CN112662641B - Marchantia cuneata flavonoid glycosyltransferase and coding gene and application thereof - Google Patents

Abstract

The invention provides a marchantia polymorpha flavonoid glycosyltransferase, and a coding gene and application thereof, belonging to the technical field of genetic engineering and enzyme engineering. The invention obtains the full-length sequence of the gene from cDNA by utilizing PCR technology, and obtains the target protein by inducing and purifying after constructing pET32a protein expression vector to transform escherichia coli BL21(DE 3). In vitro enzyme activity function identification proves that the MemUGT1 substrate has strong specificity, can only catalyze flavonol compounds, has higher catalytic efficiency on the flavonol (quercetin, kaempferol, isorhamnetin and myricetin) compounds, has more specific products, can be used for biosynthesis of 3-O glycosylation products of the compounds, and has higher economic value and wide application prospect.

Description

Marchantia cuneata flavonoid glycosyltransferase and coding gene and application thereof

Technical Field

The invention belongs to the technical field of genetic engineering and enzyme engineering, and particularly relates to marchantia cuneata flavonoid compound glycosyltransferase as well as a coding gene and application thereof.

Background

The information in this background section is only for enhancement of understanding of the general background of the invention and is not necessarily to be construed as an admission or any form of suggestion that this information forms the prior art that is already known to a person of ordinary skill in the art.

Flavonoids are widely distributed in the plant kingdom, are usually bound to sugars in the plant body, exist in a small number of free forms, and play an important role in the growth, development, flowering, fruiting and the like of plants. The flavonoid compound is also one of the main active ingredients of medicinal plants, and modern researches show that the flavonoid natural product has wide pharmacological functions, such as antioxidant, anti-inflammatory, antitumor, anti-HIV virus activity and the like. In the case of plants, glycosylation can alter the physiological and chemical properties of flavonoids, such as increasing their water solubility, bioactivity, stability, etc. Flavonoid glycosylation is catalyzed in plants by glycosyltransferases (GT, EC 2.4.x.y), which transfer a glycosyl group from an activated glycosyl donor to a glycosyl acceptor compound and form a glycosidic bond.

At present, most of flavone glycoside natural products are separated from plants, but due to the factors of complex extraction process, low extraction efficiency, long plant growth period, high cost and the like, the large-scale preparation of glycoside compounds is limited, and the chemical synthesis yield of glycosides is low due to the reasons that glycosylation relates to regioselectivity, stereoselectivity and the like. The flavonoid glycoside compound synthesized by the enzyme method is not beneficial to large-scale industrial production because the glycosyl donor is expensive. In recent years, with the development of metabolic engineering and synthetic biology techniques, molecular biology methods are used to construct engineered microbial cell factories (e.g., escherichia coli and yeast), and large amounts of UDP sugar molecule donors can be economically obtained by in vivo glycosylation using biomass as a raw material. Various types of flavone glycosides have been synthesized by this method in recent years, and AtUGT73B3 and AtUGT84B1 in Arabidopsis thaliana are overexpressed in Escherichia coli, and quercetin 3-O-glucoside and quercetin 7-O-glucoside can be synthesized. UGT with 3-O glycosylation function is screened, the biochemical property of the UGT is clarified, and the UGT has important significance in synthetic biology research of flavone glycoside.

Marchantia cuneata (Marchantia emarginata) is a thallus of liverworts of Marchantia (Macrhantineae) and belongs to bryophytes, mostly grows in dark and humid places and is widely distributed in all parts of the world. The moss plant resources in China are very rich, and about 3000 moss plant resources are reported. However, the research on plant resources such as liverwort has been relatively rare so far, the existing research mostly focuses on the separation, extraction and purification of flavonoid compounds in liverwort, and the research on Glycosyltransferases (GTs) catalyzing the generation of flavonoid glycosides has not been reported yet.

Disclosure of Invention

Based on the defects of the prior art, the invention provides marchantia cuneata flavonoid glycosyltransferase and a coding gene and application thereof. According to research, the glycosyltransferase from liverwort of bryophyte clitella xylocarpa is a glycosyltransferase capable of efficiently catalyzing glycosylation of 3-hydroxy of flavone, can be used for biosynthesis of flavonoid compound 3-O glucoside by escherichia coli, and therefore has high economic value.

In order to achieve the technical purpose, the invention adopts the following technical scheme:

in a first aspect of the invention, there is provided a protein designated MemUGT1, said protein designated MemUGT1 being derived from Marchantia virginata (Marchantia emarginata). Experiments prove that the compound has the function of catalyzing the glycosylation of 3-hydroxyl of flavone, and can be used for biosynthesis of flavonol compound 3-O glucoside by escherichia coli.

Wherein the MemUGT1 is (a1) or (a2) as follows:

(a1) protein composed of amino acid sequence shown in SEQ ID No. 1;

(a2) and (b) a protein derived from (a1) by substitution and/or deletion and/or addition of one or several amino acid residues and having the same glycosyltransferase function.

SEQ ID No.1 consists of 488 amino acid residues.

In a second aspect of the present invention, there is provided a gene encoding said MemUGT 1.

Wherein the gene has the nucleotide sequence of any one of (b1) - (b 3):

(b1) a nucleotide sequence shown as SEQ ID No. 2;

(b2) a nucleotide sequence complementary to (b 1);

(b3) a nucleotide sequence which has > 90% (e.g. 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% (complete) sequence) identity to the nucleotide sequence shown in (b1) or (b2) and encodes the same functional protein.

The SEQ ID No.2 consists of 1467 nucleotides, wherein the 1 st to 1464 th nucleotides are coding sequences, and the 1465 th and 1467 th nucleotides are transcribed into stop codons to stop peptide chain synthesis.

In the third aspect of the present invention, amplification primers designed based on the coding gene, recombinant expression vectors containing the coding gene, and/or transformed cells and transgenic plants containing the coding gene are also within the scope of the present invention.

Wherein, the amplification primer comprises a sequence shown in SEQ ID No.3-SEQ ID No. 8.

The recombinant expression vector is obtained by effectively connecting the gene to an expression vector, wherein the expression vector is any one or more of a viral vector, a plasmid, a phage, a phagemid, a cosmid, an F cosmid, a phage or an artificial chromosome; the viral vector may comprise an adenoviral vector, a retroviral vector, or an adeno-associated viral vector, the artificial chromosomes comprising a Bacterial Artificial Chromosome (BAC), a bacteriophage P1 derived vector (PAC), a Yeast Artificial Chromosome (YAC), or a Mammalian Artificial Chromosome (MAC); further preferably a plasmid; the plasmids included pET32a and pGWB 5;

the transformed cell is any one or more of a bacterial cell, a fungal cell or a plant cell;

wherein the bacterial cell is any of the genera Escherichia, Agrobacterium, Bacillus, Streptomyces, Pseudomonas, or Staphylococcus;

more specifically, the bacterial cell is Escherichia coli (e.g., BL21(DE3)), Agrobacterium tumefaciens (e.g., GV3101), Agrobacterium rhizogenes, lactococcus lactis, Bacillus subtilis, Bacillus cereus, or Pseudomonas fluorescens.

The fungal cell comprises a yeast.

The transgenic plant comprises an arabidopsis plant, a maize plant, a sorghum plant, a potato plant, a tomato plant, a wheat plant, a canola plant, a rapeseed plant, a soybean plant, a rice plant, a barley plant, or a tobacco plant.

In the fourth aspect of the present invention, the use of the protein MemUGT1 as a glycosyltransferase is also within the scope of the present invention.

In the fifth aspect of the present invention, the application of the encoding gene, the recombinant expression vector, the transformed cell or the transgenic plant in the preparation of MemUGT1 is also within the protection scope of the present invention.

In a sixth aspect of the present invention, there is provided a use of the protein MemUGT1 in (c1) or (c2) as follows:

(c1) catalyzing the glycosylation of flavonol compounds 3-O;

(c2) preparing flavonol glycoside compounds.

Wherein, the flavonols include but are not limited to quercetin, kaempferol, isorhamnetin and myricetin.

The beneficial effects of one or more of the above technical solutions are as follows:

the MemUGT1 gene provided by the technical scheme is glycosyltransferase capable of catalyzing glycosylation of flavonoid compounds in liverwort, the technical scheme obtains the full-length sequence of the gene from cDNA by utilizing a PCR technology, and the target protein is obtained by inducing and purifying after constructing pET32a protein expression vector to transform escherichia coli BL21(DE 3). In vitro enzyme activity function identification proves that the MemUGT1 substrate has strong specificity, can only catalyze flavonol compounds, has higher catalytic efficiency on the flavonol (quercetin, kaempferol, isorhamnetin and myricetin) compounds, has more specific products, can be used for biosynthesis of 3-O glycosylation products of the compounds, and has higher economic value and wide application prospect.

Drawings

The accompanying drawings, which are incorporated in and constitute a part of this specification, are included to provide a further understanding of the invention, and are incorporated in and constitute a part of this specification, illustrate exemplary embodiments of the invention and together with the description serve to explain the invention and not to limit the invention.

FIG. 1: electrophoretogram of ORF amplification product of the gene of interest MemUGT 1.

FIG. 2: SDS-PAGE electrophoresis chart of MemUGT1 protein;

wherein: m protein molecular mass standard

Lane 1: MemUGT1 protein supernatant;

lane 2: purifying MemUGT1 protein;

FIG. 3: the substrate specificity of the recombinant protein MemUGT1 was studied under the condition that UDP-glucose was a sugar donor.

Wherein: and (3) Que: quercetin; kae: kaempferol; myr: myricetin; iso: isorhamnetin; api: apigenin; nar: naringenin; lut: luteolin; and (2) Chr: chrysoeriol; gen: genistein; and (Aca): farnesin; esc: aesculetin; dai: daidzein; scu: scutellarein; wherein A is a relative activity diagram of a substrate; b is a related substrate structural formula.

FIG. 4: HPLC profile of MemUGT1 enzyme activity catalysis reaction. The reaction substrates are quercetin, kaempferol, isorhamnetin, myricetin, apigenin, luteolin, chrysoeriol and naringenin respectively. Wherein: Q-3-G: quercetin-3-O-glucoside; K-3-G: kaempferol-3-O-glucoside; M-3-G: myricetin-3-O-glucoside; I-3-G: isorhamnetin-3-O-glucoside.

FIG. 5 is a schematic view of: the enzyme activity of MemUGT1 catalyzes the optimum pH and the optimum temperature of the reaction. UDP-glucose is used as a glycosyl donor, and myricetin, kaempferol and quercetin are used as glycosyl acceptors. Wherein, the glycosyl receptor in A is myricetin, the glycosyl receptor in B is kaempferol, and the glycosyl receptor in C is quercetin.

FIG. 6: influence of the type of medium on the glycoside yield during feeding of E.coli U1. Feeding Escherichia coli U1 in vivo with quercetin and kaempferol as substrate, wherein the culture medium includes LB culture medium, TB culture medium and M9 culture medium.

FIG. 7: effect of inducer concentration on glycoside yield during feeding of e.coli U1. Feeding Escherichia coli U1 in vivo with quercetin and kaempferol as substrates, wherein the substrate concentration gradient is 25 μ M, 50 μ M, 100 μ M, 500 μ M, 1000 μ M, or 2000 μ M; wherein the substrate in the A is kaempferol, and the substrate in the B is quercetin.

FIG. 8: effect of substrate concentration on glycoside production during feeding of e.coli U1. Feeding Escherichia coli U1 in vivo with quercetin and kaempferol as substrates, wherein the substrate concentration gradient is set to 50 μ M, 75 μ M, 100 μ M, 125 μ M, 150 μ M, and 400 μ M; wherein the substrate in the A is kaempferol, and the substrate in the B is quercetin.

FIG. 9: overexpression of MemUGT1 gene in Arabidopsis thaliana and content analysis of flavonol glycoside in transgenic Arabidopsis thaliana.

A: RT-PCR analysis indicated that MemUGT1 was transcribed in the selected transgenic line; AtActin was used as a reference sequence. B: kaempferol glycoside content in methanol extracts of arabidopsis seedlings was analyzed by HPLC. C: HPLC-MS profile.

Detailed Description

It should be noted that the following detailed description is exemplary and is intended to provide further explanation of the disclosure. Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application belongs.

It is noted that the terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting of example embodiments according to the present application. As used herein, the singular forms "a", "an" and "the" are intended to include the plural forms as well, and it should be understood that when the terms "comprises" and/or "comprising" are used in this specification, they specify the presence of stated features, steps, operations, devices, components, and/or combinations thereof, unless the context clearly indicates otherwise. It is to be understood that the scope of the invention is not to be limited to the specific embodiments described below; it is also to be understood that the terminology used in the examples is for the purpose of describing particular embodiments only, and is not intended to limit the scope of the present invention. The experimental procedures, if specific conditions are not indicated in the following detailed description, are generally in accordance with conventional procedures and conditions of molecular biology within the skill of the art, which are fully explained in the literature. See, e.g., Sambrook et al, "molecular cloning: the techniques and conditions described in the laboratory Manual, or according to the manufacturer's recommendations.

In order to make the technical solutions of the present invention more clearly understood by those skilled in the art, the technical solutions of the present invention will be described in detail below with reference to specific embodiments.

Example 1 cloning of the expression Gene MemUGT1

1.1 extraction of Total RNA of liverwort by CTAB-PVP method

(1) Taking plant fronds of liverwort with two months of growth in a greenhouse, cleaning, quickly freezing by using liquid nitrogen, and then putting into a mortar to grind until the materials are powdered.

(2) Taking a proper amount of plant powder into a pre-cooled 2mL inlet centrifuge tube, adding 800 mu l of CTAB-PVP extracting solution preheated at 65 ℃, and turning upside down and uniformly mixing.

The preparation method of the CTAB-PVP extraction buffer solution is as follows:

100mM Tris & HCl (pH 8.0), 2% CTAB (w/v), 2% PVP (w/v), 25mM EDTA, 2M NaCl, mercaptoethanol added to 0.2% after autoclaving; solution preparation of DEPC treated ddH₂And O, autoclaving for standby.

(3) Water bath at 65 deg.C for 30min, and mixing by reversing every 6-10 min.

(4) Cooling, adding 600 μ l chloroform, and mixing; centrifuge at 13,000rpm for 10min at 4 ℃.

(5) The supernatant was transferred to a new 1.5mL centrifuge tube, 800. mu.L chloroform was added, the mixture was shaken and mixed well, and then centrifuged at 13,000rpm at 4 ℃ for 10 min.

(6) Repeat the above steps (i.e. three extractions with chloroform).

(7) Sucking the supernatant, transferring to a new precooled centrifuge tube, adding 1/3 volumes of 8M LiCl, and standing at-20 ℃ for more than 3h (or standing overnight at 4 ℃, if icing occurs, 8M LiCl needs to be supplemented).

(8) Centrifuge at 13,000rpm for 10min at 4 ℃ and discard the supernatant.

(9) The precipitate was washed 2-3 times with 700. mu.l of 75% ethanol. Centrifuging, removing supernatant, and volatilizing residual ethanol.

(10) Adding 30 μ l of sterilized water treated with protease K to dissolve RNA, and obtaining total RNA. The concentration and mass of the extracted RNA were determined using a BioPhotometer plus nucleic acid protein analyzer.

1.2 full-Length amplification of MemUGT1 Gene

1.2.1 primer design

The ORF (open Reading frame) of MemUGT1 was found using the software Bioxm 2.6. Designing full-length primers MemUGT1-F/R at non-coding regions on both sides of ORF to amplify the gene;

full-length primer:

MemUGT1-F:GTATGTCCGTCAATCTGCTG；(SEQ ID No.3)

MemUGT1-R:TCTTCTCTACAGGGGATAAT；(SEQ ID No.4)

1.2.2 cDNA Synthesis

The total RNA of the extracted marchantia cuneata is taken as a template, and a cDNA template chain is obtained by a PrimerScript RT Master Mix reverse transcription system through a PCR technology.

The reverse transcription system and reverse transcription procedure were as follows:

(1) genome DNA removal

The components are added into an import PCR tube, mixed evenly and gently, and then put into a water bath at 42 ℃ for 5 min.

(2) Reverse transcription PCR

The reverse transcription procedure in the PCR instrument was: 15min at 37 ℃; denaturation at 85 ℃ for 15s, and heat preservation at 4 ℃.

The reverse transcription product was stored at-20 ℃ and diluted 10-fold before use.

1.2.3 amplification of target Gene

The diluted reverse transcribed marchantia cuneata cDNA is taken as a template, and MemUGT1-F/R is respectively taken as a primer for amplification.

The amplification system and the amplification procedure were as follows:

the components are added into a PCR tube of 200 mu L and mixed evenly, and PCR is amplified according to the following procedures: pre-denaturation at 94 ℃ for 3 min; denaturation at 94 ℃ for 10s, annealing at 52 ℃ for 15s, extension at 72 ℃ for 45s, and 33 cycles; extension at 72 ℃ for 10 min.

And (3) carrying out agarose gel electrophoresis detection on the PCR reaction product, and cutting and recovering the target size band gel by the following method.

The PCR product was subjected to agarose gel electrophoresis (1.4%, W/V, g/100ml), and the objective fragment was recovered using a TIANGEN gel recovery kit. The method comprises the following steps:

(1) the PCR product was subjected to agarose gel electrophoresis, stained with Ethidium Bromide (EB) for 5min, and the gel block containing the band of the desired size was rapidly cut under an ultraviolet lamp and placed in a 1.5mL centrifuge tube for recovery.

(2) Add 200. mu.L of solution PC and dissolve the gel pieces in a water bath at 55 ℃. During the period, the centrifuge tube was shaken upside down every 2-3min to dissolve it sufficiently.

(3) Placing adsorption column CB2 in a 2mL collection tube, transferring the sol solution to adsorption column CB2, centrifuging at 12,000rpm for 1min, and discarding the filtrate in the collection tube.

(4) To the adsorption column CB2, 600. mu.L of the rinsing solution PW was added. Centrifuge at 12,000rpm for 1min and discard the filtrate.

(5) And (4) repeating the operation step.

(6) The filtrate was discarded, and the adsorption column CB2 was centrifuged at room temperature at 12,000rpm for 2min to remove the rinsing liquid as much as possible.

(7) The adsorption column CB2 was placed in a new 1.5mL centrifuge tube, uncapped and placed until the ethanol was evaporated. Add 30. mu.L ddH to the center of the column₂O, standing at room temperature for 2min, centrifuging at 12,000rpm for 2min, and collecting DNA solution for immediate use or storing at-20 ℃.

1.3 ligation of the fragment of interest with blunt-ended vector

The product fragment recovered from the gel was ligated to the blunt-ended vector pTOPO according to the following reaction system:

after the reaction system is mixed evenly and placed in a PCR instrument for 5 minutes at 25 ℃, the final product is transformed into Escherichia coli DH5 alpha.

1.4 transformation

Coli DH 5. alpha. was transformed with 5. mu.L of the ligation product. The transformation method comprises the following steps: taking out competent cells (50 μ L) of Escherichia coli DH5 α preserved at-80 deg.C, thawing on ice, adding 5 μ L ligation product, gently blowing, mixing, and standing on ice for 30 min; heating in 42 deg.C water bath for 90s, rapidly placing on ice for 2min, adding 600 μ L non-resistant LB culture medium, culturing in 37 deg.C incubator under shaking for 1h, rapidly propagating, taking 200 μ L transformation solution, spreading on LB solid culture medium (containing 100 μ g/mL ampicillin), and standing at 37 deg.C for 12 h.

LB medium composition (1L): 5g of yeast extract, 10g of tryptone and 10g of NaCl, and adding water to dissolve the yeast extract, and then fixing the volume to 1L. After agar (12g/L) was added to the solid medium, the medium was autoclaved.

1.5 recombinant positive clone identification

Randomly selected 5 single clones were cultured in 200. mu.L of LB medium at 37 ℃ for 4 hours with shaking. Colony PCR was performed using M13F/R as a primer and bacterial solution as a template. The system is as follows:

and (3) amplification procedure: pre-denaturation at 94 ℃ for 5 min; denaturation at 94 ℃ for 30s, annealing at 52 ℃ for 30s, and extension at 72 ℃ for 60s, for 32 cycles; extending for 10min at 72 ℃;

and carrying out agarose gel electrophoresis after colony PCR, amplifying positive monoclonals with target size bands, and sequencing the positive clones with proper band sizes. And (3) successfully sequencing the positive clone for bacteria storage: 930. mu.L of the bacterial solution was added with 70. mu.L of DMSO, and the mixture was stored at-80 ℃ after being mixed well.

Example 2 Gene protein expression and enzyme Activity function analysis

2.1 extraction of MemUGT1-pTOPO plasmid

Plasmid extraction with plasmid miniprep kit (TIANGEN):

(1) the stored strain MemUGT1-pTOPO-DH5 alpha is respectively scribed into LB plate (containing 100 mu g/mL Amp), a single clone grows after 12h at 37 ℃, and the single clone is picked up and cultured for 10h at 37 ℃ and 110rpm in 4mL of Amp-resistant culture medium.

(2) Centrifuging the bacterial liquid at room temperature of 12,000rpm for 1min, discarding the supernatant, collecting the thallus, and pouring the supernatant as far as possible.

(3) The cell pellet was added to a centrifuge tube containing 150. mu.L of the solution P1, and vortexed until the cells were completely suspended.

(4) Add 150. mu.L of solution P2 to the tube and gently turn it up and down 6-8 times to lyse the cells.

(5) Add 350. mu.L of solution P5 to the centrifuge tube and mix immediately, quickly, upside down, whereupon a flocculent precipitate will appear. After standing for 2min, the mixture was centrifuged at 12,000rpm for 5 min.

(6) The supernatant collected in the previous step was transferred to adsorption column CP3 (adsorption column placed in collection tube). Centrifuge at 12,000rpm for 1min and discard the waste liquid from the collection tube.

(7) To the adsorption column CP3, 300. mu.L of the rinsing solution PWT was added, and centrifuged at 12,000rpm for 1min to discard the waste liquid from the collection tube.

(8) The adsorption column CP3 was placed in a collection tube and centrifuged at 12,000rpm for 2min to remove the residual rinse from the adsorption column.

(9) Placing the adsorption column CP3 in a clean centrifuge tube, volatilizing ethanol, suspending and dripping 30-50 μ L distilled water into the middle part of the adsorption membrane, centrifuging at 12,000rpm for 2min, and collecting the plasmid solution in the centrifuge tube.

2.2 amplification of the ORF of MemUGT1

The constructed positive monoclonal plasmid is used as a template, and a primer pair MemUGT1-pET32a-F/R with restriction enzyme cutting sites and PrimerSTAR Max DNA polymerase are respectively used for amplifying the ORF of MemUGT 1.

MemUGT1-pET32a-F:CGGGATCCATGGAGGGAGAAGTTGCAGG；(SEQ ID No.5)

MemUGT1-pET32a-R:ACGCGTCGACCTATGTACAGTTCATATCCT；(SEQ ID No.6)

Using MemUGT1-pTOPO plasmid as a template, amplifying ORF by using the primers, wherein the amplification program is as follows: pre-denaturation at 94 ℃ for 3 min; denaturation at 94 ℃ for 10s, annealing at 52 ℃ for 15s, extension at 72 ℃ for 45s, and 33 cycles; extension at 72 ℃ for 10 min.

And after the PCR product is separated by gel electrophoresis, carrying out gel recovery on the fragments according to a gel recovery kit. (results are shown in FIG. 1)

2.3 enzyme digestion

The recovered fragments of the vector pET32a and MemUGT1 gel were digested with BamHI and SalI, respectively, as follows:

the digestion was carried out in a 37 ℃ water bath for 3 h. The enzyme digestion product is added with 10 Xloading buffer to terminate the reaction, then agarose gel electrophoresis is carried out, and a proper band is selected for gel recovery, wherein the gel recovery method is the same as the above.

2.4 ligation, transformation and Positive validation

The cleaved target fragment was ligated with the cleaved vector pET32a (available from Novagen) using T4 DNA Ligase (available from Takara) in the following manner:

the above components were mixed well and ligated overnight at 16 ℃. The ligation product was transformed into E.coli DH5 alpha competent. The transformation method is the same as above. And selecting a monoclonal antibody to verify positive and sending the monoclonal antibody to sequencing, taking the monoclonal antibody with correct sequencing to store bacteria, and extracting a MemUGT1-pET32a plasmid. The constructed prokaryotic expression vector plasmid is transformed into escherichia coli BL21(DE3) competent cells by a heat shock method, and the transformation, screening and identification methods are the same as the above.

2.5 prokaryotic expression of MemUGT1 recombinant protein

2.5.1 Induction purification of recombinant proteins

(1) The strains MemUGT1-pET32a-BL21 positive clones are respectively picked and inoculated in 4mL LB culture medium containing Amp resistance, and shake culture is carried out on a constant temperature shaking table at 37 ℃ and 200rpm overnight.

(2) Inoculating the cultured bacterial liquid into 200mL Amp-resistant culture medium according to the proportion of 1:100, and culturing under the same condition until OD is reached₆₀₀Is 0.4-0.6. Adding inducer IPTG into the bacterial liquid to make the final concentration 0.5mM, culturing in a shaker at 16 ℃ and 110rpm for 18h to induce the expression of the target protein.

(3) And (4) centrifuging the bacterial liquid at 5000rpm, discarding supernatant after 5min, and collecting thalli.

(4) Adding a proper amount of Binding buffer washing liquid into a centrifugal tube according to the mass of the bacteria, whirling the bacteria to enable the bacteria to be suspended, centrifuging for 5min at 5,000rpm, collecting the bacteria, washing twice, and adding 15-20 mL of Binding buffer to suspend the bacteria.

(5) And (3) placing the bacterial liquid in an ice water mixture, carrying out ultrasonic lysis on thalli, centrifuging at 4 ℃ at 12,000rpm for 20min, collecting supernatant, carrying out column purification, and reserving part of supernatant and precipitate to prepare SDS-PAGE (sodium dodecyl sulfate polyacrylamide gel electrophoresis) so as to observe the protein expression condition.

(6) The integrated supernatant was applied to a Ni-NTA column, and after the supernatant was drained, a column volume of eluent (containing 20mM imidazole) was added to wash off the foreign proteins, and then 5mL of Elution buffer (containing 250mM imidazole) was used to collect the recombinant protein of interest. And (3) placing the eluted protein solution into an ultrafiltration tube with the protein molecule of 30,000Da specification, adding Binding buffer for liquid change and concentrating the target protein.

(7) The concentrate was pipetted into a 1.5mL collection tube, the protein concentration determined, and the sample electrophoresed.

(8) Adding 10% glycerol into protein, and storing in refrigerator at-80 deg.C.

Binding buffer: 2.42g Tris-HCl, 29.22g NaCl and 0.34g imidazole are respectively weighed, dissolved in water, adjusted to pH8.0, and added with 70 muL beta-mercaptoethanol after sterilization, and stored at 4 ℃.

Elution buffer: 2.42g Tris-HCl, 29.22g NaCl and 34g imidazole were weighed respectively, dissolved in water, adjusted to pH8.0, and made into 1000mL volume, sterilized, added with 70. mu.L beta-mercaptoethanol, and stored at 4 ℃.

2.5.2 concentration determination of protein

Protein concentration was determined using the Bradford protein concentration assay kit.

(1) The protein standard BSA was completely dissolved, and 10. mu.L of the solution was diluted with 0.9% NaCl to 100. mu.L to give a final concentration of 0.5mg/mL as a standard.

(2) The standard is added into a 96-well plate according to 0,1,2,4,8,12,16 and 20 mu L, and 0.9% NaCl is added to make up to 20 mu L. Three for each run.

(3) The remaining protein sample was diluted appropriately with 0.9% NaCl and 20. mu.L of the diluted solution was added. Each done in 3 replicates.

(4) 200 mu L G250 staining solution was added to each well and left at room temperature for 3-5 min.

(5) Determination of the light absorption at 595nm with a microplate reader (A)₅₉₅) And drawing a standard curve according to the protein concentration of the standard substance and the corresponding absorbance, and calculating the protein concentration in the sample according to the standard curve.

2.5.3 protein SDS-PAGE electrophoresis

The expression, separation and purification of the target protein were detected by denaturing Polyacrylamide Gel Electrophoresis (SDS-PAGE).

(1) And assembling the electrophoresis device, and fixing the glass plate on the rubber frame.

(2) Preparing 12% separation gel, adding into an electrophoresis apparatus, adding water, sealing, and standing until the separation gel is solidified.

(3) 5% concentrated glue is prepared, and the upper water layer is poured off. The prepared 5% concentrated glue is poured into the glass plate immediately after being mixed evenly, the hole comb is inserted between the glass plates (the generation of air bubbles is avoided), and the comb is pulled out after the gel is solidified.

(4) Adding proper amount of loading buffer into the protein supernatant and the purified protein respectively, boiling in boiling water for 5min, centrifuging at 13,000rpm for 10min, taking 10 mu L of supernatant for sample application, and absorbing 3 mu L of protein Marker for sample application.

(5) And adding a proper amount of electrophoresis buffer solution into the electrophoresis tank, carrying out electrophoresis at a constant voltage of 90V, changing the electrophoresis to 160V constant voltage electrophoresis when the sample is electrophoresed to the separation gel, and stopping electrophoresis until the bromophenol blue reaches the lower edge of the gel.

(6) Taking off the protein gel, soaking and dyeing in Coomassie brilliant blue R-250 dyeing solution, and dyeing for 4h at room temperature with gentle shaking.

(7) And (3) washing off the dyeing liquid on the surface of the protein adhesive by using distilled water, washing for 2-3 times, then placing in a decoloring liquid for decoloring for 2 hours, and replacing the decoloring liquid for several times in the decoloring process until the background of the protein adhesive is washed clean.

(8) The results of protein electrophoresis are shown in FIG. 2.

The preparation solution and proportion of SDS-PAGE separating gel and concentrated gel are as follows:

2.6 in vitro enzyme Activity function identification of proteins

2.6.1 in vitro enzyme Activity assay

MemUGT1 was used for in vitro enzyme activity function identification, and the reaction system with pET32a protein added was used as a control. The substrate is quercetin; kaempferol; myricetin; isorhamnetin; apigenin; naringenin; luteolin; chrysoeriol; genistein; farnesin; aesculetin; daidzein; scutellarein.

The enzyme activity reaction system is as follows:

mixing the above components, reacting at 30 deg.C for 30min, adding equal volume of ethyl acetate to stop reaction, extracting twice with equal volume of ethyl acetate, mixing organic phases, and volatilizing solvent. The enzyme activity was analyzed by HPLC using 100. mu.L of methanol for reconstitution. The results of the experiment are shown in FIGS. 3 and 4.

2.6.2 analysis of enzyme Activity products

To verify the in vitro enzyme activity function of MemUGT1, HPLC was used to detect the products of the enzyme activity reaction described above (fig. 3 and 4). The analysis was carried out using a ZORBAX SB-C18, 5 μm, 4.6X 150mm (Agilent) column, detection wavelengths 254nm,280nm,320nm and 346nm, a flow rate of 1.0mL/min and a sample size of 20 μ L. The liquid phase analysis conditions were as follows:

the HPLC analysis conditions were as follows:

enzyme activity product identification was performed using retention time of standards.

2.6.3 determination of optimum pH and optimum temperature

To determine the optimal pH for the catalytic activity of the recombinant MemUGT1 protein, the assay was performed at pH 5.0 to 9.5 and 0.5pH increments. The pH was controlled by MES buffer (pH 5.0-6.5), Tris-HCl buffer (pH 7.0-8.5) and NaHCO3-Na2CO3 buffer (pH 9.0-9.5). In addition, the effect of temperature on catalytic activity was determined in Tris-HCl buffer pH 7.5, where the enzyme activity was reacted for 30 minutes. The results of the experiment are shown in FIG. 5.

2.6.4 determination of kinetic parameters of the enzyme

In Tris-HCl (pH 7.5) buffer, MemUGT1 was subjected to enzyme kinetic analysis under optimum temperature conditions, and the substrate concentrations were 10, 20, 40, 50, 80, 100, 200, and 400. mu.M, respectively. The reaction was started at the time of enzyme addition, reacted for 5min, and stopped by adding an equal volume of acetonitrile, and experiments were performed in parallel for 3 times. The results are shown in Table 1.

TABLE 1

Example 3 biosynthesis of flavonol 3-O-glucoside by MemUGT1

3.1 production of Compounds Using E.coli MemUGT1-pET32a-BL21(U1)

In order to study the influence of the type of a culture medium, the concentration of a substrate and the in-vivo feeding culture time on a glucoside product, an in-vivo feeding experiment of a recombinant strain U1 is carried out by respectively using substrates of quercetin and kaempferol, and the specific experimental operation is as follows:

(1) activating the strain in a constant temperature incubator at 37 ℃, selecting and inoculating the monoclonal into 4mL of LB liquid culture medium, TB liquid culture medium and M9 liquid culture medium (containing Amp 100 mu g/mL), and continuously culturing for 7h in the incubator at 37 ℃;

(2) inoculating the target strain and the control strain into 50mL of resistant LB medium, TB medium and M9 medium at a ratio of 1:100, and culturing at 37 deg.C in a shaker at 200rpm to OD₆₀₀Adding IPTG to make the final concentration 0.5mM, and culturing at 20 deg.C for 5-7 h;

(3) adding substrates (quercetin and kaempferol) dissolved in DMSO (with a substrate concentration of 100 μ M) into the bacterial liquid, and culturing at 20 deg.C for a while;

(4) and taking 500 mu L of bacterial liquid every 12 hours, adding equal volume of ethyl acetate for extraction for 2-3 times, combining organic phases, drying the sample, adding 150 mu L of methanol for redissolving, and analyzing the product by HPLC. The results of the effect of the media type on the glycoside product are shown in FIG. 6.

(5) Then, the recombinant strain U1 was fed with IPTG concentration gradient of 25. mu.M-2000. mu.M under the condition of using the optimal culture medium, and the experimental results are shown in FIG. 7.

(6) We then performed the feeding experiment on recombinant strain U1 with a substrate concentration gradient of 50. mu.M-175. mu.M using the optimal medium and optimal IPTG concentration, as described above, and the experimental results are shown in FIG. 8.

(7) The maximum conversion after condition optimization is shown in table 2.

TABLE 2

3.2 construction of expression vector for target Gene

Gateway primer designed according to target gene MemUGT1

attB1-MemUGT1-F：GGGGACAAGTTTGTACAAAAAAGCAGGCTTAACCATGGAGGGAGAAGTTGCAGG；(SEQ ID No.7)

attB1-MemUGT1-R

GGGGACCACTTTGTACAAGAAAGCTGGGTCCTATGTACAGTTCATATCCT；(SEQ ID No.8)

The amplification was carried out using the MemUGT1-pET32a plasmid as a template, and the amplification system and conditions were as described above.

(1) The BP reaction system is as follows:

(a) taking outBP Clonase^TMPlacing the mix reagent on ice for 2min, sequentially adding the components into an EP tube according to the above reaction system, and uniformly mixing by blowing with a gun tip.

(b) The mixture was incubated at 25 ℃ for 4-6 h.

(c) After the reaction, 0.5. mu.L of protease K solution was added and mixed gently, and the mixture was placed in a 37 ℃ water bath for 10 min.

(d) The final reaction product was transformed into E.coli DH 5. alpha. and plated (with gent resistance) on LB plates and cultured at 37 ℃. The ligation transformation and the identification of positive single clones were as above.

(2) The successfully sequenced plasmid (MemUGT1-pDONR207) was subjected to LR reaction according to the following protocol:

(a) placing the mixed solution at 25 ℃, reacting for about 6 hours, then adding 0.5 mu L of protease K solution, gently mixing uniformly, reacting for 10min at 37 ℃, and stopping the reaction;

(b) after the reaction, the final reaction product was transformed into E.coli DH 5. alpha. and plated (with Kan-resistant) on LB plates and cultured at 37 ℃. The ligation transformation and the identification of positive single clones were as above. The sequencing was successful to obtain the final positive plasmid MemUGT1-pGWB 5.

3.3 transformation of Agrobacterium by Freeze thawing

(1) Taking out Agrobacterium tumefaciens competent cells GV3101 in an ultralow temperature refrigerator at minus 80 ℃, thawing on ice, taking out 2 mu L of plasmid MemUGT1-pGWB5 and pGWB5 empty vector plasmids, respectively adding the plasmids into GV3101 competent cells, softly and uniformly mixing, and then placing on ice for 25 min;

(2) rapidly refreezing with liquid nitrogen for 1min, and then water bathing at 37 deg.C for 3 min;

(3) adding 500 μ L of non-antibiotic YEP liquid culture medium, and shake culturing at 30 deg.C for 3-5 h;

(4) 200 μ L of the bacterial suspension was applied to YEP solid medium (containing 50mg/mL Kan, 100mg/mL Rif). Standing and culturing for 36h at 30 ℃;

(5) and (4) selecting the monoclonal to carry out small-amount shaking culture, identifying the positive of the monoclonal by colony PCR, and taking the positive clone to store the bacteria for later use.

YEP medium composition (1L): 10g of yeast extract, 10g of tryptone and 5g of NaCl, adding water for dissolving and fixing the volume

After agar (12g/L) was added to the solid medium, the medium was autoclaved.

3.4 Agrobacterium inflorescence dip-dyeing method for transforming Arabidopsis thaliana

Agrobacterium containing MemUGT1-pGWB5 overexpression vector is transformed into Arabidopsis by inflorescence infection method, and the method is as follows:

(1) and (3) cultivating the transformed plants: soaking soil one day in advance, dibbling arabidopsis thaliana Col-0 seeds which are vernalized for three days at 4 ℃ into flowerpots, placing four seeds in each flowerpot, and culturing in an incubator; when the arabidopsis plant just blossoms, the top end of the main branch is removed to promote the growth of lateral branches, plants which are good in growth state, have no silique (if the silique exists, the silique needs to be cut off firstly so as to avoid influencing the positive rate) and immature flowers are selected for transformation, and the plants can be watered with a little more water before infection.

(2) Activating agrobacterium: marking and activating the constructed agrobacterium containing the plant overexpression vector on a YEP solid culture medium, picking single clones to shake in 2mL YEP liquid culture medium (containing 50 mu g/mL Kan +100 mu g/mL Rif), and then performing amplification treatment according to the ratio of 1:100 is inoculated into 100mL YEP liquid culture medium and shaken, and the OD600 is measured to be approximately equal to 1.0-1.2; centrifuging to remove the culture medium, collecting the thallus, re-suspending with an appropriate amount of an infection solution, and adjusting the concentration of the thallus to ensure that OD600 is approximately equal to 0.8.

(3) Infection: placing the activated infection bacterial liquid in a big beaker, inclining a flowerpot, immersing the plant inflorescence in the bacterial liquid for 2min, and slightly rotating the flowerpot during the period to ensure that the inflorescence is completely infected by the agrobacterium. After infection, covering with black bags, culturing in dark for 24 hr, and culturing normally for 2-3 times. Then, the mixture is cultured under normal illumination until the siliques are mature and cracked, and seeds are collected.

3.5 screening and identification of transgenic Arabidopsis

The seeds of the transgenic arabidopsis obtained by the inflorescence infection method need to be screened by a culture medium containing antibiotics and verified to be positive, and the specific method comprises the following steps:

(1) sterilizing the collected seeds with 75% ethanol for 5min and anhydrous ethanol for 3min, and culturing in 1/2MS selective culture medium containing 25mg/L hygromycin under the conditions of 22 deg.C and 16h/8h photoperiod;

(2) and observing the growth condition of the seeds on the culture medium, wherein some seeds germinate normally, root leaves grow normally, and some seeds can germinate but cannot grow roots and have no true leaves. The normal growth is positive clone, the non-positive clone seeds can not grow normally on the culture medium, and the obtained positive seedlings are transplanted into soil for planting;

(3) taking a small amount of leaves of the positive plant, extracting DNA by a CTAB-DNA method to perform PCR positive verification, amplifying by two pairs of primers, namely MemUGT1-RT-F/MemUGT1-RT-R and AtActin-RT-F/AtActin-RT-R, respectively, determining the positive plant containing the target gene, and collecting seeds of the positive plant;

(4) collecting T1 transgenic plant seeds, screening on a selective culture medium, and selecting a positive seedling single plant to obtain T2 transgenic seeds;

(5) screening T2 generation seeds without segregation ratio to obtain homozygous transgenic lines for analyzing the in vivo function of the target gene.

3.6 transgenic Arabidopsis Gene expression analysis

(1) Respectively extracting RNA of the transgenic homozygote and the wild seedling by a CTAB-PVP method, wherein the extraction method is as before;

(2) MemUGT1-RT-F/MemUGT1-RT-R and an internal reference primer AtActin-RT-F/AtActin-RT-R are used for respectively detecting the transcription condition of MemUGT1 in a transgenic plant through RT-PCR, and the result proves that the exogenous gene MemUGT1 is successfully integrated into an arabidopsis genome.

3.7 chemical composition analysis of transgenic Arabidopsis

(1) Fresh transgenic Arabidopsis seedlings were collected, metabolites were extracted with a mixed solvent (80% methanol: 20% water), sonicated for 1h at 4 ℃, followed by 1,4000rpm, centrifuged for 15min, the supernatant was taken, and after filtration, 20. mu.L was taken for HPLC/LC-MS analysis.

(2) HPLC was used to analyze metabolites in transgenic arabidopsis extracts. The detection wavelength is 280-350 nm, a Luna 5u C18 (5 mu m) chromatography column (Agilent) with the size of 4.6 multiplied by 250mm is adopted for analysis, the detection wavelength is 254nm,280nm,320nm and 346nm, the flow rate is 0.8mL/min, and the sample injection amount is 20 mu L. The liquid phase analysis conditions were as follows:

the HPLC analysis conditions were as follows:

LC-MS was used for extract identification. The analytical method and analytical column are as above. The detection results are shown in FIG. 9.

Although the embodiments of the present invention have been described with reference to the accompanying drawings, it is not intended to limit the scope of the present invention, and it should be understood by those skilled in the art that various modifications and variations can be made without inventive efforts by those skilled in the art based on the technical solution of the present invention.

SEQUENCE LISTING

<110> Shandong university

<120> liverwort flavones glycosyltransferase and coding gene and application thereof

<130>

<160> 8

<170> PatentIn version 3.3

<210> 1

<211> 488

<212> PRT

<213> MemUGT1 protein

<400> 1

Met Glu Gly Glu Val Ala Gly Leu Arg Ile Ser Thr Asp Asp Leu Lys

1 5 10 15

Asn Ile Gln Thr Lys His Val His Leu Leu Val Ile Pro Leu Cys Ile

20 25 30

Lys Ala Ile Ser His Val Ser Ala Cys Phe Leu Leu Ala Val Lys Leu

35 40 45

Ala Lys Gln Gly Ile Thr Val Thr Phe Leu Thr Val Glu Asp Thr Leu

50 55 60

Ser Tyr Ile His Ser Gln Arg Ser Pro Glu Glu Leu Gln Ser Leu Gly

65 70 75 80

Ile Arg Leu Ala Ile Val Glu Tyr Asp Glu Ser Leu Leu Leu Gln His

85 90 95

Pro Glu Trp Ser Pro Pro Val Arg Leu Ser Trp Val Leu Glu Arg Ala

100 105 110

Val Gln Pro Tyr Phe Lys Lys Phe Ala Leu Asp Arg Ala Ser Gly Val

115 120 125

Ala Asp Gln Pro Thr Cys Ile Met Ala Asp Phe Phe Cys Tyr Trp Ala

130 135 140

Gln Thr Arg Ala Glu Glu Leu Asn Leu Pro Asn Tyr Val Phe Tyr Pro

145 150 155 160

Ser Gly Ala Asn Leu Ala Arg Leu His Ala Ala Phe Pro Thr Leu Val

165 170 175

Ser Glu Gly Lys Val Glu Val Ser Ala Asp Asp Lys Val Ile Val Thr

180 185 190

Asn Ala Ile Val Ser Val Pro Gly Leu Pro Pro Leu Pro Ser Gly Glu

195 200 205

Leu Pro Lys Ser Leu Arg Gln Gly Pro Val Ser Glu Ala Leu Asn Leu

210 215 220

Ala His Glu Leu Val Lys Ala Thr Gly Ile Ile Ile Asn Thr Phe Tyr

225 230 235 240

Glu Phe Glu Tyr Thr Ala Ile Glu Pro Phe Met Ala Ala Cys Asp Ser

245 250 255

Lys Met Lys Val Pro Lys Leu Phe Pro Ile Gly Pro Leu Ala Ser Ala

260 265 270

Gln Thr Val Thr Val Pro Thr Gly Arg Gln Thr Glu Glu Cys Met Glu

275 280 285

Trp Leu Asp Ser Gln Pro Ala Ser Ser Val Ile Tyr Ile Cys Phe Gly

290 295 300

Ser Lys Ser Asn Trp Thr Ala Gln Ile Val His Glu Leu Ala Leu Ala

305 310 315 320

Leu Glu Ala Ser Asn Tyr Arg Phe Leu Trp Val Leu Asn Gln Lys Gly

325 330 335

Phe Asp Phe Thr Ser Leu Ala Glu Val Leu Pro Ala Gln Phe Gln Ala

340 345 350

Arg Val Gly Glu Arg Gly Arg Ile Ala Thr Phe Trp Val Pro Gln Val

355 360 365

Lys Val Leu Leu His Arg Ala Val Ser Cys Phe Met Ser His Cys Gly

370 375 380

Trp Asn Ser Ile Met Glu Ser Val Thr Ser Gly Val Pro Met Leu Cys

385 390 395 400

Trp Pro Arg Gln Ala Glu Gln His Leu Asn Cys Arg His Ile Val Asp

405 410 415

Met Val Gln Ala Gly Val Gln Ile Ile Val Gly Asp Asp Gly Ala Ala

420 425 430

Lys Gln Gln Glu Ile Glu Arg Ala Leu Ser Ile Met Met Asp Glu Glu

435 440 445

Asp Gly Lys Ser Ile Arg Lys Arg Met Gln Asp Leu Lys Met Lys Ala

450 455 460

Ala Ala Ala Ala Ala Pro Gly Gly Ser Ser Ser Leu Ala Phe Gln Asp

465 470 475 480

Leu Val Glu Asp Met Asn Cys Thr

485

<210> 2

<211> 1467

<212> DNA

<213> MemUGT 1-encoding gene

<400> 2

atggagggag aagttgcagg cctccgcatt tcgactgacg atctcaagaa catccaaacg 60

aagcatgtcc acctgctggt aatcccattg tgtataaagg ccatttctca cgtttctgcg 120

tgttttttgc tggctgtgaa gctcgcaaag cagggcatca ccgtcacctt cctcacggtg 180

gaagatactc tgtcgtacat ccactcgcag cgttcacccg aagagctgca aagcctgggc 240

atccgtttgg ccattgtgga atacgatgaa tctctgctac tgcaacatcc tgaatggtcc 300

ccgccagttc gtctctcgtg ggtgctggag cgagctgtcc aaccgtactt caaaaagttt 360

gctctcgacc gagcttcagg agttgccgat caacccacat gcatcatggc agatttcttc 420

tgttattggg cccagacacg agccgaggag ttgaatctac caaactatgt attttatccc 480

agtggtgcaa atctggcccg tcttcatgca gcgtttccaa ctctcgtatc agaaggcaaa 540

gtagaagtgt cagcagacga caaagtcatc gtgacgaacg cgattgtcag cgtcccaggt 600

cttccacctc tacccagcgg agagctgcca aagtctttga gacaaggccc agtctcagag 660

gctctgaatt tggcgcacga actggtaaaa gcaactggaa taatcatcaa caccttctac 720

gagttcgaat atacagcaat tgaacctttc atggcggctt gcgattccaa gatgaaggtc 780

ccaaaattgt tcccaattgg accgcttgcc tcggcgcaaa ctgtaactgt cccgacaggg 840

aggcagacag aggaatgtat ggagtggctg gacagtcagc ctgcctcttc agtcatctac 900

atctgctttg gcagtaagag caactggaca gcgcaaattg tgcacgaact tgctcttgct 960

ctcgaggcga gcaactaccg gtttctgtgg gttcttaatc agaaaggttt tgattttact 1020

agtttggctg aagtgcttcc tgcacaattt caggcacgag ttggggaacg tggcaggata 1080

gctacgttct gggtacccca ggttaaggtt cttttgcatc gagctgtcag ctgtttcatg 1140

tcacattgtg gttggaactc cattatggaa agtgtaacca gtggagtgcc catgttgtgt 1200

tggccccgtc aagctgagca gcacctcaat tgcaggcaca ttgtggacat ggtgcaggcg 1260

ggtgtacaaa tcatagttgg agatgatggt gctgcaaagc aacaggaaat cgagagggca 1320

ttgagtatta tgatggacga ggaagacggg aaaagcataa ggaaacggat gcaagacctc 1380

aagatgaagg cggctgcagc tgctgcccct ggtggatctt ccagcctcgc ctttcaagat 1440

ctggtggagg atatgaactg tacatag 1467

<210> 3

<211> 20

<212> DNA

<213> Artificial sequence

<400> 3

gtatgtccgt caatctgctg 20

<210> 4

<211> 20

<212> DNA

<213> Artificial sequence

<400> 4

tcttctctac aggggataat 20

<210> 5

<211> 28

<212> DNA

<213> Artificial sequence

<400> 5

cgggatccat ggagggagaa gttgcagg 28

<210> 6

<211> 30

<212> DNA

<213> Artificial sequence

<400> 6

acgcgtcgac ctatgtacag ttcatatcct 30

<210> 7

<211> 54

<212> DNA

<213> Artificial sequence

<400> 7

ggggacaagt ttgtacaaaa aagcaggctt aaccatggag ggagaagttg cagg 54

<210> 8

<211> 50

<212> DNA

<213> Artificial sequence

<400> 8

ggggaccact ttgtacaaga aagctgggtc ctatgtacag ttcatatcct 50

Claims (11)

1. A protein MemUGT1, wherein the amino acid sequence of the protein is shown as SEQ ID No. 1.

2. A gene encoding MemUGT1 according to claim 1.

3. The gene of claim 2, wherein the nucleotide sequence of the gene is shown as SEQ ID No. 2.

4. A recombinant expression vector comprising the gene of claim 2 or 3.

5. The recombinant expression vector according to claim 4, wherein the recombinant expression vector is obtained by operably linking the encoding gene of claim 2 or 3 to an expression vector.

6. The recombinant expression vector of claim 5, wherein the expression vector is a plasmid.

7. The recombinant expression vector of claim 6, wherein the plasmid comprises pET32a and pGWB 5.

8. Use of the protein MemUGT1 according to claim 1 as a glycosyltransferase.

9. Use of the gene according to claim 2 or 3, the recombinant expression vector according to any one of claims 4 to 7 for the preparation of the protein MemUGT 1.

10. The use of the protein MemUGT1 according to claim 1 in (c1) or (c2) as follows:

(c1) catalyzing the glycosylation of flavonol compounds 3-O;

(c2) preparing flavonol glycoside compounds.

11. The use of claim 10, wherein said flavonol compounds comprise quercetin, kaempferol, isorhamnetin and myricetin.

Images