KR102187479B1 - PGRP-SC2 protein from Rock bream and uses thereof - Google Patents

Abstract

The present invention relates to SEQ ID NO: 2 amino acid parrot consisting of SEQ ID NO (Oplegnathus fasciatus) OfPGRP-SC2 ( peptidoglycan recognition protein-SC2) of the derived proteins and their use in, OfPGRP-SC2 protein of the invention with antibiotics substitute for fish It can be used or useful as a feed additive for aquaculture fish.

Description

PGRP-SC2 protein from rock bream and uses thereof {PGRP-SC2 protein from Rock bream and uses thereof}

The present invention relates to a peptidoglycan recognition protein-SC2 (PGRP-SC2) protein derived from doldom and its use.

Rock bream (scientific name Oplegnathus fasciatus ), belonging to the Perciformes Oplegnathidae, is widely distributed in the Pacific Ocean and the Indian Ocean, and is considered to be an economically important aquaculture target species distributed mainly in the south sub-south waters in Korea. With the development of fish farming, many infectious diseases such as viral diseases caused by iridovirus have been accompanied, and the incidence of diseases has increased due to stress factors caused by various limited aquaculture environments, which is an enormous amount in the dolphin farming industry. It is causing economic damage.

In tibial fish (teleosts), the acquired immune system is not as well developed as the innate immune system (innate immunity), meaning that in fish the innate immune system is important to combat pathogens. Antimicrobial peptides (AMPs) are expected as new antibiotic substitutes that can alleviate the problem of existing antibiotic-resistant strains, which is important in protecting fish from opportunistic pathogens. This is because it plays a role and acts as a powerful weapon in innate immunity.

The peptidoglycan recognition protein (PGRP) belongs to the pattern recognition receptor (PRR) family and plays an important role during the innate immune response by mediating the recognition and elimination of pathogens. In addition, PGRP binds to bacteria and plays an important role in various biological processes, such as inflammatory mediators, phagocytosis, and induction of the Toll signaling pathway.

PGRP-SC2 protein, a short form PGRP belonging to the PGRP family, is known to play an important role in various biological processes including bacterial binding, aggregation reactions, and maintenance of intestinal homeostasis. In Drosophila, PGRP-SC2 regulates the level of activation of the immunodeficiency signaling pathway after bacterial infection, and has been reported to be important for inhibition and survival of larvae development. In Artemia sinica , PGRP-SC2 has been reported to play an important role in the innate immune response to Gram-negative bacteria and early embryonic development. PGRP protein has been particularly well studied in Drosophila, and PGRP-SC2 has been identified in tibia fish including Nile tilapia and tong sole, but studies on immunological function have been limited. In the present invention, the immunological function of the PGRP-SC2 protein was confirmed through the identification and characterization of PGRP-SC2 derived from stone dome.

On the other hand, Korean Patent No. 1016689 discloses a'protein involved in the transduction of a peptide glycan recognition signal, a gene encoding it, and a kit for detecting bacterial infection including the same' for PGRP derived from a brown low-range. No. 1486236 discloses'a vaccine adjuvant for fish containing a protein derived from dolphin as an active ingredient' related to TRx (Thioredoxin) 1 protein derived from dolphin, but describes the PGRP-SC2 protein derived from dolphin of the present invention and its use. There is no bar.

The present invention was derived from the above requirements, and the present inventors obtained the cDNA nucleotide sequence of the PGRP-SC2 (peptidoglycan recognition protein-SC2) gene from Doldom, and produced a recombinant protein based on the nucleotide sequence. In addition, as a result of analyzing the expression pattern of OfPGRP-SC2 according to the infection of the pathogen causing the major disease in the dolphin culture, it was confirmed that the expression of OfPGRP-SC2 was significantly upregulated, and the recombinant protein was used to By confirming the aggregation function of OfPGRP-SC2 against, and by confirming that the recombinant OfPGRP-SC2 protein enhances phagocytosis against pathogens of leukocytes, the present invention was completed.

In order to solve the above problem, the present invention provides a Dome (Olegnathus fasciatus ) derived OfPGRP-SC2 (peptidoglycan recognition protein-SC2) protein consisting of the amino acid sequence of SEQ ID NO: 2.

In addition, the present invention provides a gene encoding the OfPGRP-SC2 protein.

In addition, the present invention provides a recombinant vector comprising the gene.

In addition, the present invention provides a host cell transformed with the recombinant vector.

In addition, the present invention provides a method for producing OfPGRP-SC2 protein comprising the step of overexpressing a gene encoding OfPGRP-SC2 protein by transforming a host cell with the recombinant vector and OfPGRP-SC2 protein produced by the method. do.

In addition, the present invention provides an antibacterial composition for fish or a feed additive for fish containing OfPGRP-SC2 protein as an active ingredient.

In the present invention, the immunological function of the major fish disease pathogens of the stone sea bream-derived OfPGRP-SC2 protein was confirmed. Therefore, OfPGRP-SC2 protein can be used as a substitute for antibiotics for fish or as a feed additive for aquaculture fish.

1 is a result of comparative analysis of amino acid sequences of PGRP-SC2 derived from rock bream and PGRP-SC2 protein derived from other tibia fish.
FIG. 2 is a result of confirming the expression level of the PGRP-SC2 gene in various tissues and organs of a healthy fish carcass by RT-qPCR.
Figure 3 is Edwardsiella piscicida ( Edwardsiella piscicida ), Streptococcus iniae ( Streptococcus iniae ) or red seabream virus (red seabream virus) infected with the kidney (kidney), spleen (spleen), gills , This is the result of analyzing the expression level of the PGRP-SC2 gene in liver tissue over time.
Figure 4 is a result of confirming the aggregation activity of PGRP-SC2 derived from stone dome against Streptococcus iniae ( S. iniae ) or Edward Siella piscicida ( E. piscicida ).
5 is a result of analyzing the effect of PGRP-SC2 on the phagocytosis of peripheral blood lymphocytes (granulocytes) against pathogens.

In order to achieve the object of the present invention, the present invention provides an OfPGRP-SC2 (peptidoglycan recognition protein-SC2) protein derived from a dome (Olegnathus fasciatus ) consisting of the amino acid sequence of SEQ ID NO: 2.

The range of OfPGRP-SC2 protein derived from doldom according to the present invention includes a protein represented by the amino acid sequence of SEQ ID NO: 2 and a functional equivalent of the protein. The term "functional equivalent" is at least 60% or more, preferably 70% or more, more preferably 80% or more, even more preferably with the amino acid sequence represented by SEQ ID NO: 2 as a result of addition, substitution or deletion of amino acids. Refers to a protein that has 90% or more sequence homology and exhibits substantially the same physiological activity as the protein represented by the amino acid sequence represented by SEQ ID NO: 2. "Substantially homogenous physiological activity" means antibacterial activity.

The present invention also provides a gene encoding the OfPGRP-SC2 protein.

The gene encoding the OfPGRP-SC2 protein of the present invention may include a nucleotide sequence represented by SEQ ID NO: 1. In addition, homologs of the nucleotide sequence are included within the scope of the present invention. Specifically, the gene encoding the OfPGRP-SC2 protein is 70% or more, more preferably 80% or more, even more preferably 90% or more, most preferably 95% or more of the nucleotide sequence of SEQ ID NO: 1 It may include a nucleotide sequence having homology. The "% of sequence homology" for a polynucleotide is identified by comparing two optimally aligned sequences with a comparison region, and a portion of the polynucleotide sequence in the comparison region is a reference sequence for the optimal alignment of the two sequences (addition or deletion It may include additions or deletions (ie, gaps) compared to (not including).

The present invention also provides a recombinant vector comprising a gene encoding the OfPGRP-SC2 protein.

The term “vector” is used to refer to a DNA fragment(s), a nucleic acid molecule, which is delivered into a cell. Vectors replicate DNA and can be reproduced independently in host cells. The term “carrier” is often used interchangeably with “vector”. The term “expression vector” refers to a recombinant DNA molecule comprising a coding sequence of interest and an appropriate nucleic acid sequence essential for expressing the coding sequence operably linked in a particular host organism. In general, any plasmid and vector can be used as long as they can replicate and stabilize in the host. An important characteristic of the expression vector is that it has an origin of replication, a promoter, a marker gene and a translation control element. Translational regulatory elements that can be used in eukaryotic cells, enhancers, ribosome binding sites, termination signals, polyadenylation signals and promoters are known in the art. The expression vector can be constructed by a method well known in the art. The method includes in vitro recombinant DNA technology, DNA synthesis technology, and in vivo recombinant technology. The DNA sequence can be effectively linked to an appropriate promoter in the expression vector to guide mRNA synthesis. In addition, the expression vector may include a ribosome binding portion and a transcription terminator as a translation initiation site.

The vectors of the present invention can typically be constructed as vectors for cloning or expression. In addition, the vector of the present invention can be constructed using a prokaryotic cell or a eukaryotic cell as a host. For example, when the vector of the present invention is an expression vector and a prokaryotic cell is used as a host, a strong promoter capable of proceeding transcription (eg, pLλ promoter, trp promoter, lac promoter, T7 promoter, tac promoter, etc.), It is common to include a ribosome binding site and a transcription/translation termination sequence for initiation of translation. When E. coli is used as a host cell, a promoter and operator site of the tryptophan biosynthetic pathway of E. coli , and a left-facing promoter (pLλ promoter) of a phage (λ) may be used as a regulatory site.

On the other hand, vectors that can be used in the present invention include plasmids often used in the art (e.g., pSC101, ColE1, pBR322, pUC8/9, pHC79, pGEX series, pET series and pUC19, etc.), phage (e.g., λgt4·λB). , λ-Charon, λΔz1 and M13, etc.) or a virus (eg, SV40, etc.). On the other hand, when the vector of the present invention is an expression vector and a eukaryotic cell is used as a host, a promoter derived from the genome of a mammalian cell (eg, a metallotionine promoter) or a promoter derived from a mammalian virus (eg, adeno Virus late promoter, vaccinia virus 7.5K promoter, SV40 promoter, cytomegalovirus promoter and tk promoter of HSV) can be used and generally have a polyadenylation sequence as a transcription termination sequence.

The vector of the present invention may contain an antibiotic resistance gene commonly used in the art as a selection marker, for example, ampicillin, gentamicin, carbenicillin, chloramphenicol, streptomycin, kanamycin, geneticin, neomycin. And resistance genes for tetracycline.

In addition, the present invention provides a host cell transformed with the recombinant vector.

Host cells capable of stably cloning and expressing the vector of the present invention can be used any host cell known in the art, for example, E. coli JM109, E. coli BL21, E. coli RR1, E. coli LE392, Bacillus strains such as E. coli B, E. coli X1776, E. coli W3110, Bacillus subtilis , Bacillus thuringiensis , Salmonella typhimurium , Serratia marcescens , and Intestinal bacteria and strains such as various Pseudomonas species are included.

In addition, when transforming the vector of the present invention into eukaryotic cells, as host cells, yeast ( Saccharomyce cerevisiae ), insect cells, human cells (eg, CHO cell line (Chinese hamster ovary), W138, BHK, COS-7, 293 , HepG2, 3T3, RIN and MDCK cell lines) and plant cells, and the like can be used.

The method of transporting the vector of the present invention into a host cell is the CaCl ₂ method (Cohen, SN et al., Proc. Natl. Acac. Sci. USA, 9:2110-2114 (1973)) when the host cell is a prokaryotic cell. ), one method (Hanahan, D., J. Mol. Biol., 166:557-580 (1983)) and electroporation method (Dower, WJ et al., Nucleic. Acids Res., 16:6127-6145 (1988)), etc. In addition, when the host cell is a eukaryotic cell, microinjection (Capecchi, MR, Cell, 22:479 (1980)), calcium phosphate precipitation (Graham, FL et al., Virology, 52:456 (1973)), Electroporation (Neumann, E. et al., EMBO J., 1:841 (1982)), liposome-mediated transfection (Wong, TK et al., Gene, 10:87 (1980)), DEAE- Dextran treatment (Gopal, Mol. Cell Biol., 5:1188-1190 (1985)) and Gene Bombadment (Yang et al., Proc. Natl. Acad. Sci., 87:9568-9572 (1990)) The vector can be injected into the host cell by, for example.

The present invention also provides a method for producing OfPGRP-SC2 protein comprising the step of overexpressing a gene encoding OfPGRP-SC2 protein by transforming a host cell with the recombinant vector, and OfPGRP-SC2 protein produced by the method. do.

The method for producing the protein of the present invention may be culturing a host cell (transformant) transformed with a recombinant vector in a medium suitable for production of a recombinant protein using a known technique. For example, cells can be cultured by small or large-scale fermentation, shake flask culture in laboratory or industrial fermentors conducted under conditions that allow the expression and/or separation of suitable media and proteins. The cultivation takes place in a suitable medium containing carbon, nitrogen sources and inorganic salts using known techniques. Suitable media can be obtained commercially or prepared according to the ingredients and composition ratios described in publications such as, for example, catalogs of the American Type Culture Collection (ATCC).

In the above production method, the expressed protein can be recovered using a protein separation method known in the art. For example, the protein can be separated from the nutrient medium by conventional methods including centrifugation, filtration, extraction, spray drying, evaporation or precipitation, but is not limited thereto. Furthermore, proteins can be obtained through a variety of known methods including chromatography (eg ion exchange, affinity, hydrophobicity and size exclusion), electrophoresis, fractionation (eg ammonium sulfate precipitation), SDS-PAGE or extraction. Can be purified.

The OfPGRP-SC2 protein of the present invention can bind to Gram-positive bacteria or Gram-negative bacteria, and is a protein that has an activity to enhance phagocytosis of lymphocytes.

The present invention also provides an antibacterial composition for fish and a feed additive for fish containing OfPGRP-SC2 protein as an active ingredient.

The term “antimicrobial” refers to the ability to reduce, prevent, inhibit, or eliminate the growth or survival of microorganisms at a certain concentration, and may preferably mean anti-bacterial. The bacterium of the present invention may be a gram-positive or gram-negative bacterium, preferably, the gram-positive bacterium is Streptococcus iniae , and the gram-negative bacterium may be Edwardsiella piscicida , but this Not limited.

The feed additive of the present invention is preferably for enhancing immunity, and may be used as a feed additive for fish, but is not limited thereto.

The feed additive of the present invention includes adjuvant components such as amino acids, inorganic salts, vitamins, antibiotics, antibacterial substances, antioxidants, antifungal enzymes, and microbial preparations in the form of other live bacteria; Grains such as crushed or crushed wheat, oats, barley, corn and rice; Vegetable protein feeds, such as those based on rapeseed, soybeans and sunflowers; Animal protein feeds such as blood meal, meat meal, bone meal and fish meal; Dried ingredients consisting of sugar and dairy products, such as various milk powders and whey powder; Main components such as lipids, for example animal fats and vegetable fats, optionally liquefied by heating; Additives such as nutritional supplements, digestion and absorption enhancers, growth promoters, and disease prevention agents may additionally be included.

The feed additive of the present invention may be in the form of a powder or liquid formulation, and may include an excipient for feed addition. Examples of excipients for feed addition may include calcium carbonate, powder, zeolite, jade flour, or rice bran, but are not limited thereto.

The feed additive of the present invention may further include one or more enzyme preparations. For example, lipolytic enzymes such as lipase, phytase that breaks down phytic acid to make phosphate and inositol phosphate, alpha-1,4-glycosidic bonds (α-1) contained in starch and glycogen ,4-glycoside bond) hydrolysis enzyme, phosphatase, an enzyme that hydrolyzes organophosphate, maltase, which hydrolyzes maltose into two molecules of glucose, and glucose-fruct by hydrolyzing saccharose. It may contain a converting enzyme and the like to make a toss mixture.

The feed additive of the present invention may be administered to fish alone or in combination with other feed additives in an edible carrier. Typically, a single daily intake or divided daily intake may be used as is well known in the art.

Hereinafter, the present invention will be described in detail by examples. However, the following examples are only illustrative of the present invention, and the contents of the present invention are not limited to the following examples.

Materials and methods

1. Sequence alignment and phylogenetic analysis

The ORF (open reading frame) containing the PGRP-SC2 sequence derived from dolphin was obtained through NGS (next generation sequencing) analysis of the intestine sample, and the sequence was verified by Sanger sequencing. The BLAST program (http://www.ncbi.nlm.nih.gov/blast) was used to investigate similarity with other known base sequences, and amino acid sequences were predicted. Amino acid domains were investigated using the SMART tool (http://smart.embl-heidelberg.de/), and GENETYX program version 8.0 (http://clustalw.ddbj.nig.ac.jp/) performed multiple sequence alignment. Used for To confirm the phylogenetic location, a phylogenetic tree was produced using the maximum likelihood method with MEGA (Molecular Evolutionary Genetics Analysis) version 6.0, and bootstrap sampling was repeated 1,000 times.

2. Real-time quantitative PCR analysis

2.1 Artificial infection of experimental fish and pathogens

Healthy stone sea bream (weight: 140.4±39.7 g, length: 19.0±1.8 cm) was purchased from a local market in Tongyeong, and was bred in seawater under aeration conditions of 20~22℃ until the experiment was completed.

Pathogen artificial infection experiments were Streptococcus iniae FP5228 (3×10 ⁶ cells/fish), Edwardsiella piscicida ) FSW910410 (2×10 ⁶ cells/fish) or red snapper iridovirus (red seabream virus, RSIV) (1.04×10 ⁴ copies/fish) was injected into the intraperitoneal cavity of healthy stone seabream for infection, and was bred in seawater at 23±1℃ during the experiment.

2.2 Healthy Doldom Fish by Each Organization PGRP-SC2 Gene expression level analysis

In order to evaluate the expression level of the PGRP-SC2 gene (hereinafter, OfPGRP-SC2) derived from stone bream, trunk kidney, head kidney, gill, spleen, and Heart, liver, brain, stomach (stomach), intestine (intestine), skin (skin), muscle (muscle) and whole blood (whole blood) were separated, 53% Sigma- Aldrich, USA) was used to separate peripheral blood leukocytes (PBL) from whole blood through density-gradient centrifugation. All isolated tissues were stored at -80°C until total RNA extraction. Total RNA was extracted using TRIzol reagent (Invitrogen, USA), and DNase I (Takara, Japan) was treated to prevent genomic DNA contamination in total RNA samples. The concentration and purity of the extracted total RNA sample were measured using a NanoVue spectrophotometer (GE Healthcare, UK). cDNA synthesis was performed using the PrimeScript™ 1st strand cDNA Synthesis kit (TaKaRa), and the expression trend of the PGRP-SC2 gene for each tissue was analyzed through quantitative real-time PCR. EF-1α (elongation factor 1 alpha) was used as a control gene to determine the relative expression level of the OfPGRP-SC2 gene. Information on each primer set is shown in Table 1 below.

PCR primer information used in the present invention Primer name Base sequence information (5'→3') EF-1α (F) CCCCTGCAGGACGTCTACAA (SEQ ID NO: 3) EF-1α (R) AACACGACCGACGGGTACA (SEQ ID NO: 4) OfPGRP-SC2 (F) AAGCGCAGAGGCAATATCAG (SEQ ID NO: 5) OfPGRP-SC2 (R) TGTGGCAGCGCAGTATAAAG (SEQ ID NO: 6) rOfPGRP-SC2 (F) CTGTTCCAC TCTAGA AATAATTTTGTTTAACTTTAAGAAGGAGATATAC (SEQ ID NO: 7) rOfPGRP-SC2 (R) GATATGGCT CTCGAG TTAGTGGTGGTGGTGGTGGTGCGTGGTACCACGCAACTGC (SEQ ID NO: 8)

2.3 Analysis of expression level after pathogen infection

The expression level of OfPGRP-SC2 gene after pathogen infection was measured 1, 3, 6, 12, 24, 36 and 48 hours after infection in the kidney, gill, liver and spleen, which are immune-related tissues. As a control, a fish body injected with the same amount of PBS buffer solution was used.

3. Expression and purification of recombinant OfPGRP-SC2 protein

The ORF of OfPGRP-SC2 protein derived from doldom was amplified using a primer set of SEQ ID NO: 7 and SEQ ID NO: 8 (see Table 1). The PCR product was cut with Xba I and Xho I restriction enzymes, and then cloned into pET-22b (+) vector. The recombinant vector was transformed into E. coli BL21 (DE3) strain and cultured in LB (Luria Bertani) medium containing ampicillin at 25° C. and 150 rpm, and then IPTG (Isopropyl-β-Dthiogalactoside) was added to a final concentration of 0.5 It was put so as to be mM and protein expression was induced. The cultured cells were obtained through centrifugation, and the obtained cells were resuspended in denaturation buffer (50mM Tris-HCl, 0.2M NaCl, 5mM EDTA and 2M Urea, pH 8.0), and then sonicated for 30 minutes. After centrifuging the sonicated product, the supernatant was recovered and loaded into Ni-NTA resin (Qiagen, Germany). For elution of the recombinant protein, the column was washed with an equilibration buffer (50mM Tris-HCl, 0.5M NaCl and 8M Urea, pH 8.0), and then purified using an elution buffer (0.5M imidazole added to the equilibration buffer). . The eluted protein was developed by 17% SDS-PAGE, and confirmed by staining the gel with Coomassie Brilliant Blue R-250. The purified OfPGRP-SC2 protein was identified with a size of 17.85kDa.

4. Bacterial aggregation experiment

Bacterial aggregation experiments were performed using well-known pathogens, Streptococcus iniae ( S. iniae ) and Edward Siella piscicida ( E. piscicida ). The cells of each pathogen were cultured in LB medium until the OD ₆₀₀ value reached 0.8, then recovered and washed three times with PBS. After the washed cells were resuspended in PBS, reacted with diluted FITC (fluorescein isothiocyanate, Sigma-Aldrich) for 1 hour at room temperature, and then washed three times with PBS. Thereafter, each bacteria was resuspended in PBS or PBS-Zn2+ buffer (10 μM ZnCl ₂ /PBS), recombinant OfPGRP-SC2 protein or bovine serum albumin (BSA) was put on a glass slide, and the bacterial resuspension was put on a glass slide. After adding to the above and reacting at room temperature under dark conditions for 2 hours, the degree of aggregation reaction was observed with a fluorescence microscope (Leica, Germany) at a wavelength of 488 nm.

5. Phagocytosis analysis

The effect of the recombinant OfPGRP-SC2 protein on the phagocytosis of granulocytes was analyzed using a flow cytometer. The prepared pathogens were inactivated by reacting with 0.5% formalin for 2 days, and washed three times with PBS. Then, the cells were reacted with diluted FITC for 1 hour at room temperature, and then washed three times with PBS. Peripheral blood lymphocytes prepared from whole blood of a healthy fish carcass were resuspended in a culture medium, and peripheral blood lymphocyte cells (10 ⁶ cells/ml) were reacted with 10 μM zinc chloride and 200 μg/ml OfPGRP-SC2 protein or BSA, 5 It was reacted for 1 hour in% carbon dioxide conditions. FITC-labeled bacteria (10 ⁸ cells/ml) and peripheral blood lymphocytes were mixed and reacted for 2 hours at room temperature under dark conditions, and then the reaction was terminated by adding cold RPMI medium and stored on ice. The percentage of phagocytosis was determined using an Accuri™ C6 flow cytometer (BD biosciences, USA).

6. Statistical processing

All samples were performed in 3 iterations, and the results were expressed as mean±standard deviation. The results were evaluated by the one-way analysis of variance (ANOVA) method using SPSS program version 19, and the expression analysis of each tissue-specific gene after pathogen infection was analyzed using Duncan's multiple comparison test (*p<0.05). I did. Phagocytosis analysis was performed using the independent sample t test (*p<0.05).

Example 1. Derived from dolphin PGRP-SC2 Gene sequence analysis

The PGRP-SC2 gene (hereinafter OfPGRP-SC2) derived from Dole Dome (Olegnathus fasciatus ) was predicted to encode a peptide consisting of 167 amino acids, the molecular weight of 17.85 kDa, and the theoretical isoelectric point of 8.72. OfPGRP-SC2 protein was estimated to have a peptide glycan recognition domain located at the 5th to 147th amino acid positions (Fig. 1). As a result of aligning the amino acid sequence of the OfPGRP-SC2 protein with the amino acid sequence of the PGRP-SC2 protein of another species, it was found to be most similar to PGRP-SC2 of the reference group (yellow croaker) at 79.6%.

Example 2. Origin of stone sea bream PGRP - SC2 Analysis of gene expression level by tissue

As a result of analyzing the expression level of each tissue of the OfPGRP-SC2 gene in healthy fish fish, it was found that it is commonly expressed in various tissues, and the OfPGRP-SC2 gene is the highest in muscle tissue compared to peripheral blood lymphocytes (PBLs). It was confirmed that it was expressed (Fig. 2).

Example 3. Derived from stone sea bream after artificial pathogen infection PGRP-SC2 Gene expression level analysis

As a result of analyzing the expression level of OfPGRP-SC2 gene after artificial infection with Streptococcus iniae ( S. iniae ), Edward Ciela piscicida ( E. piscicida ) and red snapper iridovirus (RSIV), all tissues tested were free of pathogens. It was confirmed that the expression level of the OfPGRP-SC2 gene was increased compared to the infection, and it was observed that the expression level was significantly increased in the bacterial infection condition than in the viral infection except for the gill tissue (FIG. 3 ).

Example 4. Aggregation analysis of pathogenic bacteria by PGRP-SC2 protein derived from dolphin

Recombinant OfPGRP-SC2 protein was found to induce bacterial aggregation in the presence of zinc ions against the pathogenic bacteria Streptococcus iniae and Edward Siella piscisida (FIG. 4). Through this, it could be inferred that OfPGRP-SC2 protein plays an important role in innate immunity against bacterial infection, and that the activity of OfPGRP-SC2 is regulated by zinc ions.

Example 5. Analysis of phagocytosis activity by PGRP-SC2 protein derived from dolphin

Phagocytosis is the first front line of the host defense system for the recognition and elimination of pathogens in the innate immune system. In order to evaluate the effect of the recombinant OfPGRP-SC2 protein of the present invention on the phagocytosis of lymphocytes, after reacting lymphocyte cells with recombinant protein and fluorescently labeled pathogenic bacteria, as a result of confirming with flow cytometry, the group treated with BSA protein In comparison, it was confirmed that the phagocytosis of lymphocytes was slightly increased in the group treated with the recombinant OfPGRP-SC2 protein (FIG. 5). Through this, it could be inferred that OfPGRP-SC2 protein is involved in maintaining lymphocyte homeostasis.

<110> INDUSTRY-ACADEMIC COOPERATION FOUNDATION GYEONGSANG NATIONAL UNIVERSITY <120> PGRP-SC2 protein from Rock bream and uses thereof <130> PN18238 <160> 8 <170> KoPatentIn 3.0 <210> 1 <211> 504 <212> DNA <213> Unknown <220> <223> Oplegnathus fasciatus <400> 1 atggaccaaa aggggaacat tgtttcaagg ctggagtggg gagcggctgc ccctcgacaa 60 aaggagactt tgaaaggctc tgcccggaga gtcgtcatac accacactgc cctcccaagc 120 tgcaaaggcc tgaaagagtg taaggaccgc cttgtcagca ttcagagagg acatatgacc 180 gaaaaaggct ttgatgacat tggatataat ttccttgtcg gaggagatgg taccgtgtac 240 gagggccgtg gctggggtgt ggtaggagca catgccaagg gcaacaatca tgactcagtg 300 ggggttgcct tcatgggcaa tttcaacaat gacacaccaa gcgcagaggc aatatcagca 360 gtcaaacagc tgctgcaggc tggagtctct cagggctttt tagagcaacc gtttgccctg 420 tgtgggcaca gagatgtggg atccaccgaa tgtccaggaa aaagtcttta tactgcgctg 480 ccacaactga ggggcaccac ataa 504 <210> 2 <211> 167 <212> PRT <213> Unknown <220> <223> Oplegnathus fasciatus <400> 2 Met Asp Gln Lys Gly Asn Ile Val Ser Arg Leu Glu Trp Gly Ala Ala 1 5 10 15 Ala Pro Arg Gln Lys Glu Thr Leu Lys Gly Ser Ala Arg Arg Val Val 20 25 30 Ile His His Thr Ala Leu Pro Ser Cys Lys Gly Leu Lys Glu Cys Lys 35 40 45 Asp Arg Leu Val Ser Ile Gln Arg Gly His Met Thr Glu Lys Gly Phe 50 55 60 Asp Asp Ile Gly Tyr Asn Phe Leu Val Gly Gly Asp Gly Thr Val Tyr 65 70 75 80 Glu Gly Arg Gly Trp Gly Val Val Gly Ala His Ala Lys Gly Asn Asn 85 90 95 His Asp Ser Val Gly Val Ala Phe Met Gly Asn Phe Asn Asn Asp Thr 100 105 110 Pro Ser Ala Glu Ala Ile Ser Ala Val Lys Gln Leu Leu Gln Ala Gly 115 120 125 Val Ser Gln Gly Phe Leu Glu Gln Pro Phe Ala Leu Cys Gly His Arg 130 135 140 Asp Val Gly Ser Thr Glu Cys Pro Gly Lys Ser Leu Tyr Thr Ala Leu 145 150 155 160 Pro Gln Leu Arg Gly Thr Thr 165 <210> 3 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 3 cccctgcagg acgtctacaa 20 <210> 4 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 4 aacacgaccg acgggtaca 19 <210> 5 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 5 aagcgcagag gcaatatcag 20 <210> 6 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 6 tgtggcagcg cagtataaag 20 <210> 7 <211> 49 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 7 ctgttccact ctagaaataa ttttgtttaa ctttaagaag gagatatac 49 <210> 8 <211> 55 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 8 gatatggctc tcgagttagt ggtggtggtg gtggtgcgtg gtaccacgca actgc 55

Claims (9)

OfPGRP-SC2 (peptidoglycan recognition protein-SC2) protein derived from dome (Olegnathus fasciatus ) consisting of the amino acid sequence of SEQ ID NO: 2. The gene encoding the protein of claim 1 OfPGRP-SC2. The gene according to claim 2, wherein the gene consists of the nucleotide sequence of SEQ ID NO: 1. A recombinant vector comprising the gene of claim 2. A host cell transformed with the recombinant vector of claim 4. A method of producing OfPGRP-SC2 protein comprising the step of transforming a host cell with the recombinant vector of claim 4 to overexpress a gene encoding the OfPGRP-SC2 protein. OfPGRP-SC2 protein produced by the method of claim 6. An antimicrobial composition for fish containing the OfPGRP-SC2 protein of claim 1 or 7 as an active ingredient. A feed additive for fish containing OfPGRP-SC2 protein of claim 1 or 7 as an active ingredient.

Images