CN113699170A

CN113699170A - Application of VdIV 6 gene in growth and development, pathogenicity and branched chain amino acid synthesis of verticillium dahliae

Info

Publication number: CN113699170A
Application number: CN202111055503.5A
Authority: CN
Inventors: 黄家风; 邵胜楠; 都业娟
Original assignee: Shihezi University
Current assignee: Shihezi University
Priority date: 2021-09-09
Filing date: 2021-09-09
Publication date: 2021-11-26

Abstract

The invention provides an application of acetolactate synthase (AHAS) regulatory subunit gene VdIV 6 in growth and development, pathogenicity and branched chain amino acid synthesis of verticillium dahliae, belonging to the technical field of functional gene detection. According to the invention, a knockout mutant delta VdIV 6 and a complementary mutant are taken as experimental objects, and the effect of VdIV 6 is analyzed from the aspects of growth and development, pathogenicity and branched chain amino acid synthesis respectively. The result shows that the growth speed of the delta VdIV 6 colony is reduced, and more aerial hyphae are produced; no formation of microsclerotia; the spore yield is obviously reduced; the pathogenicity is obviously reduced; VdILV6 is an essential gene for the synthesis of branched-chain amino acids Val and Ile, and Leu has a feedback inhibitory effect on branched-chain amino acid synthesis. In addition, because AHAS is the action target of herbicide, VdIV 6 can be applied to the prevention and treatment of cotton verticillium wilt. The invention has important value for preventing and controlling verticillium dahliae.

Description

Application of VdIV 6 gene in growth and development, pathogenicity and branched chain amino acid synthesis of verticillium dahliae

Technical Field

The invention belongs to the technical field of functional gene detection, and particularly relates to an application of a VdIV 6 gene in growth and development, pathogenicity and branched chain amino acid synthesis of Verticillium dahliae.

Background

Verticillium dahliae (Verticillium dahliae), belonging to the fungi of the genus Verticillium of the subdivision Deuteromycotina. The verticillium dahliae has a wide host range, and can be used for killing 660 plants of 38 families, wherein 184 crops and 153 weeds are planted in foreign reports. According to the identification of China, at least 20 host plants are 80, field crops comprise sunflower, eggplant, peppers, tomato, tobacco, potato, melon, watermelon, cucumber, peanut, kidney bean, mung bean, soybean, sesame, beet and the like, and common gramineous crops such as rice, wheat, corn, millet, sorghum and the like are not damaged. Verticillium dahliae is the main pathogen causing cotton verticillium wilt, and the generation of pathogenic toxins and duct blockage are the main pathogenic mechanisms of pathogenesis. Verticillin (VD-toxin) produced by verticillium dahliae is the main cause of withering. The reason for the blockage of the catheter is that hyphae and conidia are propagated in large quantities. Secondly, after the germs invade the host, the adjacent parenchyma spores are stimulated to generate gel, gum and invade. And thirdly, after the invasion of pathogenic bacteria, pectinase is generated, and colloidal substances and pectic substances in the walls of the fine spores and the fine spores are decomposed, so that tissues are disintegrated, and the catheter is blocked.

The micro sclerotium plays an important role in the infection cycle, and when the verticillium dahliae infects plants, a large amount of micro sclerotium is generated in vascular bundles and released into soil along with the gradual decomposition of plant residues, so that the micro sclerotium becomes an initial infection source in the next year. The microbe core has strong resistance to adverse environment, and can survive for 8-10 years in the sick residues and soil. The conventional control method is difficult to effectively control the cotton seed so that the control of the cotton seed is mainly developed through a molecular mechanism of microsclerotia formation and fungal virulence.

Acetolactate synthase (AHAS or ALS for short, EC 2.2.1.6) is the first key enzyme in the biosynthesis pathway of 3 branched-chain amino acids of valine, leucine and isoleucine catalyzed by plants and microorganisms. Due to the lack of this enzyme in mammals, inhibitors targeted for development with this enzyme, such as sulfonylurea, imidazolinone, pyrimidyloxybenzoic acid, and triazolopyrimidine sulfonamide herbicides, are biologically safe for mammals, and thus studies on AHAS have been more focused on their biochemical structure.

AHAS is composed of Catalytic Subunit (CSU) and Regulatory Subunit (RSU), under the condition of lacking RSU, the activity of AHAS enzyme is reduced to below 15% of the activity of holoenzyme, and RSU has activation effect on the catalytic activity of CSU, thus 2 subunits are necessary for realizing AHAS holoenzyme activity. The CSU sequence is conserved in most AHAS, and the RSU sequence is low in conservation among different AHAS, but the RSU has a conserved ACT structural domain containing a branched chain amino acid binding site, and the structural domain is related to functions such as metabolism, signal transduction and solute transport and is an important element for activating the catalytic activity of the CSU by the RSU. The ACT domain of RSU is capable of activating not only homologous catalytic subunits, but also heterologous catalytic subunits from different species (plants, fungi and bacteria). An important feature of AHAS is feedback inhibition, i.e. the ability of branched chain amino acid products to negatively regulate holoenzyme activity.

Since the abbreviation for the 3 branched-chain amino acids valine, leucine, isoleucine, respectively, I, L, V, the AHAS-expressing gene in bacteria and fungi is commonly denoted as ILVx, e.g., the fungal AHAS catalytic subunit gene is designated ILV 2; the genes for E.coli expressing AHAS I, AHAS II and AHAS III are denoted as ilvBN, ilvGM and ilvIH, respectively. Researches show that AHAS of pathogenic fungi not only participates in the synthesis of branched chain amino acid, but also is closely related to pathogenicity of pathogenic bacteria. The ILV2 knock-out of the CSU gene of Candida albicans (Candida albicans) resulted in a reduced survival rate and a marked reduction in pathogenicity of pathogenic bacteria (Kingsbury, 2010); knockout of the CSU gene FgILV2 of Fusarium graminearum (Fusarium graminearum) resulted in reduction of aerial hyphae and haematochrome, complete loss of pathogenicity of the Δ FgILV2 mutant (Liu et ah, 2015); the rice blast fungus MoIlV2 subcellular localization on mitochondria, MoIlV2 gene knockout caused the rice blast fungus not to produce conidiophores and conidia, the penetration of attached spore is reduced and pathogenicity is reduced significantly (Du et al, 2013). However, the function of the verticillium dahliae acetolactate synthase regulatory subunit gene (VDAG _01958, named VdILV6) is not yet clear.

Disclosure of Invention

In view of the above, the invention aims to provide a new application of verticillium dahliae VdIV 6 gene, and the application of the gene in the growth and development, pathogenicity and branched chain amino acid synthesis of verticillium dahliae is clear, so that the gene has important theoretical value for preventing and controlling diseases caused by verticillium dahliae and developing novel bactericidal drugs, and has important practical significance for promoting the safe production of cotton.

The invention provides application of a VdIV 6 gene in the growth and development of verticillium dahliae.

Preferably, the growth and development comprise growth rate, propagule yield and dormant body yield.

Preferably, the propagules comprise conidia.

Preferably, the dormant body comprises microsclerotia.

The invention provides application of a VdIV 6 gene in pathogenicity of verticillium dahliae.

Preferably, the pathogenicity is expressed in one or more of disease index, vascular bundle browning degree, hypha penetration ability and host colonization ability.

The invention provides application of a VdIV 6 gene in the synthesis of a branched chain amino acid of verticillium dahliae.

Preferably, the branched-chain amino acid comprises one or more of the following amino acids: val, Ile and Leu.

Preferably, the VdIV 6 gene is involved in Val and Ile biosynthesis;

the Leu feedback-inhibits the expression of the VdIV 6 gene at a concentration of 5 mM.

The invention provides a medicament for preventing and treating cotton diseases, which comprises a reagent for down-regulating VdIV 6 gene or protein expression.

Preferably, the agent comprises a sulfonylurea herbicide and/or a pyrimidine salicylic acid herbicide.

The VdIV 6 gene provided by the invention is applied to the growth and development, pathogenicity and branched chain amino acid synthesis of verticillium dahliae. The invention firstly obtains a Verticillium dahliae delta VdIV 6 mutant strain and a complementary strain aiming at the mutant strain (a strain with complementary VdIV 6 gene function), and takes the two constructed strains as materials to respectively detect the growth and development related indexes (bacterial colony growth speed, microsclerotia production quantity, conidium production quantity and peduncle production quantity of wheel-shaped branches) and pathogenicity (disease index, vascular bundle browning degree, hypha penetrability and host colonization ability) of the strain and the biosynthesis aspect of branched chain amino acid (amino acid addition experiment and AHAS inhibitor efficacy experiment). The results show that the colony growth rate of the VdIV 6 gene knockout mutant is obviously lower than that of the V592 strain, more aerial hyphae are produced, and the hypha growth morphology of the fungus is changed; the VdIV 6 gene knockout mutant does not form microsclerotia on glass paper, and cannot observe microsclerotia under a microscope, so that the VILV 6 gene knockout can be explained to influence the formation of the verticillium dahliae microsclerotia; spores generated by the delta VdIV 6 mutant at 7d are only 7.2-8.4% of that of the wild-type strain V592; the sporulation of all complementary strains is almost recovered to the level of the wild type strain, meanwhile, the sporulation of the mutant is observed under a microscope, compared with the strain V592, the mutant delta VdIV 6 has the advantages that the mycelium hardly generates sporulation of wheel-shaped branches, and the sporulation of the complementary strains is recovered to the level of the wild type strain; pathogenicity results of cotton show that disease symptoms are reduced most obviously due to knockout mutants delta VdIV 6-1 and delta VdIV 6-2, and disease indexes are 18.2 and 16.4 respectively; the pathogenicity of the complementary strain is obviously restored to the level of the wild strain; the infected plants are observed in a cross-section manner, and the knockout mutants delta VdIV 6-1 and delta VdIV 6-2 hardly cause vascular bundle browning, which is consistent with the result of disease indexes; the VdIV 6 knock-out mutant was unable to penetrate the cellophane at 5d or even 7d after inoculation, indicating that the VILV 6 knock-out results in the loss of the ability of Verticillium dahliae to penetrate the cellophane. VdILV6 gene knock-out can cause verticillium dahliae to accumulate in roots and obviously block colonization in stems. VdIV 6 participates in the biosynthetic pathway of Verticillium dahliae Val and Ile, and 5mM Leu inhibits the expression of VdIV 6 gene; this indicates that VdILV6 gene is an important component in the branched chain amino acid synthesis pathway; in addition, both sulfonylurea herbicides and pyrimidine salicylic acid herbicides inhibited the expression of VdILV6 gene, again demonstrating that VdILV6 is an essential gene for branched chain amino acid synthesis. Because the VdIV 6 gene has important functions in the aspects of colony growth speed, conidium yield and pathogenicity, branched chain amino acid biosynthesis and the like, the control of diseases caused by verticillium dahliae can be realized by reducing the expression of the VdIV 6 gene, and therefore, the VdIV 6 gene can be used as a drug target point to prepare a drug for controlling the diseases caused by the verticillium dahliae.

Drawings

FIG. 1 is a schematic diagram of the domain of the AHAS regulatory subunit VdIV 6 gene;

FIG. 2 is a colony morphology diagram of Verticillium dahliae delta VdIV 6 mutant strain, complementation strain and wild strain V592 constructed by the invention;

FIG. 3 shows the microscopic observation results of the formation of microsclerotia of Verticillium dahliae delta VdIV 6 mutant, complementation strain and wild strain V592 constructed by the present invention;

FIG. 4 shows the result of sporulation measurements of the Verticillium dahliae Delta VdIV 6 mutant, complementary strain and wild strain V592 constructed according to the present invention;

FIG. 5 shows the results of microscopic observation of the produced sporophores of the Verticillium dahliae Delta VdIV 6 mutant strain, complementary strain and wild strain V592 constructed by the present invention;

FIG. 6 shows the pathogenicity of Verticillium dahliae delta VdIV 6 mutant, complementation strain and wild strain V592 constructed by the invention to cotton; wherein A is the result of pathogenic plant morphology and vascular bundle browning degree; b is disease index result;

FIG. 7 shows the results of the determination of the cotton penetration of the hyphae of the Verticillium dahliae Delta VdIV 6 mutant, complementation strain and wild strain V592 constructed by the invention;

FIG. 8 shows the results of determination of colonization of different tissues in cotton by hyphae of Verticillium dahliae Delta VdIV 6 mutant strain, complementation strain and wild strain V592 constructed by the present invention;

FIG. 9A is a schematic diagram showing the inoculation positions of a Verticillium dahliae VdIV 6 knockout mutant, a complementation strain and a wild-type strain on FGA medium;

FIG. 9B is a colony morphology diagram of Verticillium dahliae delta VdIV 6 mutant, complementary strain and wild strain V592 constructed by the present invention on FGA medium supplemented with different kinds of amino acids;

FIG. 10 shows the results of relative expression levels of a mutant strain, a complementary strain and a wild-type strain V592 of Verticillium dahliae.DELTA VdILV6 constructed according to the present invention after treatment with branched amino acids;

FIG. 11 shows the colony morphology results of wild type strain V592 after treatment with an AHAS inhibitor;

FIG. 12 shows the results of relative expression levels of VdIV 6 gene after AHAS inhibitor treatment of V592.

Detailed Description

In the present invention, the growth and development preferably includes growth rate, propagule yield, and resting body yield. The propagules preferably comprise conidia. The dormant body preferably comprises microsclerotia.

In the invention, the nucleotide sequence of the VdIV 6 gene is shown as SEQ ID NO. 1. The genome DNA and cDNA of the Verticillium dahliae wild strain V592 are used as templates to obtain the regulatory subunit gene VdILV6 of the AHAS through clone sequencing. The VdIV 6 gene predicts that the encoded protein contains 693 amino acids. Sequence analysis showed that it contained one ACT domain and one C-terminal AHAS small subunit (see FIG. 1).

In order to determine whether the VdIV 6 gene knockout influences the formation of verticillium dahliae conidia, the invention constructs a VdIV 6 gene knockout Verticillium dahliae mutant strain delta VdIV 6 by taking a wild type strain V592 as a basic strain, and performs gene complementation on the delta VdIV 6 to obtain a complementary strain ECVdIV 6. The construction method of the Verticillium dahliae mutant strain delta VdIV 6 with the VdIV 6 gene knocked out is completed by utilizing the principle of homologous recombination, and concretely, the method can be seen in the prior art to obtain knocked-out and complementary mutants (WANG S, XING H, HUA C, GUO H S, ZHANG J. An. immunological single-step cloning strategy) and the Agrobacterium tumefaciens-mediated transformation (ATMT) -based gene-deletion method for Verticillium dahliae. phytopathology,2016,106(6):645 652.).

In the invention, a series of experiments are carried out by taking wild strains V592, delta VdILV6 and ECVdILV6 as experimental objects, and the results show that the VdIV 6 gene knockout reduces the growth speed of verticillium dahliae colonies, promotes the mass production of aerial hyphae of the verticillium dahliae, and changes the growth form of the hyphae of fungi. The VdILV6 gene knockout ensures that verticillium dahliae does not form microsclerotia on glass paper, the microsclerotia is a primary infection source in the growth and infection cycle of the verticillium dahliae, the stress resistance in soil is strong, and the cotton verticillium wilt is difficult to prevent and treat due to long survival time in the soil. After the gene VdIV 6 is knocked out, no microsclerotia is formed, and a HIGS technology can be adopted to silence the gene VILV 6, so that a new idea is provided for prevention and treatment of cotton verticillium wilt.

The VdIV 6 gene knockout reduces the conidium amount of verticillium dahliae, which shows that the VILV 6 gene knockout is beneficial to reducing the propagation capacity and reproductive capacity of verticillium dahliae, reducing the host infected by verticillium dahliae and reducing the probability of occurrence and development of diseases.

In the invention, the pathogenicity is preferably expressed in one or more of the following indexes of disease index, micro-tube bundle browning degree, hypha penetrating capability and host colonization capability.

In the invention, wild strains V592, delta VdIV 6 and ECVdIV 6 are used as experimental objects for pathogenicity determination, and the results show that the VdIV 6 gene knockout can most obviously relieve disease symptoms caused by verticillium dahliae, and the disease indexes are respectively 16.4-18.2; the pathogenicity of the complementary strain is obviously restored to the level of the wild strain, and the disease index is higher than 90. When the strain is inoculated for 30 days, the infected plants are subjected to stalk-cutting observation, and the knockout mutants delta VdIV 6-1 and delta VdIV 6-2 hardly cause vascular bundle browning, which is consistent with the result of disease index. The VdIV 6 gene knockout results in the loss of the ability of Verticillium dahliae to penetrate on cellophane. Meanwhile, the results of fungal biomass measurement experiments show that the VdIV 6 gene knockout leads verticillium dahliae to be obviously blocked from colonizing in the roots and stems of cotton, which obviously reduces the capability of colonizing in cotton tissues. From the above results, it was found that VdIV 6 gene is involved in the pathogenicity of Verticillium dahliae.

In the present invention, the branched-chain amino acid preferably includes one or more of the following amino acids: val, Ile and Leu. Experiments prove that the VdIV 6 gene knockout leads to the difficult growth of Verticillium dahliae on the culture lacking branched-chain amino acids, and after additional branched-chain amino acids are added, the growth defect of the VdIV 6 gene knockout mutant is relieved, Val and Ile can supplement amino acids required by the growth of the VILIV 6 gene knockout mutant, which shows that VILIV 6 participates in the biosynthesis pathway of Val and Ile, and high-concentration Leu can feedback inhibit the growth of the wild type strain V592 and the complementary strain. And Leu inhibits the expression of VdIV 6 gene, which shows that VdIV 6 gene is related to the biosynthesis pathway of Leu. The experiments show that the VdIV 6 gene is involved in the biosynthesis of branched-chain amino acids and is an important component of the biosynthesis of branched-chain amino acids.

Because the VdIV 6 gene is directly related to the growth and pathogenicity of verticillium dahliae and the VdIV 6 gene is knocked out to be beneficial to reducing the pathogenicity and growth performance of verticillium dahliae, the invention provides a medicament for preventing and treating cotton diseases, which comprises a reagent for down-regulating the VdIV 6 gene or protein expression.

In the present invention, the agent preferably includes a sulfonylurea herbicide and/or a pyrimidine salicylic acid herbicide. The present invention is not particularly limited in kind of the sulfonylurea herbicide, and a sulfonylurea herbicide well known in the art, for example, tribenuron-methyl, may be used. The present invention is not particularly limited in kind of the pyrimidine salicylic acid herbicides, and the kinds of the pyrimidine salicylic acid herbicides known in the art, such as bispyribac-sodium, can be used. The sulfonylurea herbicide preferably includes tribenuron-methyl. The concentration of the sulfonylurea herbicide is preferably not less than 400mg/L, and more preferably 409.6-1638.4 mg/L. The pyrimidine salicylate herbicides preferably comprise bispyribac-sodium. The concentration of the pyrimidine salicylic acid herbicide is preferably not less than 400mg/L, and more preferably 409.6-1638.4 mg/L. Experiments prove that the tribenuron-methyl and the bispyribac-sodium obviously inhibit the growth of the verticillium dahliae and cause the verticillium dahliae not to generate microsclerotia, thereby showing that the verticillium dahliae can effectively prevent and treat diseases caused by the verticillium dahliae. The expression of VdIV 6 gene can be inhibited by detecting treated wild strain V592, tribenuron-methyl and bispyribac-sodium, and the VdIV 6 is proved to be an essential gene for branched chain amino acid synthesis.

The preparation method of the medicine is not particularly limited, and the preparation method of the bactericide which is well known in the field can be adopted. The method of using the drug is not particularly limited in the present invention, and a method of using a drug known in the art may be used. The medicament achieves the purpose of preventing and controlling the occurrence and development of diseases by reducing the pathogenicity of the VdIV 6 gene.

Because the sulfonylurea herbicide and/or the pyrimidine salicylic acid herbicide directly down-regulate the VdIV 6 gene and the VdIV 6 gene down-regulate the growth performance, the pathogenicity and the nutrition synthesis capacity of the verticillium dahliae, the VdIV 6 gene of the verticillium dahliae is used as a medicine target point to prevent and control cotton diseases.

The following examples are provided to illustrate the use of VdIV 6 gene in Verticillium dahliae growth and development, pathogenicity, and branched chain amino acid synthesis, but they should not be construed as limiting the scope of the invention.

Example 1

Construction method of Verticillium dahliae mutant strain delta VdIV 6 with VdIV 6 gene knocked out

Primers are designed according to upstream and downstream homology arms of VdIV 6 gene (nucleotide sequence is shown as SEQ ID NO: 1), a knockout vector is constructed, and a wild strain V592 is used as an initial strain to construct a mutant strain. See in particular the prior art (WANG S, XING H, HUA C, GUO H S, ZHANG J. an amplified single-step cloning strategies) the bacteria tissue-mediated transformation (ATMT) -based gene-deletion method for Verticillium dahliae. phytopathology,2016,106(6): 645: 652.) to obtain Verticillium dahliae strains (delta VdILV6-1, delta VdILV6-2) with VdILV6 gene knocked out.

Example 2

Construction method of verticillium dahliae VdILV6 gene complementary mutant ECVdILV6

The Verticillium dahliae mutant strain DeltaVdIV 6 constructed in example 1 was used as an initial strain, and the complementary mutants of the Verticillium dahliae VdIV 6 gene (ECVdILV6-1 and DeltaVdILV 6-2) were obtained by referring to the prior art (WANG S, XING H, HUA C, GUO H S, ZHANG J. an improved single-step cloning site) and the Agrobacterium tumefaciens-mediated transformation (ATMT) -based gene-deletion method for Verticillium dahliae. phytopathology,2016,106(6): 652.).

Example 3

1. Determination of colony growth Rate

A Verticillium dahliae mutant strain in which VdIV 6 gene had been knocked out, which was prepared in example 1, a VdIV 6 gene complementation mutant, which was prepared in example 2, and a wild type strain V592 were cultured, and the respective mycelia were inoculated into the center of a PDA medium and cultured in the dark at 22 ℃. On the 5 th and 9 th days after inoculation, the colony diameters of all the strains were measured, and the average growth rate of the colonies was calculated according to formula I.

The average growth rate of the colonies (the growth rate of the colonies (average colony growth diameter of 9 d-average colony growth diameter of 5 d)/4) is formula I.

Each strain was set to 3 replicates and colony morphology was recorded by photographing on day 15.

2. Morphological Observation of hyphae

Different strains of Verticillium dahliae are streaked and cultured on a PDA (personal digital assistant) plate, then a sterilized cover glass is obliquely inserted to the streaked part, dark culture is carried out for 3d at 22 ℃, and the cover glass is taken out to observe the growth condition of hyphae under a microscope.

The results are shown in FIG. 2. The colony growth rate of the VdIV 6 gene knockout mutant is significantly lower than that of the V592 strain, and more aerial hyphae are produced, and the hyphae morphology of the verticillium dahliae is changed.

Example 4

Determination of the amount of microsclerotia

Bacterial diseases were obtained by culturing the Verticillium dahliae mutant strain with VdIV 6 gene knockout prepared in example 1, the VdIV 6 gene complementation mutant prepared in example 2, and the wild strain V592 as the subjects. Respectively beating about 10 bacterial cakes of each strain by using a puncher, inoculating the bacterial cakes into a Chachi (containing kan) liquid culture medium, and shaking the bacterial cakes for 3-5 days in a shaking table at 26 ℃ at 200 r/min; filtering and collecting conidia; modified sporeConcentration the conidium concentration was adjusted to 1.0X 10⁶CFU/mL, draw 100. mu.L of MM plate (NaNO) coated evenly on the flat glass paper₃ 2g、KH₂PO₄ 1g、MgSO₄·7H₂0.5g of O, 0.5g of KCl, 10mg of citric acid and ZnSO₄·7H₂O 10mg、FeSO₄·7H₂O 10mg，NH₄Fe(SO₄)₂)·12H₂O 2.6mg，CuSO₄·7H₂O 0.5mg，NnSO₄·H₂O 0.1mg，H₃BO₃ 0.1mg，Na₂MoO₄·2H₂O0.1 mg, glucose 2g, 1.5 agar, and distilled water to 1L. 113 ℃, autoclaving for 20min), culturing for 15d in dark at 22 ℃, photographing and observing, scraping the culture on glass paper, weighing and measuring, recording the wet weight, placing the microsclerotia at room temperature for 48h for airing, weighing on a balance, and recording the dry weight data.

The results show that the VdILV6 knock-out mutant did not form microsclerotia on cellophane, no microsclerotia were observed under the microscope, and both the V592 strain and the complementary strain formed microsclerotia aggregates under the microscope (fig. 3). Since the microsclerotia is the initial infection source in the growth and infection cycle of the verticillium dahliae, the VdILV6 gene can reduce the infection performance of the verticillium dahliae, so that the pathogenicity of the verticillium dahliae is reduced.

Example 5

In order to determine whether the VdIV 6 gene knockout affects the formation of Verticillium dahliae conidia, the specific determination method is as follows:

the concentration is 1.0X 10⁶The CFU/mL knockout mutant (strain constructed in example 1), the complementation strain (strain constructed in example 2) and V592 were inoculated into Czapek-Dox liquid medium, and were shaken at 26 ℃ and 200r/min for 5 days to isolate spores. Will suck 1.0X 10⁶CFU/mL spore suspension 100. mu.L was inoculated in Chasch (kan containing) medium. 3 biological repeated experiments are set for each strain, shaking culture is carried out in a shaker at the temperature of 26 ℃ at the speed of 200r/min, 1mL of bacterial liquid is sucked every 24h, the spore concentration is measured by a blood counting plate for 7 days continuously, and data are recorded.

The results show that the Δ VdILV6 mutant produced spores that were only 7.2% and 8.4% of wild-type strain V592 at 7d when inoculated; the sporulation of all the complementing strains was almost restored to the level of the wild type strain (FIG. 4). The resulting stalks of the mutant were observed under a microscope, and compared with the V592 strain, the Δ VdILV6 mutant produced almost no branched rota-peduncle in the mycelia, and the stalks of the complementary strain were restored to the level of the wild-type strain (FIG. 5).

Example 6

In order to clarify the influence of the VdIV 6 gene knock-out on the pathogenicity of Verticillium dahliae, the pathogenicity of the VdIV 6 gene knock-out mutant on cotton was determined by using a wild strain V592 and a complementary strain as controls. The pathogenicity assay was as follows:

the knockout mutant, the complementation strain and V592 constructed as above are inoculated into Czapek-Dox liquid medium and cultured for 5d at 26 ℃ and 200 r/min. After the 5 th main leaf of the cotton seedling grows out, 200mL of cotton with the concentration of 1.0X 10 is inoculated in each pot by using a root soaking inoculation method⁷CFU/mL of bacterial solution, 3 hydroponic boxes (36 cotton seedlings in total) were repeated for each strain. The disease classification standard is that the disease is observed every day after inoculation, the disease is counted from the beginning of the disease, the disease is generally recorded every 3d until one month after the disease, and the disease classification standard is as follows: level 0: the disease is not developed; level 1: 1-2 leaves of the plant are attacked; and 2, stage: 1 true leaf onset; and 3, level: 2 true leaves are attacked; 4, level: 3 or more than 3 true leaves. Disease index was calculated according to formula II.

Disease index [ [ sigma ] disease plant number of each stage × stage/(total plant number × highest disease stage) ] × 100 formula II

Disease index is the average of 3 biological experiments.

On day 30, the straw was cut and vascular bundles were photographed using a stereomicroscope (Olympus SZX7, Japan).

The results show that disease symptoms are reduced most obviously due to the knockout mutants delta VdIV 6-1 and delta VdIV 6-2, and disease indexes are 18.2 and 16.4 respectively; the pathogenicity of the complementary strain is obviously restored to the level of the wild strain, and the disease index is higher than 90. At 30d of inoculation, the infected plants were observed to be dissected, and the knockout mutants Δ VdIV 6-1 and Δ VdIV 6-2 hardly caused the vascular bundle browning, which is consistent with the minimal disease index (18.2 and 16.4) (FIG. 6)

Example 7

In order to analyze whether the reduced pathogenicity of verticillium dahliae caused by the VdIV 6 gene knockout is related to the host penetration capacity of the verticillium dahliae, a cellophane penetration experiment is carried out on each knockout mutant strain by taking V592 as a control, and the specific method is as follows:

and (4) paving the glassine paper which is subjected to high-temperature sterilization treatment and has the size basically consistent with that of the culture dish on the poured MM minimal medium. Picking out hyphae with toothpick, inoculating to the center of cellophane, culturing for 3d, 4d and 5d respectively, removing cellophane, allowing the strain to grow for 7d, and determining whether bacterial colony can grow on the culture dish, wherein each strain has 3 repeats.

The VdILV6 knock-out mutant was unable to penetrate the cellophane at 5d or even 7d of inoculation (fig. 7). The results show that the VdIV 6 gene knockout results in the loss of the ability of Verticillium dahliae to penetrate on cellophane.

Example 8

Whether the VdIV 6 gene knockout affects the colonization of Verticillium dahliae in a host body is analyzed, and the biomass of the VdIV 6 gene knockout mutant in cotton is determined by qPCR. And (3) inoculating different strains, and collecting the root (root 5cm below red stem line), stem (stem 5cm at half height of cotton seedling), and leaf of cotton, and respectively extracting total DNA of root, stem, and leaf. The primers used for qPCR [ transcribed spacer (ITS) -F (5'-tgttgcttcggcggc tcgtt-3', SEQ ID NO:6) and ITS-R (5'-gcgtttcgctgcgttcttca-3', SEQ ID NO:7) ] were designed based on the ITS1 and ITS2 regions of Verticillium dahliae ribosomal RNA (Z29511). The total DNA of each sample was quantitated by normalization using a constitutively expressed beta-tubulin gene (DQ266153) as an internal reference gene (internal reference gene: beta-tubulin-F: tcaccagccgtggcaaggttg, SEQ ID NO: 8; beta-tubulin-R: agcaaagggcggtctggacgttg, SEQ ID NO: 9). Each reaction was set to 3 replicates.

RT-qPCR is adopted to detect the expression condition of VdIV 6 in different tissues of the colonized cotton, a kit method is adopted to extract RNA of the different tissues of the cotton, cDNA obtained by reverse transcription is taken as a template to carry out RT-qPCR detection, and the designed primer sequences are as follows:

VdILV6-qPCR-F：ATGGCGTCTCGCTGCCTC(SEQ ID NO:2)；

VdILV6-qPCR-R：TTGTAGGCGAGAGCCGAGGT(SEQ ID NO:3)；

β-tubulin-F：TCACCAGCCGTGGCAAGGTTG(SEQ ID NO:4)；

β-tubulin-R：AGCAAAGGGCGGTCTGGACGTTG(SEQ ID NO:5)。

verticillium dahliae beta-tubulin (DQ266153) is an internal reference gene.

Reaction system (10 μ L):

PowerUp^TM SYBR^TM Green Master Mix(2×)5μL

forward primer 0.2. mu.L

Reverse primer 0.2. mu.L

DNA template 4.6. mu.L.

The reaction procedure for RT-qPCR detection was as follows: 2min at 50 ℃; 2min at 95 ℃; 953 s, 30s at 60 ℃ for 40 cycles. The resulting data were analyzed using 7500 Fast Real-Time PCR System at 2^-ΔΔCtIs calculated by the method of (1). The results show that the Δ VdILV6 mutant had significantly higher biomass in roots than the V592 strain and 2 complement strains, and significantly lower biomass in stem tissues than the V592 strain and the complement strains (fig. 8). This indicates that VdIV 6 gene knock-out causes Verticillium dahliae to accumulate in roots and obviously block colonization in stems. The results are consistent with the disease index and the degree of vascular bundle browning caused by the Δ VdILV6 mutant on cotton seedlings.

Example 9

Wild strain V592 and a complementary strain were used as controls, and VdIV 6 gene was knocked out and inoculated into FGA medium (FGA medium: fructose 10.0g/L, gelatin 2.0g/L, K)₂HPO₄ 1.0g/L，MgSO₄·7H₂O 0.5g/L，NaNO₃2g/L, pH adjusted to 7.0, autoclaved at 115 ℃ for 30min), the inoculation sites are shown in FIG. 9A.

Δ VdILV6 was barely able to grow when cultured on FGA medium for 9 days. To further determine whether the growth defect of Δ VdILV6 on FGA was caused by the absence of one or several amino acids, different concentrations of single or multiple branched chain amino acids were added to FGA medium for the wild type strain V592 and the knockout mutant and the complement, respectively.

Exogenously added amino acid 1mM of a single amino acid had no effect on Δ VdIV 6, when 5mM Val and 5mM MIle were supplemented to FGA, the growth defect of Δ VdIV 6 was mitigated, Val and Ile were able to supplement the amino acids required for growth of Δ VdIV 6, promoting growth of Δ VdIV 6 with maximal colony diameter (FIG. 9B), VdIV 6 was involved in the biosynthetic pathway of Val and Ile.

V592 was treated with tribenuron-methyl and bispyribac-sodium at 3 concentrations (409.6mg/L, 819.2mg/L and 1638.4mg/L), respectively, and the relative expression level of VdIV 6 gene was determined as described in example 8.

5mM Leu inhibited the expression of VdIV 6 gene (FIG. 10). VdIV 6 is involved in the branched-chain amino acid biosynthesis pathway and is an important component of branched-chain amino acid biosynthesis.

Example 10

AHAS inhibitor treatment experiments

2 herbicides of different chemical types are selected, namely tribenuron-methyl (sulfonylurea herbicide) and bispyribac-sodium (pyrimidine salicylic acid herbicide), liquid medicines with the concentration of 409.6mg/L, 819.2mg/L and 1638.4mg/L are respectively prepared and inoculated to the bacterial colony of a wild type strain V592, and the influence of the liquid medicines on the growth of the strain is observed.

AHAS is a target for herbicide action, selecting 2 different chemical classes of herbicides: tribenuron-methyl (sulfonylurea herbicide) and bispyribac-sodium (pyrimidine salicylic acid herbicide) are inoculated to a wild type strain V592, and the colony morphology is observed to find that the tribenuron-methyl and the bispyribac-sodium obviously inhibit the growth of verticillium dahliae under the action of 1638.4mg/L, and the V592 does not generate microsclera (see figure 11).

The RT-qPCR method is adopted to detect the relative expression quantity of the VdIV 6 gene after the Tribenuron-methyl and bispyribac-sodium with 3 concentrations are treated with the V592, and the specific method is the same as the example 5.

Tribenuron methyl and bispyribac-sodium at 3 concentrations were selected for the respective treatment of V592. The RT-qPCR method is adopted to detect the relative expression quantity of the VdIV 6 gene after the Tribenuron-methyl and bispyribac-sodium with 3 concentrations are treated with the V592, and the specific method is the same as the example 5. Results Ct value (Threshold cycle) is defined as the number of cycles required to reach a detection Threshold that exceeds the fluorescence signal, and data for the results is 7500Fast Real-Time PCR System for analysis, at 2^-ΔΔCtIs calculated by the method of (1). The results showed that the relative expression level of VdILV6 gene was down-regulated, and the down-regulation was more pronounced at higher concentrations (fig. 12). These results indicate that tribenuron-methyl and bispyribac-sodium can inhibit the expression of VdIV 6 gene. Again, VdILV6 was shown to be an essential gene for branched chain amino acid synthesis.

The foregoing is only a preferred embodiment of the present invention, and it should be noted that, for those skilled in the art, various modifications and decorations can be made without departing from the principle of the present invention, and these modifications and decorations should also be regarded as the protection scope of the present invention.

Sequence listing

<110> river university

Application of <120> VdIV 6 gene in growth and development, pathogenicity and branched chain amino acid synthesis of verticillium dahliae

<160> 5

<170> SIPOSequenceListing 1.0

<210> 1

<211> 945

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

atggcgtctc gctgcctcgc cgcgcccatg cggctcgctg cccgactgca ggccgccccg 60

actgcgacat cgctcgcctc ccagcgctgg agctcctcca gctcgacctc ggctctcgcc 120

tacaaggcca tccgccgtcg ctcctccccc cttcccgtcg accagacgcc cgcctggtcc 180

gcccaggctg ccgtctccaa catcctctac gagacgccca ccccgtcgat ggccccgccc 240

aagcgtcaca tcctcaactg tctcgtccag aacgagcccg gtgtcctgtc gcgcgtctcc 300

ggcattctcg ccgcccgcgg cttcaacatt gactcgctcg tcgtctgcag caccgaggtc 360

gaggacctgt cgcgcatgac catcgtcctg accggccagg acggcgtcgt cgagcaggcg 420

cgccgccagc tggaagacct cgtccccgtc tgggccgtgc tcgactacac caacgccgct 480

ctcgtccaga gggagctggt gctcgccaag atcaacattc tcggccccga gtactttgag 540

gagctcctcg cccaccaccg cgagatgacg gctggcgact ccgagtacga ggacggccac 600

gacgtctccc tcgagcagac cgccaaggat ttccacccca gcaagctggc gctcagcgag 660

gcccttcgcc acaagcacga gcacctgaag accatcacct acttcactca ccagtttggc 720

ggcaaggttc tcgacatcag caccaacagc tgcattgtcg aggtttccgc gaaacaatcc 780

aggattgact ccttcctcaa gcttgtcggc ccctttggta tcctcgagtc ggcccgcacc 840

ggtctcatgg ccctgccccg ttctcccctg cagaacagcc aagacgacgc tctcatcaag 900

gaggcggacg aggttgtcga tgccagccag ctgccccccg gttaa 945

<210> 2

<211> 18

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

atggcgtctc gctgcctc 18

<210> 3

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

ttgtaggcga gagccgaggt 20

<210> 4

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

tcaccagccg tggcaaggtt g 21

<210> 5

<211> 23

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

agcaaagggc ggtctggacg ttg 23

Claims

The application of VdIV 6 gene in the growth and development of verticillium dahliae.
2. The use of claim 1, wherein the growth development comprises growth rate, propagule and resting body yield.
3. Use according to claim 2, wherein the propagules comprise conidia and the dormant species comprise microsclerotia.
Application of VdIV 6 gene in pathogenicity of verticillium dahliae.
5. The use of claim 4, wherein the virulence is expressed in one or more of disease index, microtubule bundle browning, hyphal penetration and host colonization.
Application of VdIV 6 gene in synthesis of verticillium dahliae branched chain amino acid.
7. The use of claim 6, wherein the branched chain amino acids comprise one or more of the following amino acids: val, Ile and Leu.
8. The use according to claim 7, wherein the VdIV 6 gene is involved in Val and Ile biosynthesis; and 5mM Leu inhibited the expression of VdIV 6 gene.
9. The drug for preventing and treating cotton diseases is characterized by comprising an agent for down-regulating the expression of VdIV 6 gene or protein.
10. The medicament according to claim 9, wherein the agent comprises a sulfonylurea herbicide and/or a pyrimidine salicylic acid herbicide.