CN112724217A - Sweet wormwood MYB transcription factor AaMYB108 and application thereof - Google Patents

Abstract

The invention relates to a sweet wormwood MYB transcription factor AaMYB108 and application thereof in the technical field of plant biology. The nucleotide sequence of the transcription factor AaMYB108 is shown in SEQ ID NO. 1, and the amino acid sequence is shown in SEQ ID NO. 2. The transcription factor AaMYB108 can be used for activating the activity of a promoter of a key enzyme gene CYP71A V1 in an artemisinin biosynthesis pathway and positively regulating and controlling the expression of the key enzyme gene for artemisinin synthesis, so that the biosynthesis of artemisinin is promoted, and no harm is caused to the growth and development of plants, and compared with non-transgenic wild artemisia apiacea, the growth state of the artemisia apiacea is not different. The AaMYB108 transcription factor can be applied to the improvement of the yield of artemisinin by an over-expression method, and has important significance for the genetic engineering breeding of artemisia apiacea and the large-scale production of artemisinin.

Description

Sweet wormwood MYB transcription factor AaMYB108 and application thereof

Technical Field

The invention belongs to the technical field of genetic engineering, and particularly relates to a sweet wormwood MYB transcription factor AaMYB108 and application thereof.

Background

Artemisinin is a sesquiterpene lactone compound with peroxy group extracted from traditional Chinese medicine Artemisia annua, which was originally discovered by Chinese scientist U-yo in 1971, and contribution of artemisinin and dihydroartemisinin to the creation of a novel antimalarial drug-NOBEL physiology or medical prize in 2015 by Tuyoyo-yo in 2015 10 months was honored. Artemisinin is currently the only effective monomer against malaria, and in particular has a rapid onset of action against falciparum malaria. The main mechanism of artemisinin for resisting malaria is to destroy the structure of plasmodium membrane system, firstly act on food vacuole, surface membrane, mitochondria and endoplasmic reticulum, and in addition, have certain influence on endochromatin. The mode of action of artemisinin is mainly interference with the function of the pellicle-mitochondria. Artemisinin acts on food vacuole membrane to block the earliest stage of nutrient intake, so that the plasmodium is starved for amino acid quickly, autophagy vacuoles are formed quickly and are continuously discharged out of the plasmodium body, and the plasmodium loses a large amount of cytoplasm to die.

Artemisinin is the most effective component against malaria in Artemisia annua plants, however, artemisinin is present in Artemisia annua in very low amounts, only 0.1-1.0% on a dry weight basis. Promoting the production of artemisinin in plants is beneficial to improving the anti-malarial capability of the whole plants and reducing the tolerance of plasmodium to pure artemisinin. Therefore, the research on the synthetic pathway of the artemisinin has important significance for improving the content of the artemisinin in the artemisia apiacea.

MYB transcription factors, the largest class of transcription factors in plants, are involved in many vital activities including the cell cycle, physiological metabolic balance, and environmental responses. With the rapid increase of the number of MYB genes found in plants, the information of the MYB transcription factor such as a regulation mechanism, a gene expression profile and the determination of a target gene is continuously enriched. MYB transcription factors participate in a plurality of primary and secondary metabolic reaction processes such as flavonoid metabolic pathways, cell wall component synthesis, glucosinolate biosynthesis and the like, and play an important role in regulation.

Disclosure of Invention

In order to improve the content of artemisinin, the invention provides a sweet wormwood herb AaMYB108 gene and application thereof, wherein the gene codes a sweet wormwood herb MYB transcription factor AaMYB108, and the transcription factor can promote the activity of a key rate-limiting enzyme gene CYP71AV1 promoter in an artemisinin biosynthesis pathway and positively regulate the expression of CYP71AV1, so that the biosynthesis of artemisinin is promoted; the Artemisia apiacea AaMYB108 transcription factor is over-expressed in the Artemisia apiacea by utilizing a genetic engineering technology, the artemisinin content of a transgenic plant can be obviously improved, the normal growth and development of the plant cannot be influenced, and the method has important significance for germplasm innovation of the Artemisia apiacea, breeding of high-content artemisinin varieties and large-scale production of artemisinin.

The invention is realized by the following technical scheme:

in a first aspect, the invention provides a sweet wormwood MYB transcription factor AaMYB108, wherein the nucleotide sequence of the transcription factor AaMYB108 is shown as SEQ ID NO. 1; the amino acid sequence of the transcription factor AaMYB108 is shown in SEQ ID NO. 2.

Or a sweet wormwood MYB transcription factor AaMYB108, wherein the amino acid sequence of the transcription factor AaMYB108 is shown in SEQ ID NO. 2.

In a second aspect, the invention discloses a recombinant expression vector, which comprises the nucleotide sequence of the sweet wormwood MYB transcription factor AaMYB 108; or the recombinant expression vector can code the amino acid sequence of the sweet wormwood MYB transcription factor AaMYB 108.

In a third aspect, the invention discloses application of the sweet wormwood MYB transcription factor AaMYB108 in regulation and control of artemisinin biosynthesis, wherein the transcription factor AaMYB108 can activate the promoter activity of a key rate-limiting enzyme gene CYP71AV1 in an artemisinin downstream synthesis pathway.

Further, the artemisinin content of the transgenic plant can be increased by over-expressing the AaMYB108 gene, and the artemisinin content can be reduced by expressing the AaMYB108 gene in an antisense interference mode.

Further, the method comprises the following steps:

firstly, connecting a nucleotide sequence of a sweet wormwood MYB transcription factor AaMYB108 to a plant expression regulatory sequence, constructing an over-expression vector pHB-AaMYB108-YFP containing an AaMYB108 nucleotide sequence and an Antisense interference expression vector pHB-AaMYB108-Antisense, and transferring the over-expression vector pHB-AaMYB108-Antisense into an agrobacterium strain GV 3101;

step two, constructing a plant double-fluorescein detection report vector pGreenII0800-ProCYP71AV1 by using a promoter ProCYP71AV1 vector of an artemisinin biosynthesis key enzyme gene CYP71AV1 in sweet wormwood herb;

step three, respectively transferring the pHB-AaMYB108-YFP plant expression vector and the plant double-fluorescein detection report vector pGreenII0800-ProCYP71AV1 into an agrobacterium strain GV3101 with pSoup19 auxiliary plasmids to obtain an agrobacterium engineering strain containing a target vector;

step four, respectively mixing the agrobacterium engineering strain containing the pHB-AaMYB108-YFP plant expression vector and the agrobacterium engineering strain containing the pGreenII0800-ProCYP71AV1 plant double-fluorescein detection report vector according to a ratio of 1:1, injecting the mixture into tobacco leaves growing for 4-5 weeks in an injection infection mode, culturing the mixture in the dark for one day, and culturing the mixture in the light for one day;

taking a sample of the tobacco leaf injection part by using a puncher, quickly freezing by using liquid nitrogen, and grinding into powder;

sixthly, detecting the fluorescence intensity by adopting a Promega-Dual-Luciferase detection kit and a GloMax 20/20Luminometer fluorescence detector, and determining the activation effect of the transcription factor AaMYB108 on the promoter of the artemisinin synthesis key enzyme gene CYP71AV 1;

seventhly, transferring the over-expression vector pHB-AaMYB108-YFP and the Antisense interference expression vector pHB-AaMYB108-Antisense into an agrobacterium strain EHA105, and respectively obtaining an agrobacterium tumefaciens strain EHA105 containing the over-expression vector pHB-AaMYB108-YFP and the Antisense interference expression vector pHB-AaMYB108-Antisense for sweet wormwood herb transformation;

step eight, transferring the two kinds of agrobacterium tumefaciens in the step seven into the sweet wormwood, screening by using antibiotic hygromycin to obtain resistant seedlings, extracting plant DNA, and carrying out positive detection by using PCR to obtain transgenic sweet wormwood plants; through artemisinin content detection, the artemisinin content in the transgenic plant over expressing the AaMYB108 is obviously improved, the artemisinin content in the transgenic plant expressing the AaMYB108 through antisense interference is obviously reduced, and the positive regulation and control effect of the AaMYB108 on the artemisinin content is confirmed.

Further, in the first, third and seventh steps, the specific method is switched to: transferring by a freeze thawing method; in the eighth step, the specific method for performing positive detection by PCR comprises: designing a sequencing primer according to a nucleotide sequence of a transcription factor AaMYB108, carrying out DNA amplification, and observing a positive strain of a target strip under ultraviolet rays after electrophoresis of a PCR product to obtain a transgenic artemisia apiacea plant; the artemisinin content was determined by HPLC-ELSD method.

In a fourth aspect, the invention provides an application of excess AaMYB108 expression to increase the content of artemisinin in artemisia apiacea, which comprises the following steps:

analyzing a sweet wormwood transcription group database MYB transcription factor, and cloning a sweet wormwood MYB transcription factor AaMYB108 as defined in claim 1;

step two, operably linking AaMYB108 to a plant over-expression vector to form an over-expression vector;

step three, transferring the over-expression vector in the step two into agrobacterium to obtain an agrobacterium tumefaciens strain containing the over-expression vector;

step four, transferring the agrobacterium tumefaciens strain containing the over-expression vector in the step three into sweet wormwood, obtaining resistant seedlings through resistance screening, and obtaining transgenic sweet wormwood plants through PCR positive detection;

and step five, extracting artemisinin from the transgenic artemisia apiacea plant obtained in the step four, and determining the content of artemisinin by adopting an HPLC-ELSD method to obtain the transgenic artemisia apiacea plant with the significantly improved content of artemisinin.

Further, the specific steps are as follows:

analyzing a sweet wormwood transcription group database MYB transcription factor, and cloning a sweet wormwood MYB transcription factor AaMYB108 as defined in claim 1;

step two, operably connecting AaMYB108 to a plant over-expression vector to form an over-expression vector pHB-AaMYB 108-YFP;

step three, transferring the overexpression vector pHB-AaMYB108-YFP in the step two into an agrobacterium EHA105 strain to obtain an agrobacterium tumefaciens strain EHA105 containing the overexpression vector;

step four, transferring the agrobacterium tumefaciens in the step three into sweet wormwood, screening by hygromycin to obtain resistant seedlings, and carrying out positive detection by PCR to obtain transgenic sweet wormwood plants;

and step five, extracting artemisinin from the transgenic artemisia apiacea plant obtained in the step four, and determining the content of artemisinin by adopting an HPLC-ELSD method to obtain the transgenic artemisia apiacea plant with the significantly improved content of artemisinin.

AaMYB108 is a MYB transcription factor separated from the sweet wormwood, and the over-expression of AaMYB108 in the sweet wormwood plant can obviously improve the content of artemisinin, so that the transcription factor can regulate and control the biosynthesis of artemisinin, and the cloning of the gene has important significance for the genetic engineering breeding of the sweet wormwood and the large-scale production of artemisinin. Through the search of the prior art documents, no report related to the sequence of the AaMYB108 gene is found. The sequence is proposed for the first time by the invention.

The invention clones AaMYB108 gene from sweet wormwood by analyzing MYB transcription factor in sweet wormwood transcriptome database, constructs over-expression vector containing AaMYB108 gene, uses Agrobacterium tumefaciens EHA105 to mediate, and adopts leaf disc method to transform AaMYB108 gene over-expression vector into sweet wormwood; PCR detects the integration condition of the exogenous target gene AaMYB108, and the artemisinin content in the artemisia apiacea is determined by a high performance liquid chromatography-evaporative light scattering detector (HPLC-ELSD), which shows that the artemisinin content of the obtained transgenic artemisia apiacea is obviously improved.

In the present invention, various vectors known in the art, such as commercially available vectors, including plasmids, cosmids, and the like, can be used. When the Artemisia apiacea AaMYB108 protein polypeptide is produced, the Artemisia apiacea AaMYB108 protein coding sequence can be operably connected with a plant expression regulatory sequence, so that an Artemisia apiacea AaMYB108 protein expression vector is formed.

As used herein, "operably linked" refers to a condition in which certain portions of a linear DNA sequence are capable of affecting the activity of other portions of the same linear DNA sequence. For example, if the signal peptide DNA is expressed as a precursor and is involved in secretion of the polypeptide, the signal peptide (secretory leader) DNA is operably linked to the polypeptide DNA; a promoter is operably linked to a coding sequence if it controls the transcription of that sequence; a ribosome binding site is operably linked to a coding sequence if it is positioned so as to permit translation. Generally, "operably linked" means adjacent, and for secretory leaders means adjacent in reading frame.

The Agrobacterium related to the invention is Agrobacterium tumefaciens (Agrobacterium tumefaciens), strains of which are GV3101, GV3101 (psuup 19) and EHA105, respectively, and all of the strains can be purchased from the market publicly.

The invention has the advantages that: the transcription factor AaMYB108 for positively regulating the artemisinin biosynthesis has a remarkable activation effect on a key enzyme gene CYP71AV1 in the artemisinin biosynthesis pathway, and does not cause harm to plant growth and development, and the growth state of the plant is not different compared with that of non-transgenic wild type artemisia apiacea. The invention also constructs pHB-AaMYB108-Antisense interference vector by intercepting the coding region of the transcription factor gene and amplifying a sequence which is reversely complementary with the original gene sequence, and inhibits the expression of the gene in the southernwood. The invention changes the expression condition of corresponding genes in the sweet wormwood herb plant by using a genetic engineering means, improves the yield of the artemisinin and provides a new strategy for improving the yield of the artemisinin by metabolic regulation.

The present invention will be further described with reference to the accompanying drawings to fully illustrate the objects, technical features and technical effects of the present invention.

Drawings

FIG. 1 shows that the tobacco transiently transformed AaMYB108 significantly activates the activity of CYP71AV1 gene promoter.

FIG. 2 shows that AaMYB108 transcription factor regulates the artemisinin expression level in Artemisia annua; wherein the overexpression strain (AaMYB108OE) showed significantly increased artemisinin content and the antisense-interfering expression strain (AaMYB108-Anti) showed significantly decreased artemisinin content.

In the above figures, a indicates a significant difference from the control, and a indicates a very significant difference from the control.

Detailed Description

The following examples illustrate the invention in detail: the present embodiment is implemented on the premise of the technical solution of the present invention, and a detailed implementation manner and a specific operation process are given, but the protection scope of the present invention is not limited to the following embodiments. Experimental procedures without specific conditions noted in the following examples, generally followed by conventional conditions, such as molecular cloning in Sambrook et al: the conditions described in the Laboratory Manual (New York: Cold Spring Harbor Laboratory Press,1989), or according to the manufacturer's recommendations.

Example 1 cloning of the Artemisia apiacea AaMYB108 Gene

1. Extraction of total RNA of sweet wormwood genome

Taking sweet wormwood leaf tissue, placing the sweet wormwood leaf tissue in liquid nitrogen for grinding, adding the sweet wormwood leaf tissue into a 1.5mL Eppendorf (EP) centrifuge tube containing lysis solution, fully oscillating, and extracting total RNA according to the instruction of a TIANGEN kit. The total RNA mass was determined by agarose gel electrophoresis and the RNA concentration was determined on a spectrophotometer.

2. Cloning of Artemisia apiacea AaMYB108 gene

Taking the extracted total RNA of the sweet wormwood herb as a template, calculating the dosage according to the concentration of the RNA, and obtaining cDNA under the action of PowerScript reverse transcriptase; the sequence was obtained from the sequencing results of the Artemisia annua genome based on the nucleotide sequence of the AaMYB108 gene (SEQ ID NO: 1). Designing a gene specific primer, amplifying the AaMYB108 gene from the total cDNA by PCR, recovering and purifying a PCR product, connecting a blunt-end pLB vector (a product of Tiangen biochemistry Co., Ltd.) and sequencing to obtain a pLB-AaMYB108 plasmid vector, extracting the plasmid and sequencing.

Through the steps, a coding sequence (SEQ ID NO:1) of the AaMYB108 transcription factor in the southernwood is obtained, and a protein coding sequence (SEQ ID NO:2) of the coding sequence is deduced, wherein the initiation codon is ATG, and the stop codon is TGA.

Example 2 construction of plant expression vector containing AaMYB108 Gene

1. Construction of overexpression vector pHB-AaMYB108-YFP

The AaMYB108 gene is amplified from a blunt-end vector pLB with correct sequencing and is constructed on a plant expression vector pHB-YFP, a BamHI enzyme cutting site is introduced into a forward primer and a SpeI enzyme cutting site is introduced into a reverse primer for facilitating the construction of the expression vector, and the primer sequences are as follows:

forward primer MYB 108-YFP-F: TCTCTCTCTAAGCTTGGATCCATGAATAGCAACAACAAC, SEQ ID NO.3

Reverse primer MYB 108-YFP-R: GCCCTTGCTCACCATACTAGTCATGTCGAATTGTTGTT, SEQ ID NO.4

2. Construction of antisense interference expression vector pHB-AaMYB108-antisense

After the nucleotide sequence of the AaMYB108 with correct sequencing is reversely complemented, a primer is designed, a reverse complementary sequence of the AaMYB108 gene is amplified from a blunt-end vector pLB and is constructed on a plant expression vector pHB, in order to facilitate construction of the expression vector, a forward primer introduces a SpeI enzyme cutting site, a reverse primer introduces a BamHI enzyme cutting site, and the sequence of the primer is as follows:

forward primer Anti-MYB 108-F: GCTCTAGAATGAATAGCAACAACAAC, SEQ ID NO.5

Reverse primer Anti-MYB 108-R: CGGGATCCTCACATGTCGAA, SEQ ID NO.6

Example 3 construction of Bisphorescin reporter vector for Gene CYP71AV1 promoter, a Key enzyme for artemisinin biosynthesis

PCR amplification of promoter of key enzyme gene CYP71AV1 for artemisinin biosynthesis

According to sequence information of key enzyme genes for artemisinin biosynthesis in an NCBI database, a promoter amplification specific primer of CYP71AV1 is designed, Artemisia apiacea genomic DNA is used as a template for amplification, and HindIII and PstI enzyme cutting sites are respectively added at the upstream and downstream of the primer.

The forward primer CYP71AV 1-P-F: AAATGGGTCAATTTCGGGTT, SEQ ID NO.7

The reverse primer CYP71AV 1-P-R: CATTGCTTTTAGTATACTCTTC, SEQ ID NO.8

2. Ligation of promoter fragments into a Bifluorescein reporter vector

By utilizing a homologous recombination method, the amplified promoter sequence of CYP71AV1 is constructed on a pGreenII0800-LUC vector through a Clonexpress II One Step Cloning Kit (Novozam, Nanjing) Kit, and a plant double-fluorescein detection report vector pGreenII0800-ProCYP71AV1 is obtained.

Example 4 detection of transcription factor AaMYB108 on promoter of Gene CYP71AV1 in tobacco transient transformation Activation action

1. Obtaining of Agrobacterium engineering strains

The pHB-YFP empty vector and the plant expression vector pHB-AaMYB108-YFP containing AaMYB108 in the example 2 are transferred into agrobacterium tumefaciens GV3101 by a freeze-thaw method, and the plant double-fluorescein detection report vector pGreenII0800-ProCYP71AV1 in the example 3 is transferred into agrobacterium tumefaciens GV3101 with pSoup auxiliary plasmid by the freeze-thaw method to respectively obtain agrobacterium engineering strains containing the empty vector, the AaMYB108 gene and the CYP71AV1 gene promoter.

2. Transient transformation of tobacco

Inoculating the positive strains of the agrobacterium engineering strains in a liquid culture medium of 10ml according to the proportion of 1:100 for expanding culture, and culturing overnight at 28 ℃; centrifuging at 4500rpm for 10min to collect thallus; resuspending the cells using MS liquid medium, and diluting each cell concentration to OD using MS liquid medium₆₀₀Is 0.6; acetosyringone (AS) was added to the mixture at a final concentration of 200. mu. mol/L and MES (pH 5.7) was added thereto, and the mixture was allowed to stand at room temperature for 3 hours.

The agrobacterium engineering strain containing pHB-AaMYB108-YFP and an empty vector is mixed with the agrobacterium engineering strain containing pGreenII0800-ProCYP71AV1 plant double-fluorescein detection report vector according to the ratio of 1:1, and then the mixture is injected into tobacco leaves growing for 4-5 weeks in an injection infection mode through a 1mL needle-free injector, and the tobacco leaves are cultured for one day in the dark and then in the light for one day.

Dual-Luciferase assay

Taking tobacco leaf cultured for 2 days, quickly freezing with liquid nitrogen, and grinding into powder. Use Dual-

The Reporter Assay System kit and GloMax 20/20Luminometer fluorescence detector were used to measure fluorescence intensity, and the procedure was followed according to the kit instructions. The results are shown in fig. 1, AaMYB108 significantly activates the activity of the CYP71AV1 gene promoter.

Example 5 Agrobacterium tumefaciens-mediated overexpression of AaMYB108 and antisense interference vector genetic transformation of Artemisia annua Obtaining transgenic sweet wormwood plant

1. Obtaining of Agrobacterium tumefaciens engineering bacteria containing AaMYB108 overexpression and antisense interference expression vector

The AaMYB 108-containing plant overexpression and antisense interference expression vector in example 2 was transformed into Agrobacterium tumefaciens EHA105 (commercially available biomaterials with strain number of Gambar 1, available from CAMBIA, Australia) by freeze-thawing, and verified by PCR detection using the primers in example 2. The positive result shows that the plant over-expression and antisense interference vector containing AaMYB108 is successfully constructed into the Agrobacterium tumefaciens strain.

2. Agrobacterium tumefaciens-mediated AaMYB108 gene transformation southernwood

2.1. Pre-culture of explants

Soaking herba Artemisiae Annuae seed in 75% ethanol for 1min, centrifuging, washing with sterile water for 2-3 times, soaking in 20% NaClO for 20min, washing with sterile water for 4-5 times, inoculating in hormone-free MS (Murashige and Skoog,1962) solid culture medium, culturing at 25 deg.C under 16h/8h (light culture/dark culture) and germinating to obtain herba Artemisiae Annuae aseptic seedling. After the seedling grows to about 5cm, shearing a sterile seedling leaf explant for transformation.

2.2. Co-culture of Agrobacterium with explants

Transferring the leaf explant into a co-culture medium (1/2MS + AS 100 mu mol/L), dropwise adding 1/2MS suspension of the activated Agrobacterium tumefaciens engineering bacteria containing the AaMYB108 plant overexpression and antisense interference expression vector, fully contacting the explant with a bacterial solution, and performing dark culture at 28 ℃ for 3 d. Control was leaf explants dropped on 1/2MS liquid medium suspension of Agrobacterium tumefaciens without the gene of interest.

2.3. Selection of resistant regenerated plants

Transferring the sweet wormwood herb explants cultured for 3d in the co-culture process to a germination screening medium (MS +6-BA 0.5mg/L + NAA 0.05mg/L + Hyg 5mg/L + Cef 500mg/L), performing illumination culture at 25 ℃ for 16h/8h (light culture/dark culture), performing subculture once every two weeks, and performing subculture for 2-3 times to obtain Hyg-resistant cluster buds. Shearing off the well-grown resistant cluster buds, transferring the cluster buds to a rooting medium (1/2MS + Cef125mg/L) and culturing until the cluster buds grow to root, thereby obtaining a Hyg resistant regeneration sweet wormwood plant.

3. PCR detection of transgenic southernwood plant

And respectively designing a forward detection primer and a reverse detection primer according to the gene sequence of AaMYB108 and the plant pHB-YFP vector sequence to carry out positive detection on the over-expression plant and the antisense interference plant. The result shows that the designed PCR specific detection primer can be used for amplifying a specific DNA fragment. When non-transformed genomic DNA of Artemisia annua is used as a template, no fragment is amplified.

In this embodiment, the plant expression vector is transformed into agrobacterium tumefaciens EHA105 to obtain an agrobacterium tumefaciens strain containing a plant overexpression and antisense interference expression vector for transforming artemisia annua, and the constructed agrobacterium tumefaciens strain is used to transform artemisia annua to obtain a transgenic artemisia annua plant detected by PCR. The acquisition of transgenic southernwood plants provides direct materials for screening southernwood strains with higher artemisinin content.

Example 6 determination of artemisinin content in transgenic Artemisia annua by HPLC-ELSD

HPLC-ELSD conditions and System applicability and preparation of Standard solutions

HPLC: a water alliance 2695 system is adopted, a chromatographic column is a C-18 reverse phase silica gel column (SymmetryShieldTM C18, 5 mu m, 250 multiplied by 4.6mm, Waters), a mobile phase is methanol to water, the volume ratio of the methanol to the water is 70:30, the column temperature is 30 ℃, the flow rate is 1.0mL/min, the sample injection amount is 10 mu L, the sensitivity (AUFS is 1.0), and the theoretical plate number is not lower than 2000 calculated according to an artemisinin peak.

ELSD: adopting a water alliance 2420 system, wherein the temperature of a drift tube of the evaporative light scattering detector is 40 ℃, the amplification factor (gain) is 7, and the carrier gas pressure is 5 bar;

accurately weighing 2.0mg of artemisinin standard (Sigma company), dissolving completely with 1mL of methanol to obtain 2mg/mL of artemisinin standard solution, and storing at-20 deg.C for use.

In the invention, when the mobile phase is methanol (methanol) and water in a ratio of 70% to 30%, the retention time of the artemisinin is 5.1min, and the peak pattern is good. The theoretical plate number is not less than 2000 calculated by artemisinin.

2. Preparation of Standard Curve

And respectively injecting 2 mu l, 4 mu l, 6 mu l, 8 mu l and 10 mu l of the reference substance solution under corresponding chromatographic conditions to record a chromatogram and chromatographic parameters, and respectively performing regression analysis on the content (X, mu g) of the standard substance by using a peak area (Y). Through research, the artemisinin in the invention presents a good log-log linear relation in the range of 4-20 mug. The log-log linear regression equation for the artemisinin control was: y1.28 e +000X +4.71e +000, R0.979546.

3. Preparation of sample and determination of artemisinin content

2g of fresh leaves of Artemisia annua are taken from the upper part, the middle part and the lower part of the Artemisia annua plant and are baked to constant weight in an oven at the temperature of 45 ℃. Then knocking off leaves and buds from the dried branches, and grinding into powder. Weighing about 0.1g of dry powder into a 2mL Eppendorf tube, adding 2mL of methanol (1mL of methanol is used for 2 times), treating for 30min by using 40W ultrasonic waves, centrifuging for 10min at 5000rpm, taking supernate, and filtering by using a 0.22 mu m filter membrane to obtain an artemisinin methanol solution for HPLC-ELSD determination.

And (3) measuring the content of artemisinin by adopting HPLC-ELSD, wherein the sample injection volume is 20 mu l, substituting the peak area into a linear regression equation to calculate the content (mg) of artemisinin in the sample, and dividing by the dry weight (g) of the artemisia apiacea leaves of the sample so as to calculate the content of artemisinin in the artemisia apiacea plants.

In the embodiment, the content of artemisinin in transgenic artemisia apiacea is determined by an HPLC-ELSD method, and a metabolic engineering strategy for transforming an AaMYB108 overexpression vector is adopted, so that the fact that the content of artemisinin in transgenic artemisia apiacea plants can be remarkably improved by overexpression of the AaMYB108 gene is found, and powerful experimental evidence is provided for carrying out transcription regulation research by using the gene and further improving the content of artemisinin in artemisia apiacea.

The sweet wormwood MYB transcription factor AaMYB108 can improve the artemisinin content in plants, the coding sequence of the transcription factor is connected to a plant expression regulation vector, and a plant expression vector containing the coding sequence is constructed; transferring the expression vector into agrobacterium, and transferring the agrobacterium into sweet wormwood; obtaining a regenerated transgenic plant containing the coding sequence by antibiotic screening; the content of artemisinin in transgenic artemisia apiacea obtained by the invention is remarkably regulated, and the result is shown in figure 2, when the content of artemisinin in non-transformed wild artemisia apiacea is 14.9mg/g DW, the content of artemisinin in artemisia apiacea is averagely 23mg/g DW by simultaneously transferring the AaMYB108 overexpression vector, and the content of artemisinin in artemisia apiacea expressed by AaMYB108 antisense interference is averagely 10.5mg/g DW. CK in FIG. 2 represents non-transformed wild type Artemisia annua; 108OE-8, 108OE-14 and 108OE-33 represent leaf sampling at different positions of Artemisia annua which is the AaMYB108 overexpression vector; 108-Anti26, 108-Anti32 and 108-Anti34 indicate that AaMYB108 antisense interferes with the sampling of different partial leaves of Artemisia annua expressing Artemisia annua. The invention provides a transcription factor coding sequence for regulating and controlling the artemisinin content in the sweet wormwood herb, and lays a solid foundation for the large-scale production of the artemisinin by using the coding sequence.

The foregoing detailed description of the preferred embodiments of the invention has been presented. It should be understood that numerous modifications and variations could be devised by those skilled in the art in light of the present teachings without departing from the inventive concepts. Therefore, the technical solutions available to those skilled in the art through logic analysis, reasoning and limited experiments based on the prior art according to the concept of the present invention should be within the scope of protection defined by the claims.

Sequence listing

<110> Shanghai university of transportation

<120> sweet wormwood MYB transcription factor AaMYB108 and application thereof

<130> CN084-20012PICN

<160> 8

<170> PatentIn version 3.5

<210> 1

<211> 981

<212> DNA

<213> Artemisia annua L.

<400> 1

atgaatagca acaacaacaa ttgcatggaa attggtggaa gtgaagatga tgagcagatg 60

aacatgatgg aagatcttag aagaggtcct tggactgtcg aagaagattt tactctcatc 120

aattacatcg ctcatcatgg ggaaggtcgt tggaattcgc tagctcgttg cgccggactc 180

aaaagaacag gaaagagttg ccgattaaga tggttgaatt atttacgacc agatgttcgt 240

cgtgggaata ttacgcttga agaacaactt ttgattcttg aacttcattc tcgttggggc 300

aatcggtggt caaaaattgc acaacacttg ccaggaagaa ccgataacga gatcaagaat 360

tattggagaa caagggttca aaaacatgca aaacaattga aatgtgacgt gaatagcaag 420

caatttaagg acacgatgcg ttatctttgg atgccaagac tagtcgaaag aattcaagca 480

gctgcaacaa caacgaccgt aaccgaaggt tcatcttctt ccaccacaac aacctcaacc 540

gcaacgaaca caaacttcta taacccgcta aaccaaacaa acaatatgga taatattgtt 600

actagccaat ttataacgcc tcaacaaagc cataacatgt cttcaaacta tggaaatacc 660

catgttaacc ctagttacac cacggataat tcaagcaata ccgcggtatc gcctgtttct 720

gacatgactg attgttatta tcccacaaac caaaacccta gtcaagattt atatcaaagc 780

agtaatccga ttactaccgg gttttcagac actatgatta gcccgacggg gtactttaat 840

caagggatgg acttccaagc tatggttgat caccaaaaca gccaatggtc cgaaggcgaa 900

aatggtggtg gtgatgcttt ctcagacaat ttgtggaacg tggaggacgt ttggtttctc 960

aaacaacaat tcgacatgtg a 981

<210> 2

<211> 326

<212> PRT

<213> Artemisia annua L.

<400> 2

Met Asn Ser Asn Asn Asn Asn Cys Met Glu Ile Gly Gly Ser Glu Asp

1 5 10 15

Asp Glu Gln Met Asn Met Met Glu Asp Leu Arg Arg Gly Pro Trp Thr

20 25 30

Val Glu Glu Asp Phe Thr Leu Ile Asn Tyr Ile Ala His His Gly Glu

35 40 45

Gly Arg Trp Asn Ser Leu Ala Arg Cys Ala Gly Leu Lys Arg Thr Gly

50 55 60

Lys Ser Cys Arg Leu Arg Trp Leu Asn Tyr Leu Arg Pro Asp Val Arg

65 70 75 80

Arg Gly Asn Ile Thr Leu Glu Glu Gln Leu Leu Ile Leu Glu Leu His

85 90 95

Ser Arg Trp Gly Asn Arg Trp Ser Lys Ile Ala Gln His Leu Pro Gly

100 105 110

Arg Thr Asp Asn Glu Ile Lys Asn Tyr Trp Arg Thr Arg Val Gln Lys

115 120 125

His Ala Lys Gln Leu Lys Cys Asp Val Asn Ser Lys Gln Phe Lys Asp

130 135 140

Thr Met Arg Tyr Leu Trp Met Pro Arg Leu Val Glu Arg Ile Gln Ala

145 150 155 160

Ala Ala Thr Thr Thr Thr Val Thr Glu Gly Ser Ser Ser Ser Thr Thr

165 170 175

Thr Thr Ser Thr Ala Thr Asn Thr Asn Phe Tyr Asn Pro Leu Asn Gln

180 185 190

Thr Asn Asn Met Asp Asn Ile Val Thr Ser Gln Phe Ile Thr Pro Gln

195 200 205

Gln Ser His Asn Met Ser Ser Asn Tyr Gly Asn Thr His Val Asn Pro

210 215 220

Ser Tyr Thr Thr Asp Asn Ser Ser Asn Thr Ala Val Ser Pro Val Ser

225 230 235 240

Asp Met Thr Asp Cys Tyr Tyr Pro Thr Asn Gln Asn Pro Ser Gln Asp

245 250 255

Leu Tyr Gln Ser Ser Asn Pro Ile Thr Thr Gly Phe Ser Asp Thr Met

260 265 270

Ile Ser Pro Thr Gly Tyr Phe Asn Gln Gly Met Asp Phe Gln Ala Met

275 280 285

Val Asp His Gln Asn Ser Gln Trp Ser Glu Gly Glu Asn Gly Gly Gly

290 295 300

Asp Ala Phe Ser Asp Asn Leu Trp Asn Val Glu Asp Val Trp Phe Leu

305 310 315 320

Lys Gln Gln Phe Asp Met

325

<210> 3

<211> 39

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

tctctctcta agcttggatc catgaatagc aacaacaac 39

<210> 4

<211> 38

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

gcccttgctc accatactag tcatgtcgaa ttgttgtt 38

<210> 5

<211> 26

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

gctctagaat gaatagcaac aacaac 26

<210> 6

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 6

cgggatcctc acatgtcgaa 20

<210> 7

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 7

aaatgggtca atttcgggtt 20

<210> 8

<211> 22

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 8

cattgctttt agtatactct tc 22

Claims (10)

1. A sweet wormwood MYB transcription factor AaMYB108 is characterized in that the nucleotide sequence of the transcription factor AaMYB108 is shown in SEQ ID NO. 1; the amino acid sequence of the transcription factor AaMYB108 is shown in SEQ ID NO. 2.

2. A sweet wormwood MYB transcription factor AaMYB108 is characterized in that the amino acid sequence of the transcription factor AaMYB108 is shown in SEQ ID NO. 2.

3. A recombinant expression vector comprising the nucleotide sequence of the sweet wormwood MYB-like transcription factor AaMYB108 according to claim 1.

4. A recombinant expression vector encoding the amino acid sequence of the sweet wormwood MYB transcription factor AaMYB108 of claim 2.

5. The use of the sweet wormwood MYB transcription factor AaMYB108 in the regulation and control of artemisinin biosynthesis as claimed in claim 1, wherein the transcription factor AaMYB108 can activate the promoter activity of a key rate-limiting enzyme gene CYP71AV1 in the artemisinin downstream synthesis pathway.

6. The use as claimed in claim 5 wherein overexpression of the AaMYB108 gene increases artemisinin content in transgenic plants and antisense-interference expression of the AaMYB108 gene decreases artemisinin content.

7. The use according to claim 6, comprising the steps of:

firstly, connecting a nucleotide sequence of a sweet wormwood MYB transcription factor AaMYB108 to a plant expression regulatory sequence, constructing an over-expression vector pHB-AaMYB108-YFP containing an AaMYB108 nucleotide sequence and an Antisense interference expression vector pHB-AaMYB108-Antisense, and transferring the over-expression vector pHB-AaMYB108-Antisense into an agrobacterium strain GV 3101;

step two, constructing a plant double-fluorescein detection report vector pGreenII0800-ProCYP71AV1 by using a promoter ProCYP71AV1 vector of an artemisinin biosynthesis key enzyme gene CYP71AV1 in sweet wormwood herb;

step three, respectively transferring the pHB-AaMYB108-YFP plant expression vector and the plant double-fluorescein detection report vector pGreenII0800-ProCYP71AV1 into an agrobacterium strain GV3101 with pSoup19 auxiliary plasmids to obtain an agrobacterium engineering strain containing a target vector;

step four, respectively mixing the agrobacterium engineering strain containing the pHB-AaMYB108-YFP plant expression vector and the agrobacterium engineering strain containing the pGreenII0800-ProCYP71AV1 plant double-fluorescein detection report vector according to a ratio of 1:1, injecting the mixture into tobacco leaves growing for 4-5 weeks in an injection infection mode, culturing the mixture in the dark for one day, and culturing the mixture in the light for one day;

taking a sample of the tobacco leaf injection part by using a puncher, quickly freezing by using liquid nitrogen, and grinding into powder;

sixthly, detecting the fluorescence intensity by adopting a Promega-Dual-Luciferase detection kit and a GloMax 20/20Luminometer fluorescence detector, and determining the activation effect of the transcription factor AaMYB108 on the promoter of the artemisinin synthesis key enzyme gene CYP71AV 1;

seventhly, transferring the over-expression vector pHB-AaMYB108-YFP and the Antisense interference expression vector pHB-AaMYB108-Antisense into an agrobacterium strain EHA105, and respectively obtaining an agrobacterium tumefaciens strain EHA105 containing the over-expression vector pHB-AaMYB108-YFP and the Antisense interference expression vector pHB-AaMYB108-Antisense for sweet wormwood herb transformation;

step eight, transferring the two kinds of agrobacterium tumefaciens in the step seven into the sweet wormwood, screening by using antibiotic hygromycin to obtain resistant seedlings, extracting plant DNA, and carrying out positive detection by using PCR to obtain transgenic sweet wormwood plants; through artemisinin content detection, the artemisinin content in the transgenic plant over expressing the AaMYB108 is obviously improved, the artemisinin content in the transgenic plant expressing the AaMYB108 through antisense interference is obviously reduced, and the positive regulation and control effect of the AaMYB108 on the artemisinin content is confirmed.

8. The application as claimed in claim 7, wherein the specific method carried out in the first, third and seventh steps is as follows: transferring by a freeze thawing method; in the eighth step, the specific method for performing positive detection by PCR comprises: designing a sequencing primer according to a nucleotide sequence of a transcription factor AaMYB108, carrying out DNA amplification, and observing a positive strain of a target strip under ultraviolet rays after electrophoresis of a PCR product to obtain a transgenic artemisia apiacea plant; the artemisinin content was determined by HPLC-ELSD method.

9. The application of increasing the artemisinin content in artemisia apiacea by utilizing excessive AaMYB108 expression is characterized by comprising the following steps of:

analyzing a sweet wormwood transcription group database MYB transcription factor, and cloning a sweet wormwood MYB transcription factor AaMYB108 as defined in claim 1;

step two, operably linking AaMYB108 to a plant over-expression vector to form an over-expression vector;

step three, transferring the over-expression vector in the step two into agrobacterium to obtain an agrobacterium tumefaciens strain containing the over-expression vector;

step four, transferring the agrobacterium tumefaciens strain containing the over-expression vector in the step three into sweet wormwood, obtaining resistant seedlings through resistance screening, and obtaining transgenic sweet wormwood plants through PCR positive detection;

and step five, extracting artemisinin from the transgenic artemisia apiacea plant obtained in the step four, and determining the content of artemisinin by adopting an HPLC-ELSD method to obtain the transgenic artemisia apiacea plant with the significantly improved content of artemisinin.

10. The use of claim 9, wherein the specific steps are as follows:

analyzing a sweet wormwood transcription group database MYB transcription factor, and cloning a sweet wormwood MYB transcription factor AaMYB108 as defined in claim 1;

step two, operably connecting AaMYB108 to a plant over-expression vector to form an over-expression vector pHB-AaMYB 108-YFP;

step three, transferring the overexpression vector pHB-AaMYB108-YFP in the step two into an agrobacterium EHA105 strain to obtain an agrobacterium tumefaciens strain EHA105 containing the overexpression vector;

step four, transferring the agrobacterium tumefaciens in the step three into sweet wormwood, screening by hygromycin to obtain resistant seedlings, and carrying out positive detection by PCR to obtain transgenic sweet wormwood plants;

and step five, extracting artemisinin from the transgenic artemisia apiacea plant obtained in the step four, and determining the content of artemisinin by adopting an HPLC-ELSD method to obtain the transgenic artemisia apiacea plant with the significantly improved content of artemisinin.

Images