CN112410354B

CN112410354B - Cinnamic acid-4-hydroxylase gene ThC4H and application thereof

Info

Publication number: CN112410354B
Application number: CN202011251438.9A
Authority: CN
Inventors: 夏鹏国; 胡婉莹; 张宇; 杨东风; 章彩娟; 梁宗锁
Original assignee: HANGZHOU SANYEQING AGRICULTURAL TECHNOLOGY CO LTD
Current assignee: HANGZHOU SANYEQING AGRICULTURAL TECHNOLOGY CO LTD
Priority date: 2020-11-10
Filing date: 2020-11-10
Publication date: 2022-06-07
Anticipated expiration: 2040-11-10
Also published as: CN112410354A

Abstract

The invention discloses a cinnamic acid-4-hydroxylase gene ThC4H derived from radix tetrastigme and application thereof, wherein the nucleotide sequence of the cinnamic acid-4-hydroxylase gene ThC4H is shown as SEQ ID NO. 1. The invention takes the radix tetrastigme as a biological source design primer to amplify the cDNA sequence of the radix tetrastigme to obtain the cinnamic acid-4-hydroxylase gene ThC4H, and the gene is used as one of key enzymes in a phenylpropane metabolic pathway and can be used for producing resveratrol.

Description

Cinnamic acid-4-hydroxylase gene ThC4H and application thereof

Technical Field

The invention relates to the technical field of genetic engineering, and mainly relates to a cinnamic acid-4-hydroxylase gene ThC4H from tetrastigma hemsleyanum diels and application thereof.

Background

With the high importance of China to Chinese medicines in recent years, the rapid development of the traditional Chinese medicine industry is driven by the strong support of the government, and the market demand of the radix tetrastigme (Tetrastigma hemsleyanum Diels et Gilg) is expanded. The research on the anti-tumor effect of the radix tetrastigme is deepened, so that the market price of the radix tetrastigme is leapfrogated in recent years, and the market demand of the radix tetrastigme is increased.

In recent years, the gene regulation of the synthesis of secondary metabolites of medicinal plants has become a very active leading research field in molecular biology, and the amount and composition of metabolites are mainly determined by biosynthesis key enzymes and the expression level in cells. The research on the radix tetrastigme is mainly focused on the aspects of planting and cultivation, seedling cultivation, extraction and separation of chemical components, pharmacological and pharmacodynamic effects and the like at present, and the research on the molecular level is less.

Resveratrol is a natural component in red wine known as French paradox, and a large number of scientific researches prove that resveratrol has the effects of targeting multiple targets, exerting multiple health benefits and treating diseases, and has great research value. Resveratrol is produced in plants mainly through the phenylalanine metabolic pathway which uses phenylalanine as a substrate, phenylalanine is catalyzed by phenylalanine ammonia-lyase (PAL) to generate trans-cinnamic acid, trans-cinnamic acid is catalyzed by cinnamate-4-hydroxylase (C4H) to form coumaric acid, which in turn forms 4-coumarate-CoA (4 CA) under the action of 4-coumarate-CoA ligase (4 CL), and finally Resveratrol Synthase (RS) catalyzes 1 molecule of 4CA and 3 molecules of malonyl-CoA (CoA ) to synthesize resveratrol.

At present, the whole genome of radix tetrastigme is not published, and it is necessary to explore key enzyme genes for biosynthesis of radix tetrastigme resveratrol, try to reveal the expression regulation and control conditions of the key enzyme genes in the biosynthesis pathway of the radix tetrastigme resveratrol, and hope to obtain high-yield resveratrol based on the key enzyme genes.

Disclosure of Invention

The invention provides a cinnamic acid-4-hydroxylase gene ThC4H derived from radix tetrastigme and application thereof, wherein the cinnamic acid-4-hydroxylase gene ThC4H is derived from radix tetrastigme, is used as one of key enzymes in a phenylpropane metabolic pathway, and can be used for producing resveratrol.

The specific technical scheme is as follows:

the invention provides a cinnamic acid-4-hydroxylase gene ThC4H, the nucleotide sequence of which is shown in SEQ ID NO. 1.

The invention provides a recombinant expression vector containing the cinnamic acid-4-hydroxylase gene ThC 4H.

Preferably, the expression vector is pMD19-T or pCMBIA 1301.

The invention also provides a genetically engineered bacterium containing the cinnamic acid-4-hydroxylase gene ThC 4H.

The host cell of the genetic engineering bacteria is escherichia coli DH5 alpha.

The invention also provides a cinnamic acid-4-hydroxylase, and the amino acid sequence of the cinnamic acid-4-hydroxylase is shown in SEQ ID NO. 2.

Preferably, the cinnamic acid-4-hydroxylase is encoded by a cinnamic acid-4-hydroxylase gene ThC4H having a nucleotide sequence shown as SEQ ID NO. 1.

The invention provides application of the genetic engineering bacteria in the production of resveratrol.

The invention provides application of the cinnamic acid-4-hydroxylase in producing resveratrol.

Compared with the prior art, the invention has the following beneficial effects:

the invention takes the radix tetrastigme as a biological source design primer to amplify the cDNA sequence of the radix tetrastigme to obtain the cinnamic acid-4-hydroxylase gene ThC4H, and the gene is used as one of key enzymes in a phenylpropane metabolic pathway and can be used for producing resveratrol.

Drawings

FIG. 1 shows the PCR electrophoresis of the tetrastigma hemsleyanum cinnamic acid-4-hydroxylase gene ThC 4H.

FIG. 2 is a secondary structure prediction for cinnamic acid-4-hydroxylase ThC 4H;

α -helix: the longest vertical line; extension chain: a second long vertical line; beta-turn: a third long vertical line; random curl: the shortest vertical line.

FIG. 3 is a three-dimensional structure prediction for cinnamic acid-4-hydroxylase ThC 4H.

FIG. 4 is a phylogenetic tree analysis of the amino acid sequence of the cinnamic acid-4-hydroxylase ThC 4H.

Detailed Description

The present invention will be further described with reference to the following specific examples, which are only illustrative of the present invention, but the scope of the present invention is not limited thereto.

Example 1 obtaining of cDNA full Length sequence of Tetrastigma hemsleyanum Diels et Gilg ThC4H Gene

Taking leaves of fresh plant of radix tetrastigme, wrapping with tin foil paper, quickly freezing with liquid nitrogen, extracting total RNA, and performing reverse transcription to obtain cDNA. The total RNA extraction was performed according to the instructions of the TIANGEN RNAprep Pure plant total RNA extraction kit (DP441), and the integrity and concentration thereof were detected by 1.0% agarose gel electrophoresis and a nucleic acid concentration detector.

Reverse transcription of Total RNA following Takara PrimeScript^TMII 1st Strand cDNA Synthesis Kit instructions.

According to the existing transcriptome data and the C4H gene sequence of the same family in NCBI, carrying out BLAST analysis, selecting the sequence with the highest similarity as a target gene sequence, and designing a plurality of pairs of primers by taking the open reading frame sequence of the sequence as a template, wherein the two pairs of amplification primers are (C4H-F1: 5'-ATGGATCTCATACTCATC-3', C4H-R1: 5'-TCAAGCTTCTATTGGCTT-3'; C4H-F2: 5'-ATGGATCTCATACTCATCG-3', C4H-R2: 5'-TCAAGCTTCTATTGGCTTTG-3').

Taking radix tetrastigme cDNA as a template, performing PCR amplification by using Premix Taq (Ex Taq Version 2.0plus dye), wherein the total reaction system of PCR gene amplification is 50 mu L: 25 μ L Premix Taq, 2.5 μ L Templa te cDNA, 1 μ L Forward primer, 1 μ L Reverse primer and 22 μ L RNase Free dH₂And O. After electrophoresis of the amplification product on 1.0% agarose gel, the results showed that C4H-F2 and C4H-R2 are usable primers and the annealing temperature is 52 ℃, and the results are shown in FIG. 1.

The amplification product was recovered by cutting with the Tiangen TIANgel Midi Purification Kit (DP190123) Kit, followed by ligating the recovered product to pMD19-T vector and incubating overnight at 16 ℃ with the ligation system: 0.5. mu.L of pMD19-T Vector, 4.5. mu.L of recovered product, and 5.0. mu.L of Solution I.

Adding 5 mu L of the ligation product into a competent cell of Escherichia coli DH5 alpha, gently mixing, placing on ice for 30 min, performing heat shock at 42 ℃ for 60s, quickly placing in ice for 2min, adding 700 mu L of LB culture medium, shaking the bacteria in a shaking table at 37 ℃ and 200rpm for 1h, sucking 200 mu L of the bacteria in a super clean bench, coating the bacteria on an LB solid culture substrate containing 100mg/L ampicillin, culturing in an incubator at 37 ℃ for 12h, selecting a monoclonal in an LB liquid culture medium (containing 100mg/L ampicillin), shaking the bacteria at 37 ℃ for 5h, performing PCR verification of bacteria liquid, and sending the verified correct sequence to be sequenced to obtain the gene sequence of the Tetrastigma hemsleyanum pratense ThC 4H.

The amino acid sequence of cinnamic acid-4-hydroxylase ThC4H in the trilobe resveratrol biosynthetic pathway was analyzed using DNAStar and DNMAN software. The Open Reading Frame (ORF) sequence of the C4H gene has 1518bp, and codes 505 Amino Acids, wherein, 70 strong alkaline Amino Acids (K, R), 63 strong acidic Amino Acids (D, E), 191 Hydrophobic Amino Acids (hydrophic Amino Acids) (A, I, L, F, W, V) and 96 Polar Amino Acids (Polar Amino Acids) (N, C, Q, S, T, Y).

ExPASY online software (https:// web. ExPASy. org/computer _ pI /) was used to predict a molecular weight of 57948.35 Daltons and an isoelectric point (pI) of 9.02, indicating that the protein is a basic protein. In addition, the prediction result of SMART online software (http:// SMART. embl-heidelberg. de /) shows that the protein has a transmembrane domain (transmembrane domains) and two low copy regions (low copy) which are respectively positioned at 9-28 aa, 413-425 aa and 449-462 aa of the predicted amino acid sequence.

Example 2 Secondary and Tertiary Structure prediction and evolutionary Tree analysis of ThC4H

The secondary structure of ThC4H protein in the resveratrol biosynthesis pathway was predicted using online software SOPMA (https:// npsa-prabi.ibcp.fr/cgi-bin/npsa _ Automat.pl.

Predicting the three-dimensional structure of ThC4H protein in the resveratrol biosynthesis pathway by using online software SWISS-MODEL (http:// swissmodel. expasy. org /), wherein the use method is X-ray, and the respective rate is

The results are shown in FIG. 3. The template number used was 6vby.1.A, the sequence Identity (Seq Identity) was 75.25%, the oligonucleotide status (Oligo-state) was Monomer, the sequence similarity to the template sequence (Seq similarity) was 0.54, the Coverage (Coverage) was 0.99, and the predicted sequence was described as cinnamate-4-hydroxylase, which is identical to the cloned gene.

Cinnamic acid-4-hydroxylase was cloned and analyzed in many species. The amino acid sequence of ThC4H and the amino acid sequence of the gene in other plants in NCBI database were subjected to multiple sequence alignment and construction of evolutionary trees by software Clustal X and MEGA6.0, and the specific species and protein sequence numbers are shown in Table 1. According to the results of the evolutionary tree (figure 4), the radix tetrastigme and the humifuse euphorbia herb belong to the same group of Vitaceae, which shows that the three have high homology on the protein C4H.

TABLE 1 nucleotide sequence for construction of evolutionary tree of Gene C4H

Example 3 functional verification of ThC4H Gene

The cDNA sequence of ThC4H gene and the distribution of the cleavage sites on the sequence of plasmid vector pCMBIA1301 were analyzed, and PCR primers (upstream primer: TCCCCCGGGA TGGATCTCATACTCATCG; downstream primer: GCTCTAGATCAAGCTTCTATTGGCTTTG) with SmaI and XbaI cleavage sites were designed for constructing an overexpression vector.

PCR amplification is carried out by taking radix tetrastigme cDNA as a template, a reaction system is the same as above, and after electrophoresis of an amplification product through 1.0% agarose gel, a DNA fragment consistent with a target gene is purified and recovered by using a kit. The purified and recovered product and plasmid pCMBIA1301 are subjected to double digestion at 37 ℃, agarose gel electrophoresis and then purified and recovered. The purified and recovered enzyme digestion products are connected by T4 DNA ligase, and are incubated overnight at 16 ℃, and the connecting system is as follows: mu.L of plasmid vector fragment, 6. mu.L of target gene fragment, 1. mu. L T4 ligase and 1. mu. L T4 ligase buffer. The ligation products were transformed into E.coli DH 5. alpha. and subsequently plated and screened. And (3) selecting a single colony on an LB solid plate containing Kan, shaking the bacteria for culture, carrying out enzyme digestion on the bacteria liquid PCR to verify positive clone, and sequencing after the verification is successful. Then, the positive recombinant plasmid is cultured by LB (Kan resistance) liquid culture medium to extract plasmid, and the plasmid is extracted according to the instruction of a plasmid miniextraction kit (Tiangen biology, Ltd.).

And (3) respectively transforming the competent cells of the agrobacterium rhizogenes ATCC15834 by using the empty vector and the recombinant plasmid, and screening out positive clones by bacterial liquid PCR identification and enzyme digestion identification. And (3) infecting the tetrastigma hemsleyanum dielset hemsl seedlings with the screened positive clones, extracting the genome DNA of the resistant plants, and extracting the genome DNA according to a CTAB method. And (3) identifying the over-expressed plant by PCR, carrying out agarose gel electrophoresis on a PCR product of the over-expressed plant, purifying and recovering a band obtained by cloning, and carrying out sequencing verification.

200 mu L of the bacterial liquid of the positive clone is taken to be cultured in LB (Kan resistance) liquid medium with oscillation at 37 ℃, and when the bacterial liquid reaches logarithmic growth period (OD)₆₀₀0.5), IPTG is added to induce expression of the recombinant protein, the concentration of IPTG is 0.4mmol/L, and the suitable induction time is 2 h. High performance liquid chromatography is utilized to determine gene transformation of subculture for 2 months and accumulation of resveratrol in wild type radix tetrastigme seedlingsAnd the activity of the cinnamic acid-4-hydroxylase is detected in vitro by a Bradford method.

The relative expression level of ThC4H was increased in transgenic seedlings overexpressing ThC4H compared to wild type, as was the content of resveratrol, consistent with the expected results.

Sequence listing

<110> Shaoxing biological medicine research institute Co., Ltd, university of Zhejiang science and technology

<120> cinnamic acid-4-hydroxylase gene ThC4H and application thereof

<160> 8

<170> SIPOSequenceListing 1.0

<210> 1

<211> 1518

<212> DNA

<213> Hemsley leaf (Tetrastigma hemsleyanum Diels et Gilg)

<400> 1

atggatctca tactcatcga gaaagctctg ttggcggttt tctttgccat aattctcgcc 60

gtcggcatct cgaggtttct cggaaggaag ttgaagatgc cgccggggcc tctgccggtg 120

ccggttttcg ggaactggct gcaggttggg gatgatttga accatcggaa tctgacggat 180

tatgcgaaga agttcgggga tatttttcag ctccggatgg ggcagcggaa cctggtggtg 240

gtgtcgtcgc cggatttggc gaaggatgtt ttgcacactc agggagtgga gtttggatcg 300

cgcaccagaa atgtggtgtt cgatatcttc accggtaagg gacaggacat ggttttcacg 360

gtgtacggag agcattggcg gaagatgcgg cggatcatga ccgttccttt cttcaccaac 420

aaggtggttc agcaataccg cgccggatgg gaggacgagg cggcgcgtgt ggtggaggac 480

gtgaagaaga atcctgattc caccaccacc ggaatcgtgc tgaggaggcg gttgcagctc 540

atgatgtaca acaacatgta cagaatcatg ttcgatagaa gatttgagag cgaggaggat 600

ccattgttcg tgaagctgaa agccttgaac ggtgagagga gtagactggc tcagagcttc 660

gagtacaatt atggcgattt cattcccatt ctgagaccgt tcttgagagg ttacctgaaa 720

atctgcaagg aagttaagga tagaaggttg cagctcttca aggaccattt cgttgaggag 780

aggaagaagc tggcgagcac aaaaagggca gataacaaca gtctaaaatg cgccgttgat 840

catattttgg atgctcagca gaagggagag atcaacgagg acaacgtcct ttacattgtg 900

gagaacatca atgttgctgc cattgaaacc acattgtggt caatcgagtg gggcatcgca 960

gagctggtga accaccctca catccagaag aaggtcaggg acgagatgac cgccatcctc 1020

ggccccggcg tccaaatcac cgaacccgac gtccagaaac tcccatacct ccaagctgta 1080

gtcaaagaaa ctctccggct aaggatggcc atacccctgt tggtccccca catgaacctc 1140

aacgaggcga agctcggcgg ctacaacatc cccgccgaga gcaagatcct cgtgaacgca 1200

tggtggctcg ccaacaaccc cgacatgtgg aaaaaaccgg aagagttccg gccggaaaga 1260

ttcttggagg aggaatcaaa ggtagagcct agtggagatg atttcaggta cctccccttt 1320

ggagttggaa gaagaagctg ccctggaatt atccttgctc ttcccatcct aggtatcacc 1380

ataggacgcc ttgttcagaa ttttgagctc cttcctcctc caggacagga caagattgac 1440

acctcagaga agggtggaca gttcagtctc cacatcttga agcactccac cattgtggca 1500

aagccaatag aagcttga 1518

<210> 2

<211> 505

<212> PRT

<213> Hemsley rockvine root (Tetrastigma hemsleyanum Diels et Gilg)

<400> 2

Met Asp Leu Ile Leu Ile Glu Lys Ala Leu Leu Ala Val Phe Phe Ala

1 5 10 15

Ile Ile Leu Ala Val Gly Ile Ser Arg Phe Leu Gly Arg Lys Leu Lys

20 25 30

Met Pro Pro Gly Pro Leu Pro Val Pro Val Phe Gly Asn Trp Leu Gln

35 40 45

Val Gly Asp Asp Leu Asn His Arg Asn Leu Thr Asp Tyr Ala Lys Lys

50 55 60

Phe Gly Asp Ile Phe Gln Leu Arg Met Gly Gln Arg Asn Leu Val Val

65 70 75 80

Val Ser Ser Pro Asp Leu Ala Lys Asp Val Leu His Thr Gln Gly Val

85 90 95

Glu Phe Gly Ser Arg Thr Arg Asn Val Val Phe Asp Ile Phe Thr Gly

100 105 110

Lys Gly Gln Asp Met Val Phe Thr Val Tyr Gly Glu His Trp Arg Lys

115 120 125

Met Arg Arg Ile Met Thr Val Pro Phe Phe Thr Asn Lys Val Val Gln

130 135 140

Gln Tyr Arg Ala Gly Trp Glu Asp Glu Ala Ala Arg Val Val Glu Asp

145 150 155 160

Val Lys Lys Asn Pro Asp Ser Thr Thr Thr Gly Ile Val Leu Arg Arg

165 170 175

Arg Leu Gln Leu Met Met Tyr Asn Asn Met Tyr Arg Ile Met Phe Asp

180 185 190

Arg Arg Phe Glu Ser Glu Glu Asp Pro Leu Phe Val Lys Leu Lys Ala

195 200 205

Leu Asn Gly Glu Arg Ser Arg Leu Ala Gln Ser Phe Glu Tyr Asn Tyr

210 215 220

Gly Asp Phe Ile Pro Ile Leu Arg Pro Phe Leu Arg Gly Tyr Leu Lys

225 230 235 240

Ile Cys Lys Glu Val Lys Asp Arg Arg Leu Gln Leu Phe Lys Asp His

245 250 255

Phe Val Glu Glu Arg Lys Lys Leu Ala Ser Thr Lys Arg Ala Asp Asn

260 265 270

Asn Ser Leu Lys Cys Ala Val Asp His Ile Leu Asp Ala Gln Gln Lys

275 280 285

Gly Glu Ile Asn Glu Asp Asn Val Leu Tyr Ile Val Glu Asn Ile Asn

290 295 300

Val Ala Ala Ile Glu Thr Thr Leu Trp Ser Ile Glu Trp Gly Ile Ala

305 310 315 320

Glu Leu Val Asn His Pro His Ile Gln Lys Lys Val Arg Asp Glu Met

325 330 335

Thr Ala Ile Leu Gly Pro Gly Val Gln Ile Thr Glu Pro Asp Val Gln

340 345 350

Lys Leu Pro Tyr Leu Gln Ala Val Val Lys Glu Thr Leu Arg Leu Arg

355 360 365

Met Ala Ile Pro Leu Leu Val Pro His Met Asn Leu Asn Glu Ala Lys

370 375 380

Leu Gly Gly Tyr Asn Ile Pro Ala Glu Ser Lys Ile Leu Val Asn Ala

385 390 395 400

Trp Trp Leu Ala Asn Asn Pro Asp Met Trp Lys Lys Pro Glu Glu Phe

405 410 415

Arg Pro Glu Arg Phe Leu Glu Glu Glu Ser Lys Val Glu Pro Ser Gly

420 425 430

Asp Asp Phe Arg Tyr Leu Pro Phe Gly Val Gly Arg Arg Ser Cys Pro

435 440 445

Gly Ile Ile Leu Ala Leu Pro Ile Leu Gly Ile Thr Ile Gly Arg Leu

450 455 460

Val Gln Asn Phe Glu Leu Leu Pro Pro Pro Gly Gln Asp Lys Ile Asp

465 470 475 480

Thr Ser Glu Lys Gly Gly Gln Phe Ser Leu His Ile Leu Lys His Ser

485 490 495

Thr Ile Val Ala Lys Pro Ile Glu Ala

500 505

<210> 3

<211> 18

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

atggatctca tactcatc 18

<210> 4

<211> 18

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

tcaagcttct attggctt 18

<210> 5

<211> 19

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

atggatctca tactcatcg 19

<210> 6

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 6

tcaagcttct attggctttg 20

<210> 7

<211> 28

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 7

tcccccggga tggatctcat actcatcg 28

<210> 8

<211> 28

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 8

gctctagatc aagcttctat tggctttg 28

Claims

1.A cinnamic acid-4-hydroxylase gene ThC4H is characterized in that the nucleotide sequence of the gene is shown in SEQ ID NO. 1.

2. A recombinant expression vector comprising the cinnamic acid-4-hydroxylase gene ThC4H of claim 1.

3. The recombinant expression vector of claim 2, wherein the expression vector is pMD19-T or pcmcia 1301.

4. A genetically engineered bacterium comprising the cinnamic acid-4-hydroxylase gene ThC4H according to claim 1.

5. A cinnamic acid-4-hydroxylase is characterized in that the amino acid sequence of the cinnamic acid-4-hydroxylase is shown in SEQ ID NO. 2.

6. The cinnamic acid-4-hydroxylase of claim 5, which is encoded by the cinnamic acid-4-hydroxylase gene ThC4H having the nucleotide sequence shown in SEQ ID No. 1.

7. The use of the genetically engineered bacterium of claim 4 in the production of resveratrol.

8. Use of the cinnamic acid-4-hydroxylase of any one of claims 5 or 6 in the production of resveratrol.