CN114854703B - Flavone synthase I/flavanone-3-hydroxylase and application thereof in field of flavonoid compound synthesis - Google Patents

Abstract

The invention relates to a flavone synthase I/flavanone-3-hydroxylase and application thereof in the field of flavonoid compound synthesis. The invention discloses pine She Juehuang ketone synthase I/flavanone-3-hydroxylase, the amino acid sequence of which is shown as SEQ ID No. 1. The invention clones and identifies a bifunctional enzyme which can introduce double bond between C2 and C3 positions of flavone or introduce hydroxyl at C3 position for the first time from pteridophyte. The gene has higher catalytic activity to common flavanone compounds and provides a candidate gene for producing flavonoid compounds. The PnFNS I/F3H can synthesize flavone and flavonol in the escherichia coli body, and can simultaneously improve the content of plant flavone and flavonol compounds in transgenic arabidopsis thaliana. The gene can be used for producing flavone and flavonol compounds in escherichia coli and plant chassis, and has higher application value.

Description

Flavone synthase I/flavanone-3-hydroxylase and application thereof in field of flavonoid compound synthesis

Technical Field

The invention belongs to the technical field of flavone compound catalytic enzymes, and in particular relates to a flavone synthase I/flavanone-3-hydroxylase derived from pteris sonchifolia, a nucleic acid substance for encoding the enzyme, an expression vector containing the nucleic acid substance, a host cell, engineering bacteria for expressing the flavone synthase I/flavanone-3-hydroxylase and application of the engineering bacteria in the field of flavone compound synthesis.

Background

The disclosure of this background section is only intended to increase the understanding of the general background of the invention and is not necessarily to be construed as an admission or any form of suggestion that this information forms the prior art already known to those of ordinary skill in the art.

Flavonoids are an important class of secondary metabolites that are widely found in terrestrial plants. Research shows that the flavonoid compound has various biological activities of antibiosis, antivirus, anticancer, anti-inflammatory, antioxidation and the like, participates in the growth and development of plants in the plants, and has the capability of enhancing the abiotic stress resistance of the plants.

Both flavone synthase I (Flavone synthase I, FNS I) and Flavanone-3-hydroxylase (Flavanone 3. Beta. -hydroxyase, F3H) belong to the 2-ketoglutarate/iron (II) -dependent dioxygenase (2-oxoglutarate/Fe (II) -dependent dioxygenases,2 ODDs), and the involvement of flavone synthase I in the formation of double bonds between the C2 and C3 positions of flavones is a key enzyme for the synthesis of plant flavones. Flavanone-3-hydroxylase catalyzes (2S) -flavanone to generate (2R, 3R) -flavanonol, which determines the synthesis of flavonols and anthocyanidins in plants. In the biosynthetic pathway of flavonoids, flavonoid synthase I and flavanone-3-hydroxylase are key enzymes for the synthesis of flavones and flavonols, respectively. The pteridophyte is rich in flavonoid compounds and has important pharmacological activity, but the flavonoid synthase I and flavanone-3-hydroxylase have not been reported.

The conifer (Psilotum nudum) is the only conifer in China, and belongs to the relatively original group in the pteridophyte. The conifer is rich in flavonoid compounds, and the extract thereof has antibacterial and antifungal activities to a certain extent. However, no research report on key enzymes involved in biosynthesis of flavonoid compounds in the conifer is currently available.

Disclosure of Invention

Based on the technical background, the invention provides a flavone synthase I/flavanone-3-hydroxylase, which is derived from pteris fern, belongs to 2-ketoglutarate/iron (II) -dependent dioxygenase, has iron ion dependence, and can catalyze various flavanone compounds to generate corresponding flavonoid compounds. The flavonoid synthase I/flavanone-3-hydroxylase can introduce double bonds between C2 and C3 positions of flavanone or hydroxy at the C3 position, is a bifunctional enzyme, and plays an important role in-vitro synthesis of flavones and flavonols.

Based on the technical effects, the invention provides the following technical scheme:

in a first aspect of the invention, there is provided a flavone synthase I/flavanone-3-hydroxylase having the amino acid sequence shown in SEQ ID NO. 1.

In a second aspect of the invention there is provided a nucleic acid material encoding a flavonoid synthase I/flavanone-3-hydroxylase according to the first aspect.

The second aspect of the above, the nucleic acid material comprises a nucleic acid material which is translated to provide the flavonoid synthase I/flavanone-3-hydroxylase or derivative polypeptide of the first aspect due to codon degeneracy.

Further, the coding nucleic acid is DNA, including cDNA, genomic DNA or synthetic DNA; the DNA may be single-stranded or double-stranded, and may be a coding strand or a non-coding strand; in a specific embodiment provided by the invention, the encoding nucleic acid sequence of the flavonoid synthase I/flavanone-3-hydroxylase with the amino acid sequence shown as SEQ ID NO.1 is shown as SEQ ID NO. 2.

In a third aspect of the invention there is provided an expression vector comprising a nucleic acid material according to the second aspect.

Preferably, the expression vector is a bacterial plasmid or a yeast plasmid, including pET series vectors.

In a fourth aspect of the invention, there is provided a host cell comprising a nucleic acid material according to the second aspect, an expression vector according to the third aspect.

Preferably, the host cell is a microbial cell, in particular E.coli.

In a fifth aspect of the invention there is provided an engineered bacterium expressing a flavonoid synthase I/flavanone-3-hydroxylase, said engineered bacterium being modified to have expression of said flavonoid synthase I/flavanone-3-hydroxylase of the first aspect as compared to the wild type.

Preferably, the starting strain of the engineering bacteria is selected from escherichia coli or saccharomycetes.

Furthermore, the engineering bacteria are escherichia coli, and the escherichia coli realizes the expression of the flavonoid synthase I/flavanone-3-hydroxylase by transforming recombinant expression plasmids.

In a sixth aspect, the invention provides the use of the flavonoid synthase I/flavanone-3-hydroxylase of the first aspect, the nucleic acid encoding the second aspect, the expression vector of the third aspect, the host cell of the fourth aspect, and the engineering bacterium expressing the flavonoid synthase I/flavanone-3-hydroxylase of the fifth aspect in the field of plant flavonoid synthesis.

The plant flavone of the sixth aspect includes flavone and flavonol, and the application in the field of plant flavone synthesis includes, but is not limited to, any one of the following:

(1) The content of flavonoid compounds in plants is increased so as to obtain plants with good resistance;

(2) Obtaining plants with high flavonoid content as extraction raw materials.

One specific way of using this is by transforming Agrobacterium with the expression vector of the third aspect into Arabidopsis thaliana, thus obtaining a positive transfected plant.

According to a seventh aspect of the invention, a biosynthesis method of flavonoid compounds is provided, wherein the flavonoid compounds are used as substrates, and the flavonoid synthase I/flavanone-3-hydroxylase according to the first aspect or the engineering bacteria according to the fifth aspect are added to synthesize the corresponding flavonoid compounds.

Preferably, the substrate is any one of eriodictyol, homoeriodictyol, hesperetin, pinocembrin, and glycyrrhizin.

Preferably, the in vitro synthesis temperature of the flavonoid synthase I/flavanone-3-hydroxylase is 0-50 ℃; further, the in vitro synthesis temperature is 38-45 ℃.

Preferably, the in vitro synthesis pH of the flavonoid synthase I/flavanone-3-hydroxylase is 5-8.5; further, the in vitro synthesis pH is 7.5-8.5.

Drawings

The accompanying drawings, which are included to provide a further understanding of the invention and are incorporated in and constitute a part of this specification, illustrate embodiments of the invention and together with the description serve to explain the invention.

Fig. 1: electrophoretogram of full-length cDNA amplification product of PnFNS I/F3H gene.

Fig. 2: SDS-PAGE electrophoresis of PnFNS I/F3H protein;

wherein: m protein molecular mass standard

Lane 1: empty vector pET32a protein supernatant;

lane 2: purifying empty vector pET32a protein;

lane 3: pnFNS I/F3H protein supernatant;

lane 4: purifying PnFNS I/F3H protein.

Fig. 3: enzymatic catalytic reaction HPLC profile of PnFNS I/F3H with naringenin as substrate.

Wherein: FIG. 3A is a graph of substrate relative activity; FIGS. 3B and 3C are MS/MS cleavage spectra of related products P1 (B) and P2 (C); dihydrokempferol: dihydrokaempferol; apigenin: apigenin.

Fig. 4: HPLC profile of PnFNS I/F3H substrate selectivity assay.

Fig. 5: the optimum pH and the optimum temperature of the PnFNS I/F3H enzyme activation catalytic reaction.

Fig. 6: HPLC profile of PnFNS I/F3H feeding substrate naringenin in e.coli; dihydrokempferol: dihydrokaempferol; apigenin: apigenin.

Fig. 7: heterologous expression analysis of the PnFNS I/F3H gene in Arabidopsis thaliana;

fig. 7A: RT-PCR analysis of PnFNS I/F3H-tt6 transgenic Arabidopsis thaliana; fig. 7B: RT-PCR analysis of PnFNS I/F3H-dmr6 transgenic Arabidopsis thaliana; pnFNS I/F3H is transcribed in the selected transgenic line; atActin is used as a reference sequence.

Fig. 8: HPLC-MS plot of flavone and flavonol analysis in PnFNS I/F3H-tt6 transgenic Arabidopsis thaliana.

Fig. 9: analyzing the relative content of flavone and flavonol in PnFNS I/F3H-tt6 transgenic Arabidopsis thaliana;

fig. 9A: relative quantification of flavone compounds in WT, tt6 mutant and PnFNS I/F3H-tt6 transgenic Arabidopsis;

fig. 9B: relative quantification of flavonol compounds in WT, tt6 mutant and PnFNS I/F3H-tt6 transgenic Arabidopsis; chrysoeriol: chrysoeriol, apigenin: apigenin, luteolin: luteolin, kaempferol: kaempferol, quercetin: quercetin.

Fig. 10: analyzing the content of flavone and flavonol in the PnFNS I/F3H-dmr6 transgenic Arabidopsis thaliana;

fig. 10A-B: molecular ion peaks of apigenin (A) and quercetin (B) in WT, dmr6 mutant and PnFNS I/F3H-dmr6 transgenic Arabidopsis; C-D: content of apigenin (C) and quercetin (D) in WT, dmr6 mutant and PnFNS I/F3H-dmr6 transgenic Arabidopsis;

fig. 10a-b: MS/MS cleavage spectrum of apigenin and quercetin molecular ion in PnFNS I/F3H-dmr6 transgenic Arabidopsis; apigenin: apigenin, quercetin: quercetin.

Fig. 11: the PCR amplification procedure described in the examples;

FIG. 11A is a portion 1.2.3 of the PCR amplification procedure of example 1;

FIG. 11B is a portion 1.4 of the PCR amplification procedure of example 1;

FIG. 11C is a portion 4.4 of the PCR amplification procedure of example 4;

FIG. 11D shows a portion 4.5 of the PCR amplification procedure of example 4.

Detailed Description

It should be noted that the following detailed description is illustrative and is intended to provide further explanation of the invention. Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs.

It is noted that the terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting of exemplary embodiments according to the present invention. As used herein, the singular is also intended to include the plural unless the context clearly indicates otherwise, and furthermore, it is to be understood that the terms "comprises" and/or "comprising" when used in this specification are taken to specify the presence of stated features, steps, operations, devices, components, and/or combinations thereof.

In order to enable those skilled in the art to more clearly understand the technical scheme of the present invention, the technical scheme of the present invention will be described in detail with reference to specific embodiments.

EXAMPLE 1 cloning of the expression Gene PnFNS I/F3H

1.1 extraction of total RNA of Sonchus arvensis by CTAB-PVP method

The preparation method of the CTAB-PVP extraction buffer solution comprises the following steps:

100mM Tris-HCl (pH 8.0), 2% CTAB (w/v), 2% PVP (w/v), 25mM EDTA,2M NaCl, mercaptoethanol added to 0.2% after autoclaving; solution configuration ddH treated with DEPC ₂ O, after autoclaving, the mixture is ready for use.

The extraction method comprises the following steps:

(1) And (3) regulating the temperature of the water bath kettle to 65 ℃, and placing the prepared CTAB extract into the water bath kettle for preheating. Taking a proper amount of materials into a mortar, adding liquid nitrogen and grinding into powder.

(2) The ground material is put into a 2mL centrifuge tube with an inlet quick frozen by liquid nitrogen, 600 mu L of CTAB extracting solution is added, and the mixture is mixed evenly upside down.

(3) Water bath at 65 deg.c, mixing once every 10min and heating for 30min.

(4) Taking out the centrifuge tube, cooling to room temperature, adding equal volume of chloroform, mixing, and centrifuging at 12,000rpm for 10min at 4deg.C.

(5) The supernatant was pipetted into a 2mL centrifuge tube, an equal volume of chloroform was added, mixed upside down several times, and centrifuged at 12,000rpm for 10min.

(6) Repeating the operation (5).

(7) The supernatant was then aspirated into a fresh 1.5mL centrifuge tube, 2/3 volumes of 8M LiCl solution was added and left overnight at-20 ℃.

(8) The next day, samples were removed at-20℃and after thawing the solution, centrifuged at 12,000rpm at 4℃for 10min, the supernatant was removed and the pellet was washed twice with 700. Mu.L of 75% ethanol.

(9) Discarding ethanol, sucking the rest liquid as clean as possible, and blow-drying in an ultra clean bench.

(10) After ethanol evaporation, 30. Mu.L of DEPC water was added to dissolve RNA. RNA concentration was measured with a Biophotometer plus nucleic acid protein meter and RNA quality was visualized by gel electrophoresis.

1.2 full-length amplification of PnFNS I/F3H Gene

1.2.1 primer design

The open reading frame of PnFNS I/F3H was found using the sequence analysis program of software Bioxm 2.0 (Open reading frame). And selecting proper enzyme cutting sites according to the pET32a vector sequence, and designing primers for constructing a protein expression vector.

Full length primer:

PnFNS I/F3H-F:CGGGATCCATGGCTTCTTTGATCACTAA；(SEQ ID No.3)

PnFNS I/F3H-R:CCCAAGCTTTCAGGCCTTTGTTCCTGTTT；(SEQ IDNo.4)

1.2.2cDNA Synthesis

Using the extracted RNA of the Pinus sylvestris as a template and using a reverse TravelReverse transcription was performed using qPCR RT Kit. 1 mug of RNA was taken and water-bath was carried out at 65℃for 5min.

Reverse transcription system:

reverse transcription procedure

cDNA was obtained and stored at-20 ℃.

1.2.3 amplification of the Gene of interest

The cDNA was diluted 5-fold and amplified using this as a template.

Amplification system:

the amplification procedure is shown in FIG. 11A.

The amplified product was separated by agarose gel electrophoresis, the target fragment was excised, and the target fragment was recovered using a Gel Extraction Kit kit.

The result of PCR was subjected to agarose gel electrophoresis (see FIG. 1), and the size band of interest was cut and recovered as follows.

The PCR products were subjected to agarose gel electrophoresis (1.5%, W/V, g/100 ml), and the target fragment was recovered using an OMEGA gel recovery kit. The method comprises the following steps:

(1) After agarose gel electrophoresis (1.5%, W/V, g/100 mL) of the PCR product, the PCR product was stained with Ethidium Bromide (EB) for 5min, and a gel block containing a band of the desired size was rapidly cut off under an ultraviolet lamp and placed into a 1.5mL centrifuge tube.

(2) mu.L of Binding Buffer (XP 2) was added and the gel was dissolved in a 55℃water bath. The tubes were inverted every 2-3min during this period.

(3) The above sol was transferred to HiBind DNA column, hiBind DNA column and placed in a 2mL collection tube and centrifuged at 12,000rpm for 1min.

(4) The filtrate in the collection tube was discarded, and 300. Mu.L of Binding Buffer (XP 2) was added to HiBind DNA column. Centrifuge at 12,000rpm for 1min, discard the filtrate.

(5) 700 mu L SPW Wash Buffer was added and centrifuged at 12,000rpm for 1min.

(6) The above steps are repeated once.

(7) The filtrate was discarded, and the remaining ethanol was evaporated by centrifugation at room temperature of HiBind DNA column at 12,000rpm for 2 min.

(8) HiBind DNA column was placed in a fresh 1.5mL centrifuge tube and left open until the ethanol volatilized. Add 30. Mu.L ddH to the center of the column membrane ₂ O, standing at room temperature for 2min, and centrifuging at 12,000rpm for 1min.

(9) The concentration and quality of the gel recovered products were determined using a Biophotometer plus nucleic acid protein meter, and the recovered fragments were used immediately or stored at-20 ℃.

1.3 target fragment connecting blunt end vector and transforming E.coli DH5 alpha

The fragment of interest was ligated to the Blunt-ended vector pTOPO-Blunt.

The connection system is as follows:

the procedure is as follows:

the ligation product was transferred into E.coli competent DH 5. Alpha.

The transformation method comprises the following steps: escherichia coli DH5 alpha competent cells were thawed on ice, 10. Mu.L of the ligation product was added and mixed well, and after half an hour on ice, heat shock was performed at 42℃for 90s, followed by 2min on ice, 400. Mu.L of antibiotic-free liquid LB medium was added, and shaking culture was performed at 37℃for 1-2h at 110 rpm. The bacterial liquid is evenly coated on an Amp LB solid medium, and the bacterial liquid is inverted overnight in a 37 ℃ incubator.

LB Medium component (1L): 5g of yeast extract, 10g of tryptone and 10g of NaCl, adding water for dissolution, adjusting the pH value to 7.0, and fixing the volume. After the solid medium was added to agar (12 g/L), the mixture was autoclaved.

1.4 monoclonal Positive validation

100 mu L of Amp LB liquid medium is added into a 96-well plate, a monoclonal with good growth vigor is picked from a solid screening medium and is picked into the 96-well plate, shaking culture is carried out for 3-4h at the temperature of 37 ℃ and at the speed of 110rpm, and bacterial colony PCR positive identification is carried out by taking bacterial liquid as a template.

PCR reaction system:

the procedure is shown in fig. 11B.

Separating PCR products by agarose gel electrophoresis, sequencing the monoclonal of the PCR products corresponding to the size of the target bands, storing positive monoclonal bacterial liquid after sequencing correctly, mixing 70 mu L DMSO and 930 mu L bacterial liquid uniformly, and freezing at-80 ℃.

Example 2 Gene protein expression and enzymatic Activity function analysis

2.1 construction of protein expression vectors

2.1.1 amplification of the Gene of interest

The correctly sequenced monoclonal bacterial solution was incubated overnight at 37℃at 120rpm, and plasmids were extracted using the Plasmid Mini Kit:

(1) The deposited strains MemUGT1-pTOPO-DH5 alpha are respectively streaked on LB plates (containing 100 mug/mL Amp), after 12 hours at 37 ℃, monoclonal is grown, and the monoclonal is selected and cultured in 4mL culture medium containing Amp resistance for 10 hours at 37 ℃ and 110 rpm.

(2) The bacterial liquid was centrifuged at 12,000rpm for 1min at room temperature, and the supernatant was discarded, and the bacterial cells were collected and the supernatant was discarded as much as possible.

(3) 150. Mu.L of the solution P1 was added to the centrifuge tube in which the bacterial cells were precipitated, and the solution was vortexed until the bacterial cells were completely suspended.

(4) 150. Mu.L of the solution P2 was added to the centrifuge tube, and the tube was gently turned upside down for 6-8 times to allow the cells to be sufficiently lysed.

(5) 350. Mu.L of solution P5 was added to the centrifuge tube and immediately mixed up and down quickly, at which point flocculent precipitate would appear. After standing for 2min, the mixture was centrifuged at 12,000rpm for 5min.

(6) The supernatant collected in the previous step was transferred to an adsorption column CP3 (the adsorption column was put into a collection tube). Centrifuge at 12,000rpm for 1min, and discard the waste liquid in the collection tube.

(7) To the adsorption column CP3, 300. Mu.L of the rinse solution PWT was added, and the mixture was centrifuged at 12,000rpm for 1min, and the waste liquid in the collection tube was discarded.

(8) The adsorption column CP3 was placed in a collection tube, centrifuged at 12,000rpm for 2min, and the residual rinse solution in the adsorption column was removed.

(9) Placing the adsorption column CP3 into a clean centrifuge tube, volatilizing ethanol, suspending and dripping 30-50 μl of distilled water into the middle part of the adsorption film, centrifuging at 12,000rpm for 2min, and collecting plasmid solution into the centrifuge tube.

The plasmid is used as a template to amplify the target fragment, and the amplification system and the amplification procedure are the same as 1.2.3. Separating PCR product by agarose gel electrophoresis, and recovering target fragment.

2.1.2 cleavage and ligation

The target gene fragment and pET32a empty vector are cut by restriction endonuclease, the enzyme is cut for 3.5 hours at 37 ℃, the PCR product is separated by agarose gel electrophoresis, and the enzyme cut fragment is recovered by gel.

And (3) enzyme cutting system:

the gene of interest was ligated to pET32a vector using T4 DNA Ligase.

The connection system is as follows:

the ligation was carried out overnight at 16 ℃.

2.1.3 transformation of E.coli BL21

The ligation product was transformed into E.coli DH 5. Alpha. E.coli DH5 alpha monoclonal cultured overnight was selected and cultured in 4-5mL Amp LB liquid medium at 37℃and 120rpm for 12 hours, and plasmids were extracted using Plasmid Mini Kit. The plasmid was transferred into E.coli BL 21. The transformation method is the same as above.

2.2 prokaryotic expression of Gene recombinant proteins

2.2.1 recombinant protein Induction expression

Pn2ODD-pET32a-BL21 was inoculated on Amp LB solid plate and cultured upside down at 37℃overnight. The monoclonal with good growth vigor is selected and cultured in 2mL Amp LB liquid medium at 37 ℃ for 4-5h under 110rpm shaking. The bacterial liquid is inoculated into 200mL of Amp LB liquid medium according to the proportion of 1:100, and is cultured by shaking at 110rpm at 37 ℃ until the OD600 is about 0.6-0.8, and an inducer IPTG is added to the bacterial liquid until the final concentration is 0.5mM. It was subjected to shaking induction at 110rpm at 16℃for not less than 12 hours.

2.2.2 isolation and purification of recombinant proteins

(1) And (3) thallus collection: the induced overnight bacterial liquid was collected by centrifugation at 4,000rpm for 5min.

(2) Washing the bacterial cells: adding 15-20-mL Binding buffer to resuspend thallus, centrifuging at 5,000rpm for 5min, and discarding supernatant. The operation was repeated twice.

(3) Ultrasonic crushing: adding 15-20-mL Binding buffer to resuspend the thallus, and performing low-temperature ultrasonic crushing. Centrifuge at 10,000g for 20min at 4 ℃. The supernatant was collected. The pellet was resuspended in Binding buffer and 30. Mu.L of supernatant and pellet samples were taken for protein electrophoresis.

(4) Protein purification: adding the supernatant into a pre-loaded nickel column, and adding a column volume Wash buffer to remove the impurity protein after the supernatant is completely discharged. The recombinant protein of interest was then eluted with an imidazole 5mL Elution buffer containing 250 mM. A30. Mu.L sample was taken for protein electrophoresis.

(5) Liquid exchange and concentration: the recombinant protein of interest was collected, all of which was added to a pre-chilled ultrafiltration tube and centrifuged at 4,000g for 7min. The ultrafiltration tube is filled with Binding buffer, the mixture is gently mixed upside down, and the operation is repeated twice. The protein from the ultrafiltration tube was removed and transferred to a pre-frozen EP tube.

(6) Protein preservation: 80% glycerol was added to the protein, the volume of glycerol being approximately one seventh of the volume of the protein. The protein was then sub-packaged and stored at-80℃until use.

Binding buffer: 2.42g Tris-HCl, 29.22g NaCl and 0.34g imidozole were weighed, dissolved in water, 1000mL of the solution was determined, sterilized, and then 70. Mu.L of beta-mercaptoethanol was added and the solution was stored at 4 ℃.

An execution buffer: 2.42g Tris-HCl, 29.22g NaCl and 34g imidozole are weighed respectively, dissolved in water, fixed in 1000mL volume, sterilized, added with 70 mu L beta-mercaptoethanol and stored at 4 ℃.

2.2.3 SDS-PAGE electrophoresis of proteins

Expression, isolation and purification of the target protein were detected by denaturing polyacrylamide gel electrophoresis (Sodium Dodecyl Sulfate Polyacrylamide Gel Electrophoresis, SDS-PAGE).

(1) And assembling the electrophoresis device, and fixing the glass plate on the glue frame.

(2) Preparing 12% separating gel, adding into electrophoresis apparatus, sealing with water, and standing until the separating gel is solidified.

(3) Preparing 5% concentrated gel, and pouring out the upper water layer. Mixing 5% of the prepared concentrated gel, immediately pouring, inserting the hole comb between glass plates (avoiding bubble generation), and pulling out the comb after gelatinization.

(4) An appropriate amount of loading buffer was added to each of the protein supernatant and purified protein, and the mixture was centrifuged at 13,000rpm for 10min in boiling water to sample 10. Mu.L of the supernatant and 2.5. Mu.L of the protein Marker was simultaneously aspirated.

(5) And adding a proper amount of electrophoresis buffer solution into the electrophoresis tank, performing electrophoresis at a constant voltage of 90V, changing to 130V constant voltage electrophoresis when the sample is electrophoresed to the separation gel, and stopping electrophoresis until bromophenol blue reaches the lower edge of the gel.

(6) Taking off the albumin glue, putting the albumin glue into coomassie brilliant blue R-250 staining solution for soaking and staining, and lightly shaking and staining for 2 hours at room temperature.

(7) Washing the dyeing liquid on the surface of the protein gel with distilled water for 2-3 times, placing the washed protein gel in the decolorizing liquid for decolorizing for 2 hours, and replacing the decolorizing liquid for several times in the decolorizing process until the background of the protein gel is washed clean.

(8) The results were observed, stored in photographs and analyzed, and the results of protein electrophoresis are shown in FIG. 2.

2.3 functional identification of enzymatic Activity

2.3.1 in vitro enzymatic Activity reaction

In vitro function assay is performed on the target protein PnFNS I/F3H by taking naringenin as a substrate, and pET32a empty carrier protein is taken as a negative control. An in vitro enzyme activity reaction system (100. Mu.L) was as follows:

the reaction is carried out for 2h at 37 ℃ with 1 mu L of Vc+Fe being supplemented at 1h of intermediate interval ²⁺ . After the reaction was completed, 100. Mu.L of ethyl acetate was added to extract 2 times, and the mixture was thoroughly mixed by vortexing, centrifuged at 13,000rpm for 5 minutes, and the ethyl acetate layers were combined. After evaporating ethyl acetate, the mixture was dissolved in 100. Mu.L of chromatographic methanol, centrifuged at 13,000rpm for 10min, and 20. Mu.L of the sample was analyzed by high performance liquid chromatography (High Performance Liquid Chromatography, HPLC).

2.3.2 analysis of enzyme Activity products

To verify the in vitro enzymatic function of PnFNS I/F3H, HPLC was used to detect the products of the enzymatic reactions described above. HPLC analysis column model: agilent Eclipse XD-C18,5 μm, 4.6X106 mm.

The detection wavelength is as follows: 280nm and 350nm. Sample injection amount: 20. Mu.L.

HPLC analysis conditions were as follows:

the retention time of the standard was used for the identification of the enzyme activity product. The measurement results are shown in FIG. 3.

2.3.3 substrate Selectivity analysis

The in vitro function assay was performed on the target protein PnFNS I/F3H, with pET32a empty vector protein as a negative control. The measurement results are shown in FIG. 4. The reaction substrates are Hesperetin (Hesperetin), pinocembrin (Pinocembrin), eriodictyol (Eriodictyol), homoeriodictyol (Homoeriodictyol) and liquiritin (Liquiritigenin), respectively; the products were Diosmetin (Diosptein), chrysin (Chrysin), luteolin (Luteolin), chrysin (Chrysoeriol) and 7,4 '-dihydroxyflavone (4', 7-dihydroxyflavone), respectively

2.3.4 optimum pH and temperature

Naringenin is used as a substrate to detect the optimal pH and temperature of the enzymatic reaction of PnFNS I/F3H.

The effect of pH on the reaction rate was determined, the temperature was fixed at 37℃and the pH used for the enzyme activity included 5.0,5.5,6.0,6.5,7.0,7.5,8.0,8.5. The effect of temperature on the reaction rate was measured at pH 7.0 at 0℃C, 5℃C, 10℃C, 15℃C, 20℃C, 25℃C, 30℃C, 35℃C, 40℃C, 45℃C, 50℃C. The measurement results are shown in FIG. 5.

2.3.5 determination of enzymatic kinetic parameters

Enzymatic kinetic analysis was performed at optimum pH and temperature with naringenin and homoeriodictyol as substrates at substrate concentrations of 2, 4, 8, 10, 20, 50, 100 and 150. Mu.M, respectively. The total volume was 100. Mu.L, the reaction time was 10min, and the experiments were performed 3 times in parallel. The experimental results are shown in Table 1.

TABLE 1

Example 3 biosynthesis of apigenin and Dihydrokaempferol using E.coli PnFNS I/F3H-pET32a-BL 21.

(1) Activating the strain in a constant temperature incubator at 37 ℃, picking up the monoclonal and inoculating the monoclonal strain into 4mL of LB liquid medium (containing 100 mug/mL of Amp), and continuously culturing the strain in the incubator at 37 ℃ for 7 hours;

(2) Inoculating the target strain and the control strain into 50mL of resistant LB culture medium according to the ratio of 1:100, culturing in a shaking table at 37 ℃ and 200rpm until the OD600 = 0.6-0.8, adding IPTG to the final concentration of 0.5mM, and culturing at the constant temperature of 20 ℃ for 6-7h;

(3) Adding DMSO-dissolved substrate (naringenin) to the bacterial solution, wherein the concentration of the substrate is 150 mu M, and placing the bacterial solution at 20 ℃ for continuous culture for a period of time;

(4) 500 mu L of bacterial liquid is taken out every 12 hours, the equal volume of ethyl acetate is added for extraction for 2 to 3 times, the organic phases are combined, the sample is dried, 100 mu L of methanol is added for redissolution, and the product is analyzed by HPLC. The results of PnFNS I/F3H fed substrate naringin in E.coli are shown in FIG. 6.

Example 4 biosynthesis of flavones and flavonols Using transgenic plants PnFNS I/F3H-tt6 and PnFNS I/F3H-dmr 6.

4.1 construction of the Gene overexpression vector of interest

Gateway primer design according to target gene PnFNS I/F3H

attB1-PnFNS I/F3H-F：

GGGGACAAGTTTGTACAAAAAAGCAGGCTTAACCATGGCTTCTTTGATCAC TAA；(SEQ ID No.5)

attB2-PnFNS I/F3H-R:

GGGGACCACTTTGTACAAGAAAGCTGGGTCTCAGGCCTTTGTTCCTGTTT；(SEQ ID No.6)

PCR amplification is carried out by taking the PnFNS I/F3H-pET32a plasmid as a template, and the amplification system and the amplification conditions are the same as those above.

(1) And (3) BP reaction:

reaction system

a. The reaction was carried out at 25℃for 6 hours, 0.5. Mu. L Proteinase K solution was added thereto, and the reaction was stopped at 37℃for 10 minutes. The reaction product was transformed into E.coli DH 5. Alpha. And incubated at 37℃for 2h with 400. Mu.L of antibiotic-free LB, spread over a Gent-resistant LB solid plate and incubated overnight at 37℃with inversion.

b. And (3) selecting the monoclonal to carry out positive verification, sending the positive monoclonal to a company for sequencing, and after the sequencing is correct, storing bacteria and freezing at-80 ℃.

c. The plasmid PnFNS I/F3H-pDONR207 and pGWB5 were extracted and subjected to LR reaction.

(2) LR reaction

The reaction system:

a. the LR reaction was terminated by reaction at 25℃for 6 hours and 0.5. Mu. L Proteinase K solution was added thereto and reacted at 37℃for 10 minutes. The reaction product was transformed into E.coli DH 5. Alpha. And 400. Mu.L of antibiotic-free LB was added and incubated at 37℃for 2h, spread over a Kan-resistant LB solid plate and incubated overnight at 37℃in an inverted position.

b. And (3) selecting a monoclonal to carry out positive verification to obtain a PnFNS I/F3H-pGWB5-DH5 alpha strain, storing the strain, and freezing at-80 ℃.

c. Extracting the plasmid of PnFNS I/F3H-pGWB5 and performing agrobacterium transformation.

4.2 transformation of Agrobacterium by Freeze thawing

(1) The competent cells of Agrobacterium GV3101 were removed, thawed on ice, added with 5. Mu.L of plasmid PnFNS I/F3H-pGWB5, gently mixed and left on ice for 5min.

(2) Quick-freezing with liquid nitrogen for 5min, and then water-bathing at 37deg.C for 5min.

(3) 400. Mu.L of the liquid medium without antibiotic YEP was added thereto and incubated at 30℃for 2-3 hours.

(4) Centrifugation at 5000rpm for 1min, 200. Mu.L of the bacterial liquid was applied to a YEP solid medium containing 100. Mu.g/mL of rifampicin, 50. Mu.g/mL of kanamycin and 50. Mu.g/mL of gentamicin. And (3) standing and culturing at 30 ℃ for 2-3 days.

(5) The monoclonal is picked for small shaking, and positive is identified by colony PCR, so that agrobacterium GV3101 carrying plasmid PnFNS I/F3H-pGWB5 is obtained.

4.3 Agrobacterium-mediated transformation of Arabidopsis thaliana

Agrobacterium containing the PnFNS I/F3H-pGWB5 over-expression vector was transformed into Arabidopsis by inflorescence infection as follows:

(1) A single clone of Agrobacterium GV3101 harboring plasmid PnFNS I/F3H-pGWB5 was inoculated into 10mL of YEP liquid culture medium (containing 50. Mu.g/mL kanamycin, 50. Mu.g/mL gentamicin and 100. Mu.g/mL rifampicin, hereinafter referred to as a three antibody), and cultured at 30℃with shaking at 200rpm overnight.

(2) 300 mu L of culture solution is inoculated into 30mL of three-antibody YEP liquid culture solution, and the first time of activation is performed at 30 ℃ and 200rpm for 24 hours.

(3) 300 mu L of culture solution is inoculated into 10mL of three-antibody YEP liquid culture solution, the temperature is 30 ℃, the rpm is 200, the time is 12-14 hours, and the second time is activated.

(4) And (3) inoculating 300 mu L of the secondary activated culture solution into 30mL of three-antibody YEP liquid culture solution, culturing at 30 ℃ and 200rpm for 10 hours until the OD600 is about 0.9, centrifuging at 5000rpm at room temperature for 10 minutes, collecting thalli, and re-suspending in an infection solution to ensure that the OD600 is about 1.5.

(5) The pods grown from the tt6 and dmr6 mutant Arabidopsis are cut off, the invasion solution is spotted on the buds, and after light-shielding treatment for 4 hours, the second invasion is carried out. And then the light-shielding treatment is carried out for 20 to 24 hours.

(6) After the light-shielding treatment is completed, the arabidopsis is grown normally, and the seeds of the T0 generation are harvested.

4.4 screening and identification of Positive plants

The method for obtaining the transgenic arabidopsis seeds through inflorescence infection method requires screening and positive verification through a culture medium containing antibiotics, and comprises the following specific steps:

(1) The transgenic T0 generation seeds are placed in a 1.5mL EP tube, sterilized with 75% ethanol for 3min, turned upside down to ensure sufficient sterilization, and the 75% ethanol is discarded.

(2) 700 mu L of absolute ethyl alcohol is added, the mixture is turned upside down for 3min, the seeds are taken out and put on sterile filter paper to be dried, and the seeds are evenly spread on 1/2MS (containing 25mg/L hygromycin) solid culture medium. Placing at 4deg.C, and vernalizing for 3 days.

(3) After 3 days, the seeds were incubated in a 22℃light incubator (16 h light/8 h dark) for about 12-14 days.

(4) And (5) observing the germination and growth states of seeds in the culture medium, and picking seedlings with two true leaves and transplanting the seedlings in nutrient soil.

(5) Selecting positive plants and leaves of mutant arabidopsis thaliana (negative control), extracting DNA by using an M5 hypersonic mix kit, taking plasmids containing target genes as positive controls, respectively carrying out PCR positive verification by using PnFNS I/F3H-RT-F/R primers, determining positive plants, and collecting T1 generation seeds.

The method for extracting DNA by using the M5 super-light speed mix kit comprises the following steps:

will be 2mm ² Plant leaves of the size were placed in 20. Mu.L of lysate, and sufficiently ground until the lysate became discolored, heated at 100℃for 3-5min, centrifuged at 12,000rpm for 2min, and DNA was present in the supernatant, which was used as a PCR template.

PCR system:

the amplification procedure is shown in FIG. 11C.

(6) And continuously screening the collected T1 generation seeds, selecting plants with positive seedlings and negative seedlings in a separation ratio of 3:1, transplanting according to the operations, collecting T2 generation seeds, continuously screening the T2 generation seeds, and finally obtaining homozygous plants for subsequent in-vivo analysis of gene functions.

4.5 analysis of transgenic Arabidopsis Gene expression

The RNA of transgenic Arabidopsis, wild type, tt6 and dmr6 mutants was extracted by CTAB-PVP method and reverse transcribed into cDNA, the specific procedure was as above. Designing an internal reference primer sequence At-actin-F/R according to an internal reference sequence in Arabidopsis, and carrying out RT-PCR detection by taking cDNA as a template and taking At-actin-F/R and PnFNS I/F3H-RT-F/R as primers.

RT-PCR system:

the amplification procedure is shown in FIG. 11D.

The RT-PCR results were run out to verify the expression of the target gene, and the results are shown in FIG. 7.

4.6 chemical composition analysis of transgenic Arabidopsis thaliana

PnFNS I/F3H-tt6 seedling culture and analysis method:

(1) Treatment and vernalization of arabidopsis seeds: sterilizing homozygous transgenic Arabidopsis thaliana, wild type and mutant seeds with 75% ethanol for 3min, reversing upside down to ensure sufficient sterilization, discarding 75% ethanol, reversing upside down with absolute ethanol for 3min, taking out the seeds, placing on sterile filter paper, blow-drying, spreading in 1/2MS culture medium, and placing at 4deg.C for vernalization for 3 days.

(2) After 3 days, the seeds were incubated in a 22℃light incubator (16 h light/8 h dark) for about 12-14 days.

(3) Collecting young seedling, quick freezing with liquid nitrogen, freeze drying, grinding into powder, collecting 20mg powder, adding 600 μl of 50% methanol (containing 100 μM chrysin), and performing ice water bath ultrasonic treatment for 1 hr.

(4) Centrifuging at 13,400rpm at 4deg.C for 30min, sucking 400 μl supernatant, adding equal volume of 2N HCl, hydrolyzing with acid at 70deg.C for 40min, extracting with 600 μl ethyl acetate three times, mixing ethyl acetate phases, and blow drying into liquid phase.

(5) HPLC-MS analysis: a Hypersil Gold (100 mm. Times.2.1 mm,1.9 μm) column was used with a flow rate of 0.3mL/min. The liquid phase analysis conditions were as follows:

the results are shown in FIGS. 8 and 9.

PnFNS I/F3H-dmr6 seedling culture and analysis method:

(1) Weighing homozygote transgenic Arabidopsis thaliana, wild Arabidopsis thaliana and mutant Arabidopsis thaliana seeds of about 6.0mg, placing into a 1.5mL EP tube, adding 75% ethanol for sterilization for 3min, reversing upside down to ensure sufficient sterilization, discarding 75% ethanol, reversing upside down for 3min with absolute ethanol, taking out the seeds, placing on sterile filter paper for blow drying, placing the seeds into a 1/2MS liquid medium containing 200 mu M naringenin, and vernalizing for 3 days at 4 ℃;

(2) After 3 days, the seeds were incubated in a 22℃light incubator (16 h light/8 h dark) for about 12-14 days.

(3) Collecting seedlings, washing the materials with a large amount of water, washing off the culture medium and the substrate, absorbing water, quick freezing with liquid nitrogen, freeze-drying, grinding into powder, taking 20mg of powder, adding 600 mu L of 50% methanol (containing 100 mu M chrysin), and performing ice water bath ultrasonic treatment for 1h.

(4) Centrifuging at 13,400rpm at 4deg.C for 30min, sucking 400 μl supernatant, adding equal volume of 2N HCl, hydrolyzing with acid at 70deg.C for 40min, extracting with 600 μl ethyl acetate three times, mixing ethyl acetate phases, and blow drying into liquid phase. HPLC-MS analysis was as described above. The results are shown in FIG. 10.

The above description is only of the preferred embodiments of the present invention and is not intended to limit the present invention, but various modifications and variations can be made to the present invention by those skilled in the art. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present invention should be included in the protection scope of the present invention.

SEQUENCE LISTING

<110> university of Shandong

<120> a flavone synthase I/flavanone-3-hydroxylase and its application in the field of flavonoid synthesis

<130> 2022803774

<160> 6

<170> PatentIn version 3.3

<210> 1

<211> 346

<212> PRT

<213> Psilotum nudum

<400> 1

Met Ala Ser Leu Ile Thr Lys Ala Asn Gly Val Gly Ser Val Lys Ile

1 5 10 15

Leu Ala Glu Ala Gly Ile Glu Gln Ile Pro Ser Ala Tyr Ile Lys Asp

20 25 30

Lys Asp Glu Leu Leu Gln Ile Gly His Ser His Phe Ser Lys Glu Ile

35 40 45

Pro Val Ile Ser Leu Ile Lys Leu His Gly Lys Asp Arg Glu Arg Val

50 55 60

Leu Glu Asp Ile Arg Leu Ala Cys Glu Glu Trp Gly Ile Phe Gln Ile

65 70 75 80

Val Asp His Gly Val Thr Glu Glu Ile Gln Lys Lys Met Met Glu Leu

85 90 95

Val His Gly Phe Phe Met Leu Pro Leu Asp Glu Lys Leu Glu Tyr Ala

100 105 110

Met Pro Ala Asp Asp Phe Cys Gly Tyr Ala Asn Gly Ser Phe Leu Lys

115 120 125

Asp Asn Pro Gly Leu Asp Trp Arg Glu Leu Tyr Val Ala Arg Cys Arg

130 135 140

Pro Leu Thr Arg Arg Asp Val Asn Lys Trp Pro Ala Arg Pro Thr Gly

145 150 155 160

Phe Arg Glu Thr Phe Ala Arg Tyr Ser Asp Glu Met Leu Ser Leu Ala

165 170 175

Asn Leu Ile Ile Ser Ala Ile Ser Asp Ser Leu Gly Leu Pro Ser Asn

180 185 190

Ala Ile Leu Glu Val Cys Gly Glu Thr Glu Gln Lys Val Leu Leu Asn

195 200 205

Tyr Tyr Pro Thr Cys Pro Gln Ala Glu Gln Thr Leu Gly Leu Lys Arg

210 215 220

His Thr Asp Pro Gly Thr Ile Thr Ile Leu Leu Gln Asp Asn Val Ser

225 230 235 240

Gly Leu Gln Ala Thr Lys Asp Gly Gln Asn Trp Val Thr Val Glu Pro

245 250 255

Thr Pro Gly Ala Phe Val Val Asn Leu Gly Asp His Phe His Val Leu

260 265 270

Thr Asn Gly Arg Leu Lys Asn Ala Asp His Arg Ala Thr Val Asn Ala

275 280 285

Ser Lys Thr Arg Thr Thr Val Ala Ala Phe Trp Asn Pro Ala Ala Asp

290 295 300

Ser Lys Val Cys Pro Leu Pro Ala Leu Val Asp Glu Asp His Pro Pro

305 310 315 320

Leu Phe Glu Ala Glu Thr Phe Ser Glu Phe Tyr Asn Arg Lys Met Arg

325 330 335

Met Ala Ala Ala Lys Thr Gly Thr Lys Ala

340 345

<210> 2

<211> 1041

<212> DNA

<213> artificial sequence

<400> 2

atggcttctt tgatcactaa ggcaaatggc gttggcagtg ttaagatcct agctgaagct 60

ggaatagagc aaattccttc agcctatatc aaagacaaag atgaactact tcagatcggt 120

cacagtcatt ttagtaagga aatccctgtc atttctctta taaaactaca cggtaaagat 180

cgagagcgag tactggaaga tatcaggcta gcctgtgagg aatgggggat ttttcagatt 240

gtggatcatg gagtgacaga agagattcag aagaaaatga tggagctcgt acatggattt 300

ttcatgctcc cgctagacga gaaattggag tatgcaatgc ctgctgacga tttctgtggc 360

tatgccaacg gcagcttcct gaaggacaat ccgggccttg attggaggga gctgtatgtc 420

gcacgatgcc gtcctcttac cagaagggat gtaaataagt ggcctgcaag acctacaggc 480

ttcagggaga cgtttgcgag atacagtgac gaaatgttaa gtctggcaaa tttgatcata 540

agcgccatct ccgattccct cggtcttccc tccaacgcaa tactggaggt atgcggagag 600

acggaacaga aagtgctttt gaactactac cccacctgcc cacaagccga acagacgtta 660

ggcctgaaga gacacacaga tcccggaaca ataaccattc tgcttcagga caacgtttct 720

ggacttcagg caacaaaaga cgggcagaac tgggtaacag tggagccaac gcctggcgct 780

tttgtggtga acttgggcga tcatttccac gttcttacta acggcaggct gaagaacgca 840

gaccacagag ctactgtgaa cgcttccaaa acccgcacaa cagtagcagc attctggaac 900

ccagctgcag atagtaaggt ctgtccacta ccagctctgg tagatgaaga tcatccacca 960

ttatttgagg cagagacctt ctcagagttt tacaacagga agatgaggat ggcagcagca 1020

aaaacaggaa caaaggcctg a 1041

<210> 3

<211> 28

<212> DNA

<213> artificial sequence

<400> 3

cgggatccat ggcttctttg atcactaa 28

<210> 4

<211> 29

<212> DNA

<213> artificial sequence

<400> 4

cccaagcttt caggcctttg ttcctgttt 29

<210> 5

<211> 54

<212> DNA

<213> artificial sequence

<400> 5

ggggacaagt ttgtacaaaa aagcaggctt aaccatggct tctttgatca ctaa 54

<210> 6

<211> 50

<212> DNA

<213> artificial sequence

<400> 6

ggggaccact ttgtacaaga aagctgggtc tcaggccttt gttcctgttt 50

Claims (21)

1. A flavone synthase I/flavanone-3-hydroxylase is characterized in that the amino acid sequence of the enzyme is shown as SEQ ID NO. 1.

2. Nucleic acid substance encoding the flavonoid synthase I/flavanone-3-hydroxylase according to claim 1.

3. The nucleic acid substance of claim 2, wherein the encoding nucleic acid is DNA, including genomic DNA or synthetic DNA; the DNA is single-stranded or double-stranded, and is a coding strand.

4. A nucleic acid substance according to claim 3, characterized in that the amino acid sequence shown in SEQ ID No.1 is a flavonoid synthase I/flavanone-3-hydroxylase, the encoding nucleic acid sequence of which is shown in SEQ ID No. 2.

5. An expression vector comprising the nucleic acid agent of claim 2.

6. The expression vector of claim 5, wherein the expression vector is a pET series vector.

7. A host cell comprising the nucleic acid agent of any one of claims 2-4 or the expression vector of claim 5 or 6.

8. The host cell of claim 7, wherein the host cell is a microbial cell.

9. The host cell of claim 8, wherein the host cell is e.

10. An engineered bacterium that expresses a flavonoid synthase I/flavanone-3-hydroxylase, wherein the engineered bacterium is modified to have the expression of the flavonoid synthase I/flavanone-3-hydroxylase of claim 1 as compared to a wild-type bacterium.

11. The engineered bacterium that expresses flavonoid synthase I/flavanone-3-hydroxylase of claim 10, wherein the starting strain of the engineered bacterium is selected from the group consisting of escherichia coli.

12. The engineered bacterium of claim 11, wherein said escherichia coli expresses said flavonoid synthase I/flavanone-3-hydroxylase by transforming a recombinant expression plasmid.

13. Use of the flavonoid synthase I/flavanone-3-hydroxylase of claim 1, the encoding nucleic acid of any one of claims 2-4, the expression vector of claim 5 or 6, the host cell of any one of claims 7-9, the engineering bacterium expressing the flavonoid synthase I/flavanone-3-hydroxylase of any one of claims 10-12 in the field of plant flavone synthesis.

14. Use of the flavonoid synthase I/flavanone-3-hydroxylase, the encoding nucleic acid, the expression vector, the host cell, the engineering bacterium expressing the flavonoid synthase I/flavanone-3-hydroxylase according to claim 13 in the field of plant flavonoid synthesis, wherein the plant flavonoid comprises flavonoid and flavonol, and the use in the field of plant flavonoid synthesis comprises any one of the following:

(1) The content of flavonoid compounds in plants is increased so as to obtain plants with good resistance;

(2) Obtaining plants with high flavonoid content as extraction raw materials.

15. Use according to claim 14, wherein the use is in the transformation of agrobacterium with an expression vector according to claim 5 or 6 into arabidopsis thaliana to obtain a positive transfected plant.

16. A biosynthesis method of flavonoid compounds, which is characterized in that the synthesis method takes flavonoid compounds as substrates, and the flavonoid synthase I/flavanone-3-hydroxylase as claimed in claim 1 or the engineering bacteria as claimed in any one of claims 10 to 12 are added to synthesize the corresponding flavonoid compounds.

17. The method of biosynthesis of flavonoids according to claim 16, wherein the substrate is any one selected from eriodictyol, homoeriodictyol, hesperetin, pinocembrin and glycyrrhizin.

18. The method for biosynthesis of flavonoids according to claim 17, wherein the in vitro synthesis temperature of the flavonoid synthase I/flavanone-3-hydroxylase is 0-50 ℃.

19. The method for biosynthesis of flavonoids according to claim 18, wherein the in vitro synthesis temperature is 38-45 ℃.

20. The method for biosynthesis of flavonoids according to claim 17, wherein the in vitro synthesis pH of the flavonoid synthase I/flavanone-3-hydroxylase is 5 to 8.5.

21. The method for biosynthesis of flavonoids according to claim 20, wherein the pH of the in vitro synthesis is 7.5 to 8.5.