL4 recombinant protein is a substance influencing the generation of the chicken serum NEFA, and as NEFA is an important index of reaction lipolysis, the chicken ANGPTL4 recombinant protein of 12.5 mug/kg of body weight is used as the injection dosage for the research of the influence of ANGPTL4 on the metabolism of the chicken skeletal muscle fat, and the His-SUMO label group is established to exclude the influence of the His-SUMO label.
HSL, ATGL, CPT1, CPT2, LCAD, H-FABP, A-FABP and LPL in skeletal muscles of broilers are important enzymes and genes related to fat decomposition and fatty acid intake of the skeletal muscles of broilers, so that the enzymes and the genes are selected as main indexes reflecting the influence of ANGPTL4 on fat metabolism of the skeletal muscles of broilers in the test. The result shows that the chicken ANGPTL4 recombinant protein has the functions of improving the expression of ATGL mRNA of broiler chicken breast muscle and reducing the expression of LPL mRNA of the breast muscle, and excludes the potential influence of His-SUMO label. At present, reports about the influence of ANGPTL4 on the skeletal muscle fat metabolism of broilers are rare. Because ATGL plays a leading role in the step of hydrolyzing TG into DG and is a key enzyme for decomposing skeletal muscle fat into fatty acid of broiler chickens, the high serum NEFA content of the broiler chickens in the ANGPTL4 recombinant protein group is probably closely related to the fact that the ANGPTL4 improves the ATGL mRNA expression of the breast muscles of the broiler chickens, namely, the fat decomposition of the breast muscles of the broiler chickens is promoted.
Example 4 Effect of recombinant Chicken ANGPTL4 protein on liver fat metabolism of broiler chickens
Influence of recombinant chicken ANGPTL4 protein with different concentrations on broiler liver fat metabolism
1. design of experiments
36 AA roosters with 35 days of age and similar body weight under a healthy fasting state (fasting state for 12h) are selected for the test, and are randomly divided into 6 treatments, wherein each treatment is 6 times of repetition, and each treatment is 1 chicken of repetition. The groups are treated according to the weight of broiler chickens, recombinant chicken ANGPTL4 protein 0,20,100,500,2500 and 12500ng/kg are injected into the veins respectively, the groups are killed by bleeding from the jugular vein 30min after injection, and right liver tissue samples of the same parts are taken to be quick-frozen by liquid nitrogen and stored at the temperature of minus 80 ℃ for measuring the gene expression and the enzyme activity related to fat metabolism.
2. Statistical analysis of data
Data were analyzed using one-way ANOVA in SAS 9.2 software and multiple comparisons were performed using Duncan's method. The treatment effect of different recombinant chicken ANGPTL4 protein levels is analyzed by linear regression and quadratic curve regression by adopting an orthogonal polynomial analysis method. P <0.05 was significantly different.
3. Results
3.1 Effect of recombinant chicken ANGPTL4 protein with different concentrations on expression of genes related to fat metabolism of broiler chicken liver
as shown in Table 2, the influence of the recombinant chicken ANGPTL4 protein with different concentrations on the expression of genes related to the fat metabolism of the liver of the broiler chicken can be seen, the intravenous injection of the recombinant chicken ANGPTL4 protein has no significant influence on the expression of ApoB and MTTP mRNA of the liver of the broiler chicken (P is more than 0.05). However, the expression of liver FAS mRNA in 20,100,500 and 2500ng/kg recombinant chicken ANGPTL4 protein groups was significantly improved compared with the control group (P <0.05), the expression of ME mRNA in 100,500 and 2500ng/kg recombinant chicken ANGPTL4 protein groups and the expression of ACC mRNA in 12500ng/kg recombinant chicken ANGPTL4 protein groups was significantly reduced compared with the control group (P < 0.05). As the recombinant chicken ANGPTL4 protein injection concentration increased from 0 to 12500ng/kg, hepatic FAS mRNA expression exhibited a primary linear and quadratic curve increasing effect (P <0.05) and hepatic ACC mRNA expression exhibited a primary linear and quadratic curve decreasing effect (P < 0.05).
Table 2 influence of recombinant chicken ANGPTL4 protein with different concentrations on expression of genes related to fat metabolism of broiler chicken liver
As shown in Table 3, the influence of the recombinant chicken ANGPTL4 protein with different concentrations on the activity of the related enzyme of the fat metabolism of the liver of the broiler chicken can be seen, and the intravenous injection of the recombinant chicken ANGPTL4 protein has no significant influence on the ACCase activity of the liver of the broiler chicken (P > 0.05). However, the liver FAS enzyme activity of the 500ng/kg recombinant chicken ANGPTL4 protein group is obviously improved compared with that of the control group (P < 0.05). As the concentration of recombinant chicken ANGPTL4 protein injection increased from 0 to 12500ng/kg, hepatic FAS enzyme activity exhibited a primary linear and quadratic curve-increasing effect (P < 0.05).
TABLE 3 Effect of different concentrations of recombinant chicken ANGPTL4 protein on the activity of enzymes related to fat metabolism of broiler chicken liver
Second, the recombinant chicken ANGPTL4 protein has influence on the fat metabolism of the liver of the broiler chicken
1. Design of experiments
18 healthy AA roosters with similar weight at 35 days of age are selected for the test and are randomly divided into 3 treatments, each treatment is 6 times repeated, and each treatment is 1 chicken. Group 1 was treated with i.v. sterile saline, group 2 was treated with i.v. His-SUMO tag, and group 3 was treated with i.v. chicken ANGPTL4 recombinant protein (500ng/kg body weight). And (3) killing the jugular vein after 30min of injection by bleeding, taking a liver tissue sample on the right side of the same part, quickly freezing by using liquid nitrogen, and storing at the temperature of-80 ℃ for measuring the gene expression and the enzyme activity related to fat metabolism.
2. Statistical analysis of data
data were analyzed using One-way ANOVA in SAS 9.2 software, multiple comparisons were performed using Duncan's method, and test data were expressed as mean ± standard error. P <0.05 was significantly different.
3. Results
3.1 Effect of chicken ANGPTL4 recombinant protein on expression of genes related to fat metabolism of broiler chicken liver
As can be seen from FIG. 8, after 500ng/kg of chicken ANGPTL4 recombinant protein was intravenously injected for 30min according to the weight of broiler chickens, the expression of broiler liver FAS mRNA was significantly improved (P <0.05) compared with that of broiler chickens injected with physiological saline and His-SUMO tags, but the expression difference of broiler liver FAS mRNA between physiological saline and His-SUMO tag groups was not significant (P > 0.05). Both the intravenous injection of chicken ANGPTL4 recombinant protein and His-SUMO label significantly reduced broiler chicken liver ME mRNA expression (P <0.05), but the difference of broiler chicken liver ME mRNA expression between chicken ANGPTL4 recombinant protein and His-SUMO label was not significant (P > 0.05). After chicken are injected with ANGPTL4 recombinant protein intravenously for 30min, the liver MTTP mRNA expression of the chicken is obviously reduced compared with that of the chicken injected with His-SUMO label (P is less than 0.05).
3.2 Effect of chicken ANGPTL4 recombinant protein on activity of enzyme related to fat metabolism of broiler chicken liver
As can be seen from FIG. 9, after 500ng/kg of chicken ANGPTL4 recombinant protein was intravenously injected for 30min according to the weight of broiler chickens, the broiler liver FAS enzyme activity was significantly improved (P <0.05) compared with that of broiler chickens injected with physiological saline and His-SUMO tags, but the broiler liver FAS enzyme activity difference between physiological saline and His-SUMO tag groups was not significant (P > 0.05).
Third, discuss
FAS, ME, ACC, ApoB and MTTP in the liver of the broiler are important enzymes and genes related to synthesis and transfer of fat in the liver of the broiler, so the enzymes and genes are selected as main indexes for reflecting the influence of ANGPTL4 on fat metabolism of the liver of the broiler in the test. Firstly, through a chicken ANGPTL4 dosage test, the fact that 500ng/kg of chicken ANGPTL4 recombinant protein is injected intravenously according to the weight of broiler chicken is determined to be the optimal injection level for researching the influence of chicken ANGPTL4 on the liver fat metabolism of broiler chicken. Next, in order to exclude the effect of His-SUMO tag on chicken ANGPTL4 recombinant protein, the experiment of this example established a physiological saline group, a His-SUMO tag group, and a chicken ANGPTL4 recombinant protein (500ng/kg body weight) group, and the expression of chicken liver FAS, ME, ACC, ApoB, and MTTP mRNA and the activity of liver FAS and ACC enzyme were measured 30min after injection, and as a result, it was found that, excluding the potential effect of His-SUMO tag, the chicken ANGPTL4 recombinant protein had the effects of increasing chicken liver FAS mRNA expression and enzyme activity, and decreasing liver MTTP mRNA expression.
Sequence listing
<110> Linyi university
<120> method for prokaryotic expression of recombinant chicken angiopoietin-like protein 4 and application thereof
<160> 4
<170> SIPOSequenceListing 1.0
<210> 1
<211> 1707
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 1
atgggtcatc atcaccatca tcatggtagc ctgcaggata gcgaagttaa tcaagaagca 60
aaaccggaag ttaagccgga agtgaaacct gaaacacata ttaacctgaa agtgagtgat 120
ggcagcagcg aaatcttctt caaaatcaaa aaaaccacac cgctgcgtcg tctgatggaa 180
gcatttgcaa aacgtcaggg taaagaaatg gatagcctgc gttttctgta tgatggtatt 240
cgtattcagg cagatcaggc accggaagat ctggatatgg aagataacga tattatcgaa 300
gcacatcgtg agcagattgg tggtgcaggt ccggcacctg gcacaggtcg tgcaggcacc 360
gaacgtcgta ccgcagcagc cggtggtaaa gaacgtcgtg cacagtttgc aagctgggat 420
gaagttaatg ttattgcaca tggtctgctg cagttaggtc atggtctgaa agaacatgtt 480
gatcgtacca aaggtcagat gcgtgaactg ggtagccgtc tgagcgcaca taatagcagc 540
atgggtcgtc tgctgcgtca ggcacgtgaa acccaagaac agggtgaact gctgcgtgca 600
agcgtgcgcg aactggaagg tcgtggtcgt cagctgttta atctgagcga agcactgcgt 660
cagcgtctgg aagaagttgc agcagataaa gcagaaattc agggtcgcct ggaacagctg 720
gaaggccgtg ttcgccaggc actgcaggca cgtccggcag aaaatcagag cagcaaagat 780
ctgggtgcac tgcagaccct gatggatgca cagaatagcc gtattgaaga actgcttcag 840
aagatcaaac agcagcagta taaactggat aaacagaacc tgcagattaa aagcctgcag 900
agcaaagtta atctgctgat tccgctgcat ccgaaagata acaaaaccca gagtccgaaa 960
tggaaaatca acccgaaaaa aagctttagc cataccaatc agagccataa tgttagcgtt 1020
gaaccggcac tgccgcataa actgccggaa gattgtcagc agctgtttct ggcaggtcag 1080
cagagcagtg gtgtttttca ggttcagccg agcggtagcc agccgtttaa agtttattgt 1140
gatatgaccg cagaaggtgg ttggaccgtt attcagcgtc gcaccgatgg tagcgtggat 1200
tttgatcagc tgtgggatgc ctataaaaac ggttttggtg atctgcatgg cgatttttgg 1260
ctgggcttag aaaaaattca tcatctggtt caagagggtc gttatgacct gctgattgag 1320
ctggaagatt gggaaggtaa tagccaagaa atccagtttg aatttagctt aggtggtgaa 1380
agcaccgcat ataccctgaa tctgctgggt cctctgagcg gtgaactgga aaatgcaatt 1440
ggtgattttc gccagctgcc gtttagcacc cgtgatcgtg atcatgacct gaaagcagat 1500
accaattgtg caaaacatct gagtggtggt tggtggttta gtacctgtgg tcatgcaaat 1560
ctgaacggta aatactttcg tagcattccg cgtcagcgcc atgaacgtaa acagggtatt 1620
ttttggaaaa cctggaaagg tcgttactat ccgctgaaaa gtaccaccat gaaaattcag 1680
cctgcagcac tggaagcaga accgtaa 1707
<210> 2
<211> 1713
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 2
atgggtcatc atcaccatca tcatggtagc ctgcaggata gcgaagttaa tcaagaagca 60
aaaccggaag ttaagccgga agtgaaacct gaaacacata ttaacctgaa agtgagtgat 120
ggcagcagcg aaatcttctt caaaatcaaa aaaaccacac cgctgcgtcg tctgatggaa 180
gcatttgcaa aacgtcaggg taaagaaatg gatagcctgc gttttctgta tgatggtatt 240
cgtattcagg cagatcaggc accggaagat ctggatatgg aagataacga tattatcgaa 300
gcacatcgtg agcagattgg tggtggtagc gcaggtccgg cacctggcac aggtcgtgca 360
ggcaccgaac gtcgtaccgc agcagccggt ggtaaagaac gtcgtgcaca gtttgcaagc 420
tgggatgaag ttaatgttat tgcacatggt ctgctgcagt taggtcatgg tctgaaagaa 480
catgttgatc gtaccaaagg tcagatgcgt gaactgggta gccgtctgag cgcacataat 540
agcagcatgg gtcgtctgct gcgtcaggca cgtgaaaccc aagaacaggg tgaactgctg 600
cgtgcaagcg tgcgcgaact ggaaggtcgt ggtcgtcagc tgtttaatct gagcgaagca 660
ctgcgtcagc gtctggaaga agttgcagca gataaagcag aaattcaggg tcgcctggaa 720
cagctggaag gccgtgttcg ccaggcactg caggcacgtc cggcagaaaa tcagagcagc 780
aaagatctgg gtgcactgca gaccctgatg gatgcacaga atagccgtat tgaagaactg 840
cttcagaaga tcaaacagca gcagtataaa ctggataaac agaacctgca gattaaaagc 900
ctgcagagca aagttaatct gctgattccg ctgcatccga aagataacaa aacccagagt 960
ccgaaatgga aaatcaaccc gaaaaaaagc tttagccata ccaatcagag ccataatgtt 1020
agcgttgaac cggcactgcc gcataaactg ccggaagatt gtcagcagct gtttctggca 1080
ggtcagcaga gcagtggtgt ttttcaggtt cagccgagcg gtagccagcc gtttaaagtt 1140
tattgtgata tgaccgcaga aggtggttgg accgttattc agcgtcgcac cgatggtagc 1200
gtggattttg atcagctgtg ggatgcctat aaaaacggtt ttggtgatct gcatggcgat 1260
ttttggctgg gcttagaaaa aattcatcat ctggttcaag agggtcgtta tgacctgctg 1320
attgagctgg aagattggga aggtaatagc caagaaatcc agtttgaatt tagcttaggt 1380
ggtgaaagca ccgcatatac cctgaatctg ctgggtcctc tgagcggtga actggaaaat 1440
gcaattggtg attttcgcca gctgccgttt agcacccgtg atcgtgatca tgacctgaaa 1500
gcagatacca attgtgcaaa acatctgagt ggtggttggt ggtttagtac ctgtggtcat 1560
gcaaatctga acggtaaata ctttcgtagc attccgcgtc agcgccatga acgtaaacag 1620
ggtatttttt ggaaaacctg gaaaggtcgt tactatccgc tgaaaagtac caccatgaaa 1680
attcagcctg cagcactgga agcagaaccg taa 1713
<210> 3
<211> 568
<212> PRT
<213> Artificial Sequence (Artificial Sequence)
<400> 3
Met Gly His His His His His His Gly Ser Leu Gln Asp Ser Glu Val
1 5 10 15
Asn Gln Glu Ala Lys Pro Glu Val Lys Pro Glu Val Lys Pro Glu Thr
20 25 30
His Ile Asn Leu Lys Val Ser Asp Gly Ser Ser Glu Ile Phe Phe Lys
35 40 45
Ile Lys Lys Thr Thr Pro Leu Arg Arg Leu Met Glu Ala Phe Ala Lys
50 55 60
Arg Gln Gly Lys Glu Met Asp Ser Leu Arg Phe Leu Tyr Asp Gly Ile
65 70 75 80
Arg Ile Gln Ala Asp Gln Ala Pro Glu Asp Leu Asp Met Glu Asp Asn
85 90 95
Asp Ile Ile Glu Ala His Arg Glu Gln Ile Gly Gly Ala Gly Pro Ala
100 105 110
Pro Gly Thr Gly Arg Ala Gly Thr Glu Arg Arg Thr Ala Ala Ala Gly
115 120 125
Gly Lys Glu Arg Arg Ala Gln Phe Ala Ser Trp Asp Glu Val Asn Val
130 135 140
Ile Ala His Gly Leu Leu Gln Leu Gly His Gly Leu Lys Glu His Val
145 150 155 160
Asp Arg Thr Lys Gly Gln Met Arg Glu Leu Gly Ser Arg Leu Ser Ala
165 170 175
His Asn Ser Ser Met Gly Arg Leu Leu Arg Gln Ala Arg Glu Thr Gln
180 185 190
Glu Gln Gly Glu Leu Leu Arg Ala Ser Val Arg Glu Leu Glu Gly Arg
195 200 205
Gly Arg Gln Leu Phe Asn Leu Ser Glu Ala Leu Arg Gln Arg Leu Glu
210 215 220
Glu Val Ala Ala Asp Lys Ala Glu Ile Gln Gly Arg Leu Glu Gln Leu
225 230 235 240
Glu Gly Arg Val Arg Gln Ala Leu Gln Ala Arg Pro Ala Glu Asn Gln
245 250 255
Ser Ser Lys Asp Leu Gly Ala Leu Gln Thr Leu Met Asp Ala Gln Asn
260 265 270
Ser Arg Ile Glu Glu Leu Leu Gln Lys Ile Lys Gln Gln Gln Tyr Lys
275 280 285
Leu Asp Lys Gln Asn Leu Gln Ile Lys Ser Leu Gln Ser Lys Val Asn
290 295 300
Leu Leu Ile Pro Leu His Pro Lys Asp Asn Lys Thr Gln Ser Pro Lys
305 310 315 320
Trp Lys Ile Asn Pro Lys Lys Ser Phe Ser His Thr Asn Gln Ser His
325 330 335
Asn Val Ser Val Glu Pro Ala Leu Pro His Lys Leu Pro Glu Asp Cys
340 345 350
Gln Gln Leu Phe Leu Ala Gly Gln Gln Ser Ser Gly Val Phe Gln Val
355 360 365
Gln Pro Ser Gly Ser Gln Pro Phe Lys Val Tyr Cys Asp Met Thr Ala
370 375 380
Glu Gly Gly Trp Thr Val Ile Gln Arg Arg Thr Asp Gly Ser Val Asp
385 390 395 400
Phe Asp Gln Leu Trp Asp Ala Tyr Lys Asn Gly Phe Gly Asp Leu His
405 410 415
Gly Asp Phe Trp Leu Gly Leu Glu Lys Ile His His Leu Val Gln Glu
420 425 430
Gly Arg Tyr Asp Leu Leu Ile Glu Leu Glu Asp Trp Glu Gly Asn Ser
435 440 445
Gln Glu Ile Gln Phe Glu Phe Ser Leu Gly Gly Glu Ser Thr Ala Tyr
450 455 460
Thr Leu Asn Leu Leu Gly Pro Leu Ser Gly Glu Leu Glu Asn Ala Ile
465 470 475 480
Gly Asp Phe Arg Gln Leu Pro Phe Ser Thr Arg Asp Arg Asp His Asp
485 490 495
Leu Lys Ala Asp Thr Asn Cys Ala Lys His Leu Ser Gly Gly Trp Trp
500 505 510
Phe Ser Thr Cys Gly His Ala Asn Leu Asn Gly Lys Tyr Phe Arg Ser
515 520 525
Ile Pro Arg Gln Arg His Glu Arg Lys Gln Gly Ile Phe Trp Lys Thr
530 535 540
Trp Lys Gly Arg Tyr Tyr Pro Leu Lys Ser Thr Thr Met Lys Ile Gln
545 550 555 560
Pro Ala Ala Leu Glu Ala Glu Pro
565
<210> 4
<211> 570
<212> PRT
<213> Artificial Sequence (Artificial Sequence)
<400> 4
Met Gly His His His His His His Gly Ser Leu Gln Asp Ser Glu Val
1 5 10 15
Asn Gln Glu Ala Lys Pro Glu Val Lys Pro Glu Val Lys Pro Glu Thr
20 25 30
His Ile Asn Leu Lys Val Ser Asp Gly Ser Ser Glu Ile Phe Phe Lys
35 40 45
Ile Lys Lys Thr Thr Pro Leu Arg Arg Leu Met Glu Ala Phe Ala Lys
50 55 60
Arg Gln Gly Lys Glu Met Asp Ser Leu Arg Phe Leu Tyr Asp Gly Ile
65 70 75 80
Arg Ile Gln Ala Asp Gln Ala Pro Glu Asp Leu Asp Met Glu Asp Asn
85 90 95
Asp Ile Ile Glu Ala His Arg Glu Gln Ile Gly Gly Gly Ser Ala Gly
100 105 110
Pro Ala Pro Gly Thr Gly Arg Ala Gly Thr Glu Arg Arg Thr Ala Ala
115 120 125
Ala Gly Gly Lys Glu Arg Arg Ala Gln Phe Ala Ser Trp Asp Glu Val
130 135 140
Asn Val Ile Ala His Gly Leu Leu Gln Leu Gly His Gly Leu Lys Glu
145 150 155 160
His Val Asp Arg Thr Lys Gly Gln Met Arg Glu Leu Gly Ser Arg Leu
165 170 175
Ser Ala His Asn Ser Ser Met Gly Arg Leu Leu Arg Gln Ala Arg Glu
180 185 190
Thr Gln Glu Gln Gly Glu Leu Leu Arg Ala Ser Val Arg Glu Leu Glu
195 200 205
Gly Arg Gly Arg Gln Leu Phe Asn Leu Ser Glu Ala Leu Arg Gln Arg
210 215 220
Leu Glu Glu Val Ala Ala Asp Lys Ala Glu Ile Gln Gly Arg Leu Glu
225 230 235 240
Gln Leu Glu Gly Arg Val Arg Gln Ala Leu Gln Ala Arg Pro Ala Glu
245 250 255
Asn Gln Ser Ser Lys Asp Leu Gly Ala Leu Gln Thr Leu Met Asp Ala
260 265 270
Gln Asn Ser Arg Ile Glu Glu Leu Leu Gln Lys Ile Lys Gln Gln Gln
275 280 285
Tyr Lys Leu Asp Lys Gln Asn Leu Gln Ile Lys Ser Leu Gln Ser Lys
290 295 300
Val Asn Leu Leu Ile Pro Leu His Pro Lys Asp Asn Lys Thr Gln Ser
305 310 315 320
Pro Lys Trp Lys Ile Asn Pro Lys Lys Ser Phe Ser His Thr Asn Gln
325 330 335
Ser His Asn Val Ser Val Glu Pro Ala Leu Pro His Lys Leu Pro Glu
340 345 350
Asp Cys Gln Gln Leu Phe Leu Ala Gly Gln Gln Ser Ser Gly Val Phe
355 360 365
Gln Val Gln Pro Ser Gly Ser Gln Pro Phe Lys Val Tyr Cys Asp Met
370 375 380
Thr Ala Glu Gly Gly Trp Thr Val Ile Gln Arg Arg Thr Asp Gly Ser
385 390 395 400
Val Asp Phe Asp Gln Leu Trp Asp Ala Tyr Lys Asn Gly Phe Gly Asp
405 410 415
Leu His Gly Asp Phe Trp Leu Gly Leu Glu Lys Ile His His Leu Val
420 425 430
Gln Glu Gly Arg Tyr Asp Leu Leu Ile Glu Leu Glu Asp Trp Glu Gly
435 440 445
Asn Ser Gln Glu Ile Gln Phe Glu Phe Ser Leu Gly Gly Glu Ser Thr
450 455 460
Ala Tyr Thr Leu Asn Leu Leu Gly Pro Leu Ser Gly Glu Leu Glu Asn
465 470 475 480
Ala Ile Gly Asp Phe Arg Gln Leu Pro Phe Ser Thr Arg Asp Arg Asp
485 490 495
His Asp Leu Lys Ala Asp Thr Asn Cys Ala Lys His Leu Ser Gly Gly
500 505 510
Trp Trp Phe Ser Thr Cys Gly His Ala Asn Leu Asn Gly Lys Tyr Phe
515 520 525
Arg Ser Ile Pro Arg Gln Arg His Glu Arg Lys Gln Gly Ile Phe Trp
530 535 540
Lys Thr Trp Lys Gly Arg Tyr Tyr Pro Leu Lys Ser Thr Thr Met Lys
545 550 555 560
Ile Gln Pro Ala Ala Leu Glu Ala Glu Pro
565 570
Claims (10)
1. A method for prokaryotic expression of recombinant chicken ANGPTL4 protein, which comprises the following steps:
(1) artificially synthesizing a gene sequence of recombinant chicken ANGPTL4, constructing the gene sequence into a prokaryotic expression vector, and constructing a recombinant prokaryotic expression vector;
(2) Transforming the recombinant prokaryotic expression vector into escherichia coli E.coli competent cells, and screening positive colonies;
(3) Carrying out amplification culture on the single colony of the recombinant positive plasmid, and adding an inducer for induction expression;
(4) adopting a dilution renaturation method to carry out inclusion body renaturation;
(5) Purifying the inclusion body renaturation protein.
2. The method of claim 2, wherein the recombinant chicken ANGPTL4 gene sequence comprises a His-SUMO gene sequence and a chicken ANGPTL4 gene sequence, and wherein the recombinant chicken ANGPTL4 gene sequence is set forth in SEQ ID No.1 or SEQ ID No. 2.
3. The method according to claim 1 or 2, wherein in step (1): the prokaryotic expression vector is pET21a (+), and the constructed recombinant prokaryotic expression vector is pET21a-His-SUMO-ANGPTL 4.
4. The method according to any one of claims 1 to 3, wherein in step (3), the inducer is isopropyl- β -D-thiogalactoside; preferably, the concentration of the isopropyl-beta-D-thiogalactoside is 0.1mmol/L-1mmol/L, and the induction temperature is 16 ℃ to 37 ℃.
5. The method according to any one of claims 1 to 4, wherein the dilution renaturation method of the step (4) comprises the following specific steps:
(1) After the target protein is induced to express, fully washing the inclusion body by using a washing buffer solution, centrifuging to take a precipitate, solubilizing by using a solubilizing buffer solution, centrifuging to take a supernatant for inclusion body renaturation;
the washing buffer solution is a Tris-HCl buffer solution containing NaCl, EDTA and TritonX-100, the pH value is 8.0, the concentration of the Tris-HCl buffer solution is 20mmol/L, the concentration of the NaCl is 50mmol/L, the concentration of the EDTA is 5mmol/L, and the volume concentration of the Triton X-100 is 1%;
The solubilization buffer solution is a Tris-HCl buffer solution containing Gua-HCl and DTT, the pH value is 8.0, the concentration of the Tris-HCl buffer solution is 50mmol/L, the concentration of Gua-HCl is 6mol/L, and the concentration of DTT is 10 mmol/L;
(2) Dropwise adding the inclusion body solubilization solution into a renaturation buffer solution, and carrying out renaturation at 4 ℃ for 24 h;
Preferably, the renaturation buffer solution contains NaCl, KCl and MgCl2、CaCl2The pH of the phosphate buffer solution of sucrose, arginine, Triton X-100, GSH and GSSG is 6.5, the concentration of the phosphate buffer solution is 20mmol/L, the concentration of NaCl is 240mmol/L, and the concentration of KCl is 10mmol/L, MgCl2The concentration is 2mmol/L, CaCl2The concentration is 2mmol/L, the sucrose concentration is 0.4mol/L, the arginine concentration is 0.5mol/L, the volume concentration of Triton X-100 is 0.05%, and the GSH concentration is 1mmol/L, GSSG and is 0.1 mmol/L.
6. The method for preparing the protein of any one of claims 1 to 5, wherein the renaturation protein purification of step (5) uses a chemical SFF affinity chromatography column, and comprises the following specific steps: balancing the column with a balance buffer solution, eluting the target protein with an imidazole-containing elution buffer solution, and collecting the eluate;
The balance buffer solution is Tris-HCl buffer solution containing NaCl, the pH value is 8.0, the concentration of the Tris-HCl buffer solution is 20mmol/L, and the concentration of the NaCl is 500 mmol/L;
The elution buffer solution is a Tris-HCl buffer solution containing NaCl and imidazole, the pH value is 8.0, the concentration of the Tris-HCl buffer solution is 20mmol/L, the concentration of NaCl is 500mmol/L, and the concentration of imidazole is 50-500 mmol/L; preferably, the concentration of the imidazole is 500 mmol/L;
Preferably, the collected eluate components are dialyzed into Tris-HCl buffer solution containing NaCl, glycerol and DTT, wherein the concentration of the Tris-HCl buffer solution is 20mmol/L, the concentration of the NaCl is 500mmol/L, the volume concentration of the glycerol (glycerol) is 10% and the concentration of the DTT is 1mmol/L, and the pH value is 8.5, so that the recombinant chicken ANGPTL4 fusion protein is obtained.
7. Inclusion body or recombinant chicken ANGPTL4 protein produced according to the method of any one of claims 1-6.
8. The recombinant chicken ANGPTL4 protein according to claim 7, wherein the amino acid sequence of the recombinant chicken ANGPTL4 protein is shown as SEQ ID No.3 or as SEQ ID No. 4.
9. The use of the recombinant chicken ANGPTL4 protein of claim 7 to modulate broiler fat metabolism.
10. A method for regulating the fat metabolism of broiler chickens, which is characterized in that the method comprises the steps of injecting the recombinant chicken ANGPTL4 protein of claim 8 into the broiler chickens intravenously; preferably, the dose of the recombinant ANGPTL4 protein is 20ng/kg-12500 ng/kg.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910899778.3A CN110564756A (en) | 2019-09-23 | 2019-09-23 | method for prokaryotic expression of recombinant chicken angiopoietin-like protein 4 and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910899778.3A CN110564756A (en) | 2019-09-23 | 2019-09-23 | method for prokaryotic expression of recombinant chicken angiopoietin-like protein 4 and application thereof |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN110564756A true CN110564756A (en) | 2019-12-13 |
Family
ID=68781851
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201910899778.3A Pending CN110564756A (en) | 2019-09-23 | 2019-09-23 | method for prokaryotic expression of recombinant chicken angiopoietin-like protein 4 and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN110564756A (en) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN112553231A (en) * | 2020-12-25 | 2021-03-26 | 华南农业大学 | Recombinant human heat shock protein HSP90-His and expression and purification method thereof |
| CN112695052A (en) * | 2020-12-25 | 2021-04-23 | 华南农业大学 | Recombinant human glucocorticoid receptor GR alpha-His protein and expression and purification method thereof |
| CN112980861A (en) * | 2021-02-25 | 2021-06-18 | 安徽环球基因科技有限公司 | Prokaryotic expression vector construction of human neurofilament light chain and purification method of protein |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101220079A (en) * | 2008-01-30 | 2008-07-16 | 华东理工大学 | Denaturation and renaturation method of recombined protein |
-
2019
- 2019-09-23 CN CN201910899778.3A patent/CN110564756A/en active Pending
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101220079A (en) * | 2008-01-30 | 2008-07-16 | 华东理工大学 | Denaturation and renaturation method of recombined protein |
Non-Patent Citations (11)
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN112553231A (en) * | 2020-12-25 | 2021-03-26 | 华南农业大学 | Recombinant human heat shock protein HSP90-His and expression and purification method thereof |
| CN112695052A (en) * | 2020-12-25 | 2021-04-23 | 华南农业大学 | Recombinant human glucocorticoid receptor GR alpha-His protein and expression and purification method thereof |
| CN112980861A (en) * | 2021-02-25 | 2021-06-18 | 安徽环球基因科技有限公司 | Prokaryotic expression vector construction of human neurofilament light chain and purification method of protein |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Walsh et al. | The inhibitor protein of the cAMP-dependent protein kinase | |
| CN110564756A (en) | method for prokaryotic expression of recombinant chicken angiopoietin-like protein 4 and application thereof | |
| Cash et al. | Refolding, purification, and characterization of human and murine RegIII proteins expressed in Escherichia coli | |
| Preisig-Müller et al. | Domains of the tetrafunctional protein acting in glyoxysomal fatty acid beta-oxidation. Demonstration of epimerase and isomerase activities on a peptide lacking hydratase activity. | |
| Nishimiya et al. | Co‐operative effect of the isoforms of type III antifreeze protein expressed in Notched‐fin eelpout, Zoarces elongatus Kner | |
| Charbonnier et al. | Overexpression, refolding, and purification of the histidine-tagged outer membrane efflux protein OprM of Pseudomonas aeruginosa | |
| Tasumi et al. | Identification and characterization of pufflectin from the grass pufferfish Takifugu niphobles and comparison of its expression with that of Takifugu rubripes | |
| US20050227920A1 (en) | Methods for production of recombinant vascular endothelial cell growth inhibitor | |
| Song et al. | Molecular cloning, expression and functional characterization of interferon-γ-inducible lysosomal thiol reductase (GILT) gene from mandarin fish (Siniperca chuatsi) | |
| CN112239760A (en) | Recombinant engineering bacterium for efficiently expressing recombinant hGH (human growth hormone) and construction method and application thereof | |
| CN108752455B (en) | Recombinant preparation method and application of fungal defensin | |
| US6255067B1 (en) | cDNA encoding peptidyl-glycine alpha-amidating monooxygenase (PAM) | |
| Li et al. | Production and characterization of highly purified recombinant thymosin beta 4 in Escherichia coli | |
| Pathak et al. | Construction and characterization of mutated LEA peptides in Escherichia coli to develop an efficient protein expression system | |
| CN111304177B (en) | Preparation method and application of recombinant protein swHO1 | |
| Li et al. | Identification of interferon-γ-inducible-lysosomal thiol reductase (GILT) gene in goldfish (Carassius auratus) and its immune response to LPS challenge | |
| CN103864939A (en) | mGM-CSF/beta hCG fusion protein, and preparation method and application thereof | |
| KR102187479B1 (en) | PGRP-SC2 protein from Rock bream and uses thereof | |
| Zhang et al. | Expression, purification, characterization, and patient IgE reactivity of new macadamia nut iso-allergen | |
| Sadaf et al. | Molecular cloning, characterization, and expression studies of water buffalo (Bubalus bubalis) somatotropin | |
| Ushimaru et al. | Association of a 66 kDa homolog of Chlamydomonas DC2, a subunit of the outer arm docking complex, with outer arm dynein of sperm flagella in the ascidian Ciona intestinalis | |
| CN101003805A (en) | C100F58 gene of human, its coding proteins, and application | |
| Li et al. | Structural Characteristics, Prokaryotic Expression and Activity Analysis of Antimicrobial Peptide ALF Pm10 from Penaeus monodon | |
| CN105330735B (en) | A kind of relevant epitope peptide of PRRT2 albumen and its application | |
| KR102035802B1 (en) | PGRP2 protein from rock bream and uses thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination |