CN114410671B

CN114410671B - Aquilaria sinensis sesquiterpene synthase gene ASS15, and encoding product and application thereof

Info

Publication number: CN114410671B
Application number: CN202210099188.4A
Authority: CN
Inventors: 魏建和; 吕菲菲; 徐艳红; 杨云; 孙佩雯; 高志晖; 伍西南
Original assignee: Institute of Medicinal Plant Development of CAMS and PUMC
Current assignee: Institute of Medicinal Plant Development of CAMS and PUMC
Priority date: 2022-01-27
Filing date: 2022-01-27
Publication date: 2023-06-27
Anticipated expiration: 2042-01-27
Also published as: CN114410671A

Abstract

The invention provides a aquilaria sinensis sesquiterpene synthase gene ASS15, a coding product and application thereof, wherein the ASS15 gene can be used for identifying and screening the Qihan germplasm, can be used for identifying the Qihan germplasm and breeding high-quality Qihan germplasm, saves the breeding time of the high-quality Qihan germplasm, lays a foundation for development of functional molecular markers of the aquilaria sinensis germplasm and breeding of excellent aroma germplasm, provides theoretical basis and gene sources for breeding the high-quality Qihan new germplasm, and is beneficial to developing the sources of the Qihan germplasm; the aquilaria sinensis sesquiterpene synthase gene ASS15 can be expressed in a large amount and induce the formation of aquilaria sinensis when the germplasm of the aquilaria sinensis is damaged and induced, and can control the formation of the aquilaria sinensis by regulating and controlling the expression of the ASS15 gene, thereby having great significance for the research of the artificial incense-forming technology of the high-quality aquilaria sinensis.

Description

Aquilaria sinensis sesquiterpene synthase gene ASS15, and encoding product and application thereof

Technical Field

The invention relates to the technical field of biological genetic engineering, in particular to an aquilaria sinensis sesquiterpene synthase gene ASS15, and a coding product and application thereof.

Background

The aquilaria sinensis is a tropical subtropical evergreen tree of the agilawood genus of the daphnaceae family, and is the only basic plant of the domestic agilawood. The healthy aquilaria sinensis tree does not produce agilawood, and only after being damaged, agilawood can be formed in the stems. The agilawood is a traditional rare and fragrant medicine, and the Chinese pharmacopoeia records that the agilawood has the efficacy of promoting qi circulation, relieving pain, warming middle-jiao, arresting vomiting and relieving asthma. Modern medical research also proves that the agilawood can be used for treating symptoms such as chest and abdomen distension and pain, stomach cold and vomiting, kidney deficiency, asthma and the like, and has good effects of easing pain, resisting inflammation, resisting tumor and the like. In recent years, a mode of inducing aquilaria sinensis to form incense by artificial injury is mainly adopted to produce agilawood, and a wild tree species which is easy to form incense after injury and has better quality and excellent incense forming performance is found in the process of forming incense by drilling. After grafting and breeding, the tree species can well maintain the aroma character of the tree species, can be bred in a large quantity and is named as the phoebe chebula germplasm. The traditional germplasm breeding method is difficult to select and cultivate the phoenix germplasm with excellent aroma forming performance from a plurality of aquilaria sinensis germplasm, a MCID (manual cultivar identification diagram) method established by an RAPD molecular marker in the previous work of people can well identify a plurality of phoenix germplasm and aquilaria sinensis germplasm, but the method needs a large amount of samples to construct an MCID map, can not identify the quality of germplasm aroma forming, and severely restricts the cultivation and efficient utilization of the phoenix germplasm.

Sesquiterpenes are one of the main components of agilawood, no sesquiterpenes are contained in the stems of healthy aquilaria sinensis, and the synthesis and accumulation can be realized only after injury. The characteristic of the phoenix germplasm aroma is better than that of common aquilaria sinensis germplasm, the sesquiterpene synthesis regulation mechanism in the strophe germplasm after injury is obviously superior to that of common aquilaria sinensis germplasm, however, no molecular regulatory mechanism for the difference in sesquiterpene synthesis in two germplasm aroma has been reported so far. Sesquiterpene synthases are key catalytic enzymes for the injury-induced synthesis of agilawood sesquiterpenes, and can catalyze farnesene pyrophosphate (FPP) to form a sesquiterpene skeleton in plants. Therefore, the research on the expression difference of the sesquiterpene synthase gene in the Qihan germplasm and the common aquilaria sinensis germplasm can reveal the molecular regulation mechanism of the synthesis difference of the sesquiterpene induced by two germplasm injuries, and lay a foundation for the development of a new method for identifying and breeding the excellent germplasm of the aquilaria sinensis.

Disclosure of Invention

The invention aims to study the effect of an agilawood sesquiterpene synthase gene in the synthesis process of agilawood volatile products and the injury induction expression difference between the germplasm of the photinia serrulata and the germplasm of common aquilaria sinensis, and provides an aquilaria sinensis sesquiterpene synthase gene ASS15, a coding product thereof and application thereof in the germplasm of the photinia serrulata.

The technical scheme of the invention is realized as follows:

an aquilaria sinensis sesquiterpene synthase gene ASS15, wherein the ASS15 gene is derived from a phoenix germplasm of aquilaria sinensis (Aquilaria sinensis (lour.) spreng.) and has a nucleotide sequence shown as SEQ ID No. 1.

Preferably, the amino acid sequence of the coding product of the ASS15 gene is shown as 11 th to 613 th positions in SEQ ID NO. 2.

The invention also provides application of the ASS15 gene and the coding product thereof in the Phoebe cheilis germplasm.

Preferably, the use includes use in screening the germplasm of Photinia fraseri or modulating the formation of agilawood.

Preferably, the step of screening the photinia serrulata germplasm is to perform injury induction on the aquilaria sinensis tree species, and the method comprises the steps of detecting the expression condition of ASS15 genes after 0-24 h of induction, and screening out the photinia serrulata germplasm.

Preferably, the screening criteria are the Phoebe cheilis germplasm if the ASS15 gene is significantly expressed after the injury induction compared to before the injury induction, otherwise, the Aucklandia lappa germplasm.

Preferably, the agilawood in the formation of the regulatory agilawood is agilawood produced by the germplasm of the photinia fraseri.

The gene expression quantity of the aquilaria sinensis sesquiterpene synthase gene ASS15 in the aquilaria sinensis germplasm is obviously higher than that of the common aquilaria sinensis germplasm, and the aquilaria sinensis can be expressed in a large quantity and induce the aquilaria sinensis to form when the aquilaria sinensis germplasm is damaged and induced.

Compared with the prior art, the invention has the beneficial effects that:

the invention provides a radix aquilariae sinensis sesquiterpene synthase gene ASS15 and a coded product and application thereof, wherein the gene can be used for identifying and screening the Phoebe sinensis germplasm, can be used for identifying and breeding the Phoebe sinensis germplasm, saves the breeding time of the Phoebe sinensis germplasm, lays a foundation for the development of functional molecular markers of the radix aquilariae sinensis germplasm and the breeding of excellent aroma germplasm, provides theoretical basis and gene sources for cultivating high-quality Phoebe sinensis germplasm, and is beneficial to developing the sources of the Phoebe sinensis germplasm.

The aquilaria sinensis sesquiterpene synthase gene ASS15 can be expressed in a large amount and induce the formation of aquilaria sinensis when the germplasm of the aquilaria sinensis is damaged and induced, and can control the formation of the aquilaria sinensis by regulating and controlling the expression of the ASS15 gene, thereby having great significance for the research of the artificial incense-forming technology of the high-quality aquilaria sinensis.

Drawings

FIG. 1 shows the amplified bands of ASS15 gene in example 1 of the present invention;

FIG. 2 is a structural prediction diagram of ASS15 gene expression protein in example 2 of the present invention;

FIG. 3 shows the analysis of the conserved sequence of ASS15 gene in example 2 of the present invention;

FIG. 4 is a phylogenetic tree of ASS15 gene according to the present invention in example 2;

FIG. 5 is an electrophoresis chart of the ASS15 prokaryotic cloning vector of example 3 of the present invention after cleavage;

FIG. 6 shows the results of coomassie brilliant blue staining induced by the recombinant protein ASS15 in example 3 of the present invention;

FIG. 7 is a gel imager image of prokaryotic expression of ASS15 recombinant proteins according to example 3 of the present invention;

FIG. 8 is a GC-MS spectrum showing in vitro enzyme function verification of ASS15 in example 3 of the present invention;

FIG. 9 shows the expression of ASS15 gene in different tissues of aquilaria sinensis in example 4 of the present invention;

FIG. 10 shows the ASS15 gene expression induced by injury at different times in example 4 of the present invention;

FIG. 11 shows the expression of ASS15 gene in different varieties of aquilaria sinensis in example 4 of the present invention;

FIG. 12 shows the expression of different sesquiterpene synthase genes in the germplasm of common aquilaria sinensis and the germplasm of Photinia fraseri in example 5 of the present invention;

Detailed Description

In order to better understand the technical content of the present invention, specific examples are provided below, and the present invention is further described.

EXAMPLE 1 ASS15 Gene clone acquisition

Selecting 3-year-old healthy phoebe stock, performing total-breaking dry injury treatment on the stems with the diameter (d) = (1.2+/-0.2) cm, cutting off the stems with the diameter of 2cm at the wound positions at 0, 2, 6 and 24 hours after injury, freezing and grinding the stems into powder by using liquid nitrogen, and extracting total RNA of the stems.

1. Mu.g of RNA was used

First-Strand cDNA Synthesis SuperMix (Trans, china) was reverse transcribed to synthesize a First strand of cDNA, which was used as a template for PCR amplification, and specific primers (F: ATGTCTTGCTTCCAAGCTCTT; R: ATAAGGGATTGGATCTACAAGTATG) were designed based on the full-length sequence of ASS15 CDS in transcriptome data, amplified with Premix PrimeStar HS (Takara, japan) to a final system of 20. Mu.L; amplification procedure: pre-denaturation at 94℃for 5min; denaturation at 94℃for 20s, annealing at 56℃for 1min, extension at 72℃for 2min, and cycling for 35 times; and finally, at 72 ℃ for 10min. The amplified product was recovered with a gel recovery kit (tial, china), ligated to a Blunt Simple T vector (Trans, china), transformed e.coli Trans1-T1 competent (Trans, china), and single colonies sequenced (Ai Ji biotechnology limited, guangzhou).

The gene sequence cloned from the Phoebe cheilis germplasm injury stems to 1 1812bp encodes 603 amino acids, and is compared with the germacra germplasm of a plurality of plants by NCBI, and the gene is similar to germacrene synthase sequences of a plurality of plants, which shows that the amplified gene is a radix aucklandiae sesquiterpene synthase gene, the nucleotide sequence of which is named ASS15, the nucleotide sequence of which is shown as SEQ ID NO.1, and the amino acid of protein encoded by the ASS15 gene is shown as 11 th to 613 th positions in SEQ ID NO. 2.

EXAMPLE 2 ASS15 bioinformatics analysis

Functional domain, protein physicochemical property and homologous evolution analysis are carried out on the ASS15 gene sequence with correct sequence, the protein functional domain coded by the gene is analyzed by utilizing an online tool InterProScan, the ASS15 protein characteristic is predicted by utilizing an online tool Protpam provided by ExPASy Proteomics Server, and the molecular formula of the ASS15 protein is presumed to be C ₃₁₁₈ H ₄₈₅₈ N ₈₃₄ O ₉₀₃ S ₂₄ The relative molecular mass is 69.16kD, the isoelectric point is 5.92, the average hydrophilicity coefficient is-0.301, and the hydrophilic protein is predicted; the instability factor was calculated as 45.35 and the protein was an unstable protein. Using TRMHMM Server v.2.0 (http:// www.cbs.dtu.dk/se)rdevices/TMHMM) transmembrane predictive ASS 15-encoded protein has no transmembrane domain, is an extracellular protein; the use of SignalP 4.1Server predictions showed that ASS15 protein did not have signal peptide in amino acid sequence, was a non-secreted protein, plant-mPloc (http:// www.csbio.sjtu.edu.cn/bionf/Plant-multi /) predicted that the protein was located in chloroplasts;

sequence alignment of amino acid sequence of ASS15 in BlastP tool in NCBI revealed that ASS15 possesses conserved domains RPx8W (59-69) and DDxxD (352-356) of higher plant sesquiterpene synthases, and homology with eucalyptus (Eucalyptus crandis), kapok (Gossypium arboreum), mao Sheyang (Populus trichocarpa), and Morus nodabilis reaches 62.66%. The ASS15 phylogenetic tree is constructed by the adjacent connection method of MEGA7.0 software, and clustering relation analysis is carried out, as shown in fig. 3, in 17 plant phylogenetic trees, ASS15 is singly clustered into one branch and then clustered together with the clustering branches of sweet wormwood (artemia annua), sunflower (Helianthus annuus) and solidago (Solidago canadensis) and the branches of Jatropha curcas (Gossypium arboreum) clustering, which shows that the relatedness of ASS15 protein and sesquiterpene synthase protein of the five plants is relatively close, and the similar functions can be realized.

Example 3 expression of ASS15 and functional verification thereof

3.1 Prokaryotic expression of ASS15

(1) Carrying out codon optimization on the ASS15 sequence which is sequenced correctly by prokaryotic expression codon optimization software, optimizing 8 rare codons in the ASS15 sequence according to the expression preference of escherichia coli on the premise of not changing the amino acid sequence, and introducing two restriction enzyme sites of NdeI and Xba I, wherein the optimized sequence is synthesized by Nanjing tripod biotechnology company. Ligation of the optimized ASS15 with the pCzn1 vector followed by transfer of the ligation product into BL21 (DE) 3Plyss ^TM And (3) performing induced expression in the competent E.coli, selecting monoclonal bacterial liquid for PCR identification, and further extracting recombinant plasmid for double enzyme digestion verification. As shown in FIG. 5, the recombinant plasmid was cut into 2 fragments and the sizes of the target fragment and vector were consistent, indicating that the target fragment had been successfully inserted into the pCzn1 vector.

(2) The mixture is shaken overnight to containBL21 (DE) 3Plyss of recombinant plasmid ^TM Bacterial liquid according to the following formula 1:100 is inoculated into 30mL LB culture solution of 50 mug/mL Amp, and is cultured by shaking at 37 ℃ and 220r/min until OD ₆₀₀ At 0.6-0.8, IPTG was added to a final concentration of 0.4mM, and the mixture was shaken at 37℃for 4h at 220r/min and at 11℃for 220r/min overnight, respectively, to induce expression of the fusion protein. 10000r/min, and 2min, and re-suspending the bacterial pellet with 0.2M PBS buffer. And (3) carrying out ultrasonic crushing on the heavy suspension, respectively taking the supernatant and the precipitate, and adding a loading buffer solution for heavy suspension. 12% SDS-PAGE was performed to reveal a band using Coomassie brilliant blue staining, and a specific protein band appeared above 66.2KD, but the target protein was precipitated in the bacterial pellet as inclusion body protein. Recombinant proteins are obtained by mutabilising and purifying inclusion body proteins.

(3) In order to verify the accuracy of expression of recombinant proteins, western blot detection was performed using HIS-tagged protein antibodies. Preparing SDS-PAGE gel with corresponding concentration, taking 0.5ml recombinant protein, adding 5 Xloading buffer solution, boiling at 100deg.C for 10min after fully mixing, loading, and electrophoresis. After electrophoresis, 300mA constantly flows through the membrane for 1h, proteins in the gel are transferred to the PVDF membrane, and the membrane is taken out and washed 4 times by TBST for 5min each time. 5% nonfat dry milk was blocked for 1h. TBST 1 was used: the HIS-tagged murine monoclonal antibody was diluted 1000, and PVDF membrane was placed in the diluted HIS antibody and incubated overnight at 4 ℃. The following day, TBST was washed 4 times, rabbit anti-mouse IgG antibody (1:10000) incubated for 1h, and after secondary antibody incubation, membranes were washed 4 times with TBST. ECL was used for color development and gel imager was used for imaging. The result shows that the recombinant protein can be specifically combined with the HIS antibody, and the successful expression of ASS15 prokaryotic protein is proved, and the amino acid sequence is shown as SEQ ID NO. 2.

3.2 in vitro enzyme function validation

200ul of the reaction system (25 mmol/L of Tirs-HCl pH7.0,10% glycerol, 10mmol/L of MgSO) was prepared in a 2ml centrifuge tube ₄ 5mmol/L DTT,46umol/L FPP,50umol/L recombinant protein) was vortexed and reacted in a water bath at 30℃for 2 h.

Catalytic products were detected using solid phase microextraction, CG-MS conditions: ionization mode EI, electron energy 70eV, carrier gas Ne, flow rate 1ml/min, sample inlet temperature 250 ℃, initial temperature 80 ℃, rise to 220 ℃ at 5 ℃/min, hold for 10min, rise to 240 ℃ at 10 ℃/min, hold for 3min, and scanning mass range 30-50amu.

The in-vitro catalytic reaction product is detected by GC-MS, a peak appears at 15.907min in comparison with a blank sample catalytic product, and the peak is Nerolidol (tertiary alcohol orange) in comparison with NIST database, which shows that the enzyme generated by ASS15 gene coding is a functional enzyme gene capable of catalyzing FPP to generate sesquiterpenes substances.

Example 4 analysis of expression Properties of ASS15

Method for measuring the expression of ASS 15: the expression characteristics of ASS15 gene were determined by qRT-PCR. A LightCycle 96 (Roche Switzerland) detection system was used, 20 μl reaction system: cDNA templates 1ul, ASS15 specific forward and reverse primers 1ul,2× SYBR Premix ex TaqTM (Trans, china) 10ul, ddH ₂ O7 ul, each sample was amplified 3 times in duplicate. The reaction uses glyceraldehyde triphosphate dehydrogenase Gene (GADPH) as reference gene, and the primer sequence is F: TGCTAAAGAAGAGGTGAAAAGGG; r: CCGCAAGGTCGTCATAGAGC. qRT-PCR procedure was as follows: 95 ℃ for 5min; the cycle was repeated 40 times at 95℃for 10s,56℃for 15s,72℃for 20 s.

a. Taking samples of different tissues of common aquilaria sinensis germplasm and phoenix germplasm, extracting total RNA, and measuring the expression condition of ASS15 genes in different tissues (roots, stems, leaves, seeds and fruits);

b. performing injury induction on common aquilaria sinensis germplasm and photinia serrulata germplasm (diatom green germplasm and concave germplasm) by adopting a physical peeling scratch method, taking stems after 0h, 6h and 24h of induction respectively, extracting total RNA, and measuring the expression condition of ASS15 genes after injury induction in different germplasm;

c. the expression of ASS15 gene in different germplasm and variety is determined by extracting total RNA from the stems of healthy common aquilaria sinensis variety and Photinia germplasm variety (sugar knot, aquilaria sinensis of Thermology 1, wave seed, jin Shashe and Ru lake).

As shown in fig. 9 to 11, comparing the in-stem expression of the common aquilaria sinensis and the phoenix germplasm, it was found that the ASS15 gene expression in the healthy stems of various phoenix germplasm was higher than that of the common aquilaria sinensis germplasm, and the ASS15 gene in the healthy common aquilaria sinensis variety was significantly lower than that of the rest phoenix germplasm.

The ASS15 expression quantity of the top-penetrating green and concave phoenix germplasm after peeling scratch injury gradually increases within 24 hours, but the common aquilaria sinensis has no obvious change, the ASS15 gene expression in the phoenix germplasm after injury treatment is obviously high in Yu Baimu, and the fact that the phoenix germplasm and the common aquilaria sinensis germplasm can be identified by detecting the expression condition of the ASS15 gene after injury induction is described.

EXAMPLE 5 analysis of expression Properties of different sesquiterpene synthase genes

The expression of ASS1, ASS2, ASS15, ASS17, ASS20, ASS23 genes in the healthy common aquilaria sinensis germplasm and the QRT-PCR was measured, and the expression levels of the genes were measured again after 30d of peeling scratch injury induction.

PCR primer and annealing temperature of each gene:

note that: the annealing temperatures described in the tables are the same as those of ASS15, and specific examples are shown in example 4;

the sesquiterpene synthase expression in the aquilaria sinensis germplasm is less, and the expression level can be greatly increased after injury induction. The common aquilaria sinensis and the Qilan species have various sesquiterpene synthases, and the injury induction expression conditions of the common aquilaria sinensis and the Qilan species are compared, 6 sesquiterpene synthases have obviously different injury induction expression modes in the two species (figure 12), but the relative expression quantity of ASS15 in healthy and injured Qilan stems is obviously higher than that of the common aquilaria sinensis, which indicates that the expression of ASS15 genes can be effectively distinguished, the common aquilaria sinensis and the Qilan species can be effectively distinguished, and the cloning and functional identification and expression characteristic difference of the ASS15 genes can be researched to lay a foundation for the development of functional molecular markers of the aquilaria sinensis species and the selective breeding of excellent aroma-forming species.

The foregoing description of the preferred embodiments of the invention is not intended to be limiting, but rather is intended to cover all modifications, equivalents, alternatives, and improvements that fall within the spirit and scope of the invention.

Sequence listing

<120> an aquilaria sinensis sesquiterpene synthase gene ASS15, and its coding product and application

<160> 2

<170> SIPOSequenceListing 1.0

<210> 1

<211> 1812

<212> DNA/RNA

<213> Aquilaria sinensis (Lour.) Spreng.

<400> 1

atgtcttgct tccaagctct tcttcccgca gcagcacccg ctgcatttcc agttccccag 60

cgcgctggtg ctgcgagcaa caggtcttgc ttccgagatt cggttcttgg aacaacatca 120

gctgtagttc gaaatcgagt tcgtgccaag gctgtgactc aagacgacca gcctcgtcgg 180

ttggctgatt ttcatcccga tatctggggt gaccgcttcc ttgccccctc tcctaatgct 240

tcggctaatg aaatggaaat attggagcat gaaaagctaa agcaagaggt gaggaagatg 300

ataattgcag gcattgaaga tccttcaaag aatatggact tggttgatac aatacaaagg 360

ttgggcgtct cttatcattt tgaggaggag atcaaggagt tattggagag aatgcaccgc 420

aatcttgatg catttgttaa ggataatgct gatgatcttc accaaatctc actttgcttt 480

aggttactaa ggcaacaggg ctacaaagtt tcgagtggtg aaatgtttaa cagcttcaaa 540

tatgatgagg gaaactttaa gcaatccctt acagaagacg gaaaaggact actaagcctc 600

tacgaagcca cacacttaag gattcatgga gaagatattc tagagaaagc attcactttt 660

agtgttgctc aactcaaatc cgtcgcattg aataatgcaa gtatgctact tacaagacaa 720

atcaatcatg ctttgaggtt tcccatccag aggaccatac cacggcttgt ggcaaggttc 780

tacatctcta tgtatcaaga gaagccttca cacaacccac gggttttgaa attttcaaaa 840

ttggatttta atatcttaca aaagcagtac caaaaggagc tcagccaaat atcaaggaga 900

tggtggaaag aattggatgt taaaaccaat ttcccatttg caagggacag aatggtggaa 960

gtatactttt gtatgatgca aatatatttt gagcctcagt atgccttggg cagggcaata 1020

ttaagcaaag ctattgctat ggcatctatc caggatgaca tatatgacgc ttatggtaca 1080

cctgaggagc tcgagcctct aactgaggca attcagcgga ggtgggatcc cgatgtggcg 1140

aatcaactac caggctacat caaaaatttc tacagagcac tcttgggttt gtacaacgaa 1200

attgaagatg aaattgctgc agaaggaaag ttatacaaag ttcagtatgc taaagaagag 1260

gtgaaaaggg tagctaaagc ttacatgaga gaagttaaat ggttccagca aaactataca 1320

cccaccatgg acgagtacat ggaagttgga cttgtgacct ctggctgtac acctatattg 1380

accgtggcct ttgctggagt tttgggggaa attgtaacta aaacaacttt tgaatggctt 1440

gtcaacttcc cgaagatagt cgtcgctacg tcaacgcttg gtaggctcta tgacgacctt 1500

gcggatcatg tccatgagat tgagcaagtg agggggcatg taccctcggc ggtggaatgt 1560

tacatgaaac agtatggggt gaccgaacat gaagcagttg aagaactctc caaattgatg 1620

gaaggtgcat ggaaagacat caatgaagaa tatcttggcc tctcaaaaac aatccctatg 1680

tctcttctca cgccaataat caattacgtg cgcctggggc cagttctcta ccatgaacgt 1740

gatggattca ctaatcctca tgctgttaaa gattttgtaa cttccatact tgtagatcca 1800

atcccttatt aa 1812

<210> 2

<211> 613

<212> PRT

<213> Aquilaria sinensis (Lour.) Spreng.

<400> 2

Met Asn His Lys Val His His His His His Met Ser Cys Phe Gln Ala

1 5 10 15

Leu Leu Pro Ala Ala Ala Pro Ala Ala Phe Pro Val Pro Gln Arg Ala

20 25 30

Gly Ala Ala Ser Asn Arg Ser Cys Phe Arg Asp Ser Val Leu Gly Thr

35 40 45

Thr Ser Ala Val Val Arg Asn Arg Val Arg Ala Lys Ala Val Thr Gln

50 55 60

Asp Asp Gln Pro Arg Arg Leu Ala Asp Phe His Pro Asp Ile Trp Gly

65 70 75 80

Asp Arg Phe Leu Ala Pro Ser Pro Asn Ala Ser Ala Asn Glu Met Glu

85 90 95

Ile Leu Glu His Glu Lys Leu Lys Gln Glu Val Arg Lys Met Ile Ile

100 105 110

Ala Gly Ile Glu Asp Pro Ser Lys Asn Met Asp Leu Val Asp Thr Ile

115 120 125

Gln Arg Leu Gly Val Ser Tyr His Phe Glu Glu Glu Ile Lys Glu Leu

130 135 140

Leu Glu Arg Met His Arg Asn Leu Asp Ala Phe Val Lys Asp Asn Ala

145 150 155 160

Asp Asp Leu His Gln Ile Ser Leu Cys Phe Arg Leu Leu Arg Gln Gln

165 170 175

Gly Tyr Lys Val Ser Ser Gly Glu Met Phe Asn Ser Phe Lys Tyr Asp

180 185 190

Glu Gly Asn Phe Lys Gln Ser Leu Thr Glu Asp Gly Lys Gly Leu Leu

195 200 205

Ser Leu Tyr Glu Ala Thr His Leu Arg Ile His Gly Glu Asp Ile Leu

210 215 220

Glu Lys Ala Phe Thr Phe Ser Val Ala Gln Leu Lys Ser Val Ala Leu

225 230 235 240

Asn Asn Ala Ser Met Leu Leu Thr Arg Gln Ile Asn His Ala Leu Arg

245 250 255

Phe Pro Ile Gln Arg Thr Ile Pro Arg Leu Val Ala Arg Phe Tyr Ile

260 265 270

Ser Met Tyr Gln Glu Lys Pro Ser His Asn Pro Arg Val Leu Lys Phe

275 280 285

Ser Lys Leu Asp Phe Asn Ile Leu Gln Lys Gln Tyr Gln Lys Glu Leu

290 295 300

Ser Gln Ile Ser Arg Arg Trp Trp Lys Glu Leu Asp Val Lys Thr Asn

305 310 315 320

Phe Pro Phe Ala Arg Asp Arg Met Val Glu Val Tyr Phe Cys Met Met

325 330 335

Gln Ile Tyr Phe Glu Pro Gln Tyr Ala Leu Gly Arg Ala Ile Leu Ser

340 345 350

Lys Ala Ile Ala Met Ala Ser Ile Gln Asp Asp Ile Tyr Asp Ala Tyr

355 360 365

Gly Thr Pro Glu Glu Leu Glu Pro Leu Thr Glu Ala Ile Gln Arg Arg

370 375 380

Trp Asp Pro Asp Val Ala Asn Gln Leu Pro Gly Tyr Ile Lys Asn Phe

385 390 395 400

Tyr Arg Ala Leu Leu Gly Leu Tyr Asn Glu Ile Glu Asp Glu Ile Ala

405 410 415

Ala Glu Gly Lys Leu Tyr Lys Val Gln Tyr Ala Lys Glu Glu Val Lys

420 425 430

Arg Val Ala Lys Ala Tyr Met Arg Glu Val Lys Trp Phe Gln Gln Asn

435 440 445

Tyr Thr Pro Thr Met Asp Glu Tyr Met Glu Val Gly Leu Val Thr Ser

450 455 460

Gly Cys Thr Pro Ile Leu Thr Val Ala Phe Ala Gly Val Leu Gly Glu

465 470 475 480

Ile Val Thr Lys Thr Thr Phe Glu Trp Leu Val Asn Phe Pro Lys Ile

485 490 495

Val Val Ala Thr Ser Thr Leu Gly Arg Leu Tyr Asp Asp Leu Ala Asp

500 505 510

His Val His Glu Ile Glu Gln Val Arg Gly His Val Pro Ser Ala Val

515 520 525

Glu Cys Tyr Met Lys Gln Tyr Gly Val Thr Glu His Glu Ala Val Glu

530 535 540

Glu Leu Ser Lys Leu Met Glu Gly Ala Trp Lys Asp Ile Asn Glu Glu

545 550 555 560

Tyr Leu Gly Leu Ser Lys Thr Ile Pro Met Ser Leu Leu Thr Pro Ile

565 570 575

Ile Asn Tyr Val Arg Leu Gly Pro Val Leu Tyr His Glu Arg Asp Gly

580 585 590

Phe Thr Asn Pro His Ala Val Lys Asp Phe Val Thr Ser Ile Leu Val

595 600 605

Asp Pro Ile Pro Tyr

610

Claims

1. The aquilaria sinensis sesquiterpene synthase gene ASS15 is characterized in that the nucleotide sequence of the ASS15 gene is shown as SEQ ID NO. 1.

2. The aquilaria sinensis sesquiterpene synthase gene ASS15 according to claim 1, wherein the ASS15 gene is derived from the germplasm of the stronana fraseri of aquilaria sinensis (Aquilaria sinensis (lour.) spreng.).

3. The encoded product of aquilaria sinensis sesquiterpene synthase gene ASS15 according to claim 1, wherein the amino acid sequence of the encoded product of ASS15 is shown as position 11-613 in SEQ ID No. 2.

4. The application of the aquilaria sinensis sesquiterpene synthase gene ASS15 and the coding product thereof is characterized in that the application is in the Qihan germplasm, the nucleotide sequence of the ASS15 gene is shown as SEQ ID NO.1, and the amino acid sequence of the coding product of the ASS15 is shown as 11 th to 613 th positions in SEQ ID NO. 2.

5. The use of the aquilaria sinensis sesquiterpene synthase gene ASS15 and its encoded products according to claim 4, characterized in that said use is in the screening of the germplasm of the phoenix.

6. The application of the aquilaria sinensis sesquiterpene synthase gene ASS15 and a coding product thereof according to claim 5, wherein the screening method is characterized in that the aquilaria sinensis tree species are subjected to injury induction, the expression condition of the ASS15 gene is detected 0-24 h after the induction, and the phoenix tree germplasm is screened out.

7. The use of the aquilaria sinensis sesquiterpene synthase gene ASS15 and its encoding products according to claim 6, wherein the screening criteria is that the tree species in which the ASS15 gene is significantly expressed after the injury induction is the stroma fraxinifolia germplasm compared to before the injury induction, and vice versa.

8. The use of the aquilaria sinensis sesquiterpene synthase gene ASS15 and its encoded products according to claim 4, wherein said use is in modulating agilawood formation.

9. The use of aquilaria sinensis sesquiterpene synthase gene ASS15 and its encoded products according to claim 8, wherein said lignum Aquilariae Resinatum is produced by the germplasm of the Photinia fraseri.