CN109517831B - Chalcone enzyme gene from anoectochilus formosanus and application thereof - Google Patents

Abstract

The invention provides a chalcone synthase gene from anoectochilus formosanus and application thereof, and relates to the technical field of genetic engineering. A chalcone synthase gene derived from anoectochilus formosanus, having a nucleotide sequence as set forth in SEQ ID No.1, an amino acid sequence as set forth in SEQ ID No.2, an amino acid sequence as set forth in SEQ ID NO: 3. The sequence is a new chalcone synthase gene sequence, can be applied to rice, and can regulate and control the content of flavonoid compounds in the rice. It has important significance for researching the synthetic route of the secondary metabolite.

Description

Chalcone enzyme gene from anoectochilus formosanus and application thereof

Technical Field

The invention relates to the field of genetic engineering, and particularly relates to a chalcone synthase gene derived from anoectochilus formosanus and application thereof.

Background

Anoectochilus formosanus (Aoectochilus roxburghii) is a perennial herb, growing in the Taiwan area, and belongs to the Anoectochilus formosanus species of the genus Anoectochilus of the family Orchidaceae. The important pharmacological active substances in anoectochilus formosanus are mainly as follows: flavonoids, steroids, triterpenes, saccharides, alkaloids, cardiac glycosides, esters, taurine, various amino acids, trace elements, inorganic elements and the like. Folk agents are called "Yaowang", "gold grass", "Shencao", "bird ginseng" and the like. Among them, polysaccharides, flavonoids, steroids, etc. in anoectochilus formosanus are considered as important active substances, and the synthesis of these substances directly affects the medicinal value of anoectochilus formosanus. The analysis of the synthetic pathway of the secondary metabolite is the premise and the basis for developing related synthetic biology research.

Chalcone synthase (CHS) is a key enzyme gene in the anabolic pathway of flavonoids. The first catalytic enzyme in the anabolic pathway of flavonoids is Phenylalanine Ammonia Lyase (PAL), which catalyzes L-Phenylalanine (L-Phenylalanine) to produce Trans-cinnamic acid (Trans-cinamic acid). trans-Cinnamic acid generated in the above reaction can be catalyzed by cinnamate 4-hydroxyenzyme (C4H) in the presence of oxygen and Nicotinamide Adenine Dinucleotide Phosphate (NADPH) to generate 4-hydroxycoumarinic acid. Then 4-hydroxycoumarin acid-coenzyme A ligase (4 CL) catalyzes the ligation to convert the 4-hydroxycoumarin acid generated in the previous step into thioesters such as 4-hydroxycoumarin-CoA, which requires ATP for energy supply. The produced 4-hydroxycoumarin-CoA can be reacted with malonyl-CoA under the action of Chalcone synthase to produce Chalcone (Chalcone). Chalcone is used as a common substrate for synthesizing 5 branches (isoflavone branch, aurone branch, flavone branch, anthocyanin branch and flavonol branch) from flavonoid compounds, and plays a role in the phenylpropanoid metabolism process. Therefore, the chalcone synthase is a key rate-limiting enzyme of the anabolism pathway of the plant flavonoids, and the activity of the chalcone synthase is closely related to the anabolism and accumulation of various flavonoids. The research on the chalcone synthase gene in the anoectochilus formosanus is the basis for researching the enrichment of specific target secondary metabolites in the anoectochilus formosanus, and has important significance.

Disclosure of Invention

The invention aims to provide a chalcone synthase gene from anoectochilus formosanus, amino acid coded by the gene, a recombinant plasmid containing the gene and application of the chalcone synthase gene, and provides a basis for anabolic research of flavonoid compounds in plants.

The technical problem to be solved by the invention is realized by adopting the following technical scheme.

A chalcone synthase gene derived from anoectochilus formosanus, wherein the nucleotide sequence of the chalcone synthase gene is shown in SEQ ID NO: 1 is shown.

Alternatively, the amino acid sequence encoded by the chalcone synthase gene is as set forth in SEQ ID NO: 2, respectively.

Alternatively, the sequence of the coding region of the chalcone synthase gene is set forth in SEQ ID NO: 3, respectively.

A recombinant plasmid containing the chalcone synthase gene.

Alternatively, the plasmid is pZZ 00026-Ubi-CHS-T-nos.

An application of the chalcone synthase gene in regulating and controlling the content of the rice flavone.

Optionally, the application as described above, includes the following steps:

s1, inserting the ORF sequence of the chalcone synthase gene of anoectochilus formosanus into a pZZ00026-Ubi-CHS-T-nos plasmid to obtain an expression vector;

s2, transforming the expression vector to agrobacterium, and then infecting and transforming the rice by using the transformed agrobacterium to obtain the transgenic rice.

Compared with the prior art, the invention has the beneficial effects that:

the chalcone synthase gene provided by the invention is obtained by cloning from anoectochilus formosanus for the first time. The flavonoid compound is a plant secondary metabolite with great application value. The chalcone synthase gene is a key rate-limiting enzyme in the anabolism pathway of flavonoids. The successful cloning of the gene provides an important basis for the variety breeding of the anoectochilus formosanus and also provides a basis for the research of transgenic plant strains enriched with flavonoids compounds. The invention obtains the Unigene sequence of anoectochilus formosanus by a transcriptome sequencing method, designs primers at two ends of the Unigene sequence, and amplifies the CDS full sequence of chalcone synthase. The CDS sequence of the target gene is obtained by the transcriptome sequencing method, and the method for amplifying the gene sequence is simple and convenient to operate. The invention can be used for carrying out gene engineering transformation on rice, and regulating and controlling the rice gene through transgenosis so as to enhance the content of flavonoid compounds in the rice. Or the gene is used for plant variety identification, screening and the like to obtain plant varieties with high flavone content and the like, and a basis is provided for enriching specific target secondary metabolites in anoectochilus formosanus. Meanwhile, the chalcone synthase gene is cloned in the anoectochilus formosanus, so that the method is the basis for researching anabolic pathway of flavonoid substances in the anoectochilus formosanus, can provide important basis for variety breeding of the anoectochilus formosanus and also provides basis for research of transgenic strains enriched with flavonoid compounds.

Drawings

In order to more clearly illustrate the technical solutions of the embodiments of the present invention, the drawings needed to be used in the embodiments will be briefly described below, it should be understood that the following drawings only illustrate some embodiments of the present invention and therefore should not be considered as limiting the scope, and for those skilled in the art, other related drawings can be obtained according to the drawings without inventive efforts.

FIG. 1 is a diagram showing the result of detection of the CDS sequence of the CHS gene of Anoectochilus roxburghii according to example 4 of the present invention by electrophoresis.

FIG. 2 is a three-level structural diagram of CHS-predicted protein of Anoectochilus formosanus provided in example 5 of the present invention.

FIG. 3 shows the CHS protein occurrence tree analysis of Anoectochilus formosanus provided in example 5 of the present invention. The red frame is the position of anoectochilus formosanus.

FIG. 4 is a diagram showing different tissue expression patterns of CHS gene of Anoectochilus formosanus in example 6 of the present invention.

FIG. 5 is a diagram showing an expression pattern of CHS gene of Anoectochilus formosanus in 24 hours at 4mg/L Phe according to example 6 of the present invention.

FIG. 6 is a diagram showing the expression pattern of CHS gene of Anoectochilus formosanus in example 6 of the present invention in 100nM NaCl over 24 h. The light color bars indicate the expression level of CHS gene in Anoectochilus formosanus, and the dark color bars indicate the expression level of Anoectochilus formosanus.

FIG. 7 is a diagram showing the expression pattern of CHS gene of Anoectochilus formosanus in 24h under 253.7nm UV stress according to example 6 of the present invention.

FIG. 8 shows the results of Tail-PCR of CHS gene promoter of Anoectochilus formosanus in example 7 of the present invention. M is marker, AD1-AD6 is the second round and the third round of fragments of the fragments amplified by six degenerate primers and specific primers.

FIG. 9 shows cis-acting elements of CHS gene promoter of Anoectochilus formosanus in example 7 of the present invention.

FIG. 10 shows a transient expression vector pC2300-35S-CHS-eGFP provided in example 8 of the present invention.

FIG. 11 shows subcellular localization of CHS protein from Anoectochilus roxburghii according to example 8 of the present invention.

FIG. 12 shows the prokaryotic expression vector pET-28a (+) -CHS provided in example 9 of the present invention.

FIG. 13 shows prokaryotic induction expression of CHS protein of Anoectochilus roxburghii provided in example 9 of the present invention.

FIG. 14 shows the purification of CHS protein from Anoectochilus roxburghii according to example 9 of the present invention.

FIG. 15 shows the determination of CHS protease activity of Anoectochilus roxburghii according to example 10 of the present invention.

FIG. 16 is a monocot overexpression vector pZZ00026-Ubi-CHS-T-nos as provided in example 11 of the present invention.

FIG. 17 is a PCR detection chart of rice having a CHS gene of Anoectochilus roxburghii according to example 11 of the present invention.

FIG. 18 shows the enrichment of total flavonoids in rice with CHS gene of Anoectochilus roxburghii according to example 11 of the present invention.

Detailed Description

In order to make the objects, technical solutions and advantages of the embodiments of the present invention clearer, the technical solutions in the embodiments of the present invention will be clearly and completely described below. The examples, in which specific conditions are not specified, were conducted under conventional conditions or conditions recommended by the manufacturer. The reagents or instruments used are not indicated by the manufacturer, and are all conventional products available commercially.

The following specifically describes embodiments of the present invention.

In each example described below, the chalcone synthase gene of anoectochilus formosanus is abbreviated as AfCHS, and the chalcone sequence derived from anoectochilus formosanus (shown as SEQ ID No. 1) and the encoded amino acid sequence thereof (shown as SEQ ID No. 2) were finally obtained through experimental examples.

Example 1

The embodiment provides total RNA extraction of anoectochilus formosanus, and the Trizol extraction kit of Dalianbao biological wired company is adopted to extract total RNA of anoectochilus formosanus leaves, and the method comprises the following steps:

(1) approximately 100mg of fresh leaves were ground to a powder in liquid nitrogen and transferred to a 1.5mL centrifuge tube, followed immediately by the addition of 1mL of RNAasso Plus, and the mixture was inverted and mixed to give a homogenate.

(2) The well-mixed homogenate was allowed to stand at room temperature for 5min and then centrifuged at 12000g at 4 ℃ for 5 min.

(3) Sucking 800ml of supernatant, transferring into a new centrifuge tube, adding 200ml of chloroform into the centrifuge tube, violently shaking and mixing until the homogenate is emulsified into milk white, and standing at room temperature for 5min to obtain a mixed solution.

(4) The mixture was centrifuged at 12000g at 4 ℃ for 15min, at which time the centrifuged homogenate was divided into three layers. From top to bottom are respectively: supernatant (containing RNA), middle white layer (mostly DNA) and lower colored organic phase.

(5) Sucking 400ml of the supernatant in the step (4) and transferring the supernatant into a new centrifuge tube without touching the middle layer. Then 400ml of isopropanol was added and mixed by inversion, and then left to stand at room temperature for 10min.

(6) The solution left standing in step (5) was centrifuged at 12000g at 4 ℃ for 10min, whereupon white flocculent RNA was observed. The supernatant was carefully discarded and 1mL of 75% ethanol was added, and the supernatant was discarded after washing the RNA upside down.

(7) After the RNA was dried at room temperature for a few minutes by opening the centrifuge cap, 30. mu.l of RNase-free water was added to dissolve the RNA.

(8) Total RNA concentration was calculated by measuring the value of A260 using a ultramicrospectrophotometer (Bio-Rad, USA), and the value of OD260/OD280 was read to estimate total RNA purity and integrity. The RNA quality was rapidly determined by electrophoresis on a 1.2% agarose gel at 135V.

Example 2

This example provides transcriptome sequencing of anoectochilus formosanus, comprising the steps of:

according to example 1The method provided extracts total RNA of leaves of anoectochilus formosanus. Detecting the RNA extraction quality and meeting the requirement of library construction (RNA concentration)>250 ng/. mu.L, total amount>20μg，OD₂₆₀/OD₂₈₀Between 1.8 and 2.2, good integrity and RIN>6.5). Then, poly (A) mRNA is enriched by magnetic beads and is broken into segment fragments, the segment fragments are used as templates, the 1 st cDNA chain and the 2 nd cDNA chain are sequentially synthesized, and a sequencing joint is connected after purification, elution, end repair and poly (A) addition. Selecting 200 bp-700 bp fragments for PCR amplification, establishing a cDNA sequencing library, and sequencing by using IIIuma HiSeq 2000. The part of the experiment is finished by the Mei-Nei science and technology service cable company.

Using short reads assembly software Trinity (v2.4.0) to carry out De novo assembly, after obtaining a Contig assembly fragment without N, using tgicl (v2.1) to carry out redundancy removal, removing sequences with low quality and uncertainty in the sequences, and reserving sequences larger than 200bp for subsequent analysis. The CDS sequence of the AfCHS gene was obtained by predicting the gene structure of the above splicing result using a transdecoder (v2.0.1).

Example 3

This example provides a first strand of anoectochilus formosanus cDNA, comprising the following steps:

using the total RNA of Anoectochilus roxburghii leaves provided in example 1 as a template, oligo (dT)18 as a Reverse transcription primer, PrimeScript Reverse Transcriptase Transcriptase (Takara China) according to SMART^TMThe PCR cDNAsynthesis Kit (Clontech USA) protocol indicates that first strand cDNA synthesis was performed. The total volume of the reaction system was 20. mu.L.

(1) Preparing a reverse transcription mixed solution 1 in a 0.2mL PE tube according to the reagents in the table 1;

(2) preparing a reverse transcription mixed solution 2 in another 0.2mL PE tube according to the reagents in the table 2;

(3) preserving the heat of the reverse transcription mixed solution 1 in the step (1) at 65 ℃ for 5min, rapidly cooling on ice for 2min, and centrifuging for several seconds to enable the mixed solution of template RNA, primers and the like to gather at the bottom of a PE tube;

(4) adding the reverse transcription mixed solution 2 prepared in the step (2) into the reverse transcription mixed solution 1 reacted in the step (3), gently mixing by using a pipette gun, and reacting for 90min at 42 ℃;

(5) and (4) preserving the temperature of the reaction solution obtained in the step (4) for 5min at 80 ℃, and cooling on ice to obtain a cDNA solution.

TABLE 1 reverse transcription Mixed solution 1 composition

TABLE 2 reverse transcription Mixed solution 2 composition

Example 4

This example provides a method for cloning AfCHS gene, comprising the steps of:

(1) primer design

On the basis of obtaining the CDS sequence of the AfCHS gene by transcriptome sequencing and splicing in example 2, primers are designed by using Primer Premier5.0 software, and the designed primers are used for analyzing the specificity of the Primer in Oligo 6.0.

The upstream primer CHSF is shown as SEQ ID NO: 4 (5'-ATGCCGAGCCTCGAATCCA-3');

the downstream primer CHSR is shown as SEQ ID NO: shown at 5 (5'-TTAAAGAGGAACGCTGCGAA-3').

(2) PCR reaction

The reaction procedure is as follows: pre-denaturation at 95 ℃ for 3 min; then, the mixture is denatured at 95 ℃ for 30s, annealed at 52 ℃ for 30s, and extended at 72 ℃ for 1min for amplification for 38 cycles. A50. mu.L system was used for PCR reactions, as shown in Table 3.

TABLE 3 PCR reaction System

*: first strand cDNA as provided in example 3 was diluted 3-10 fold.

50ul of the amplified product was subjected to 180V electrophoresis on 1% nondenaturing agarose gel for 30min, and the amplified fragment was examined by UV after staining with GoLdenView, the results are shown in FIG. 1. FIG. 1A shows open reading lesson amplification, and FIG. 1B shows gene coding region amplification, wherein M represents marker, 1 represents Fujian Anoectochilus formosanus, and 2 represents Taiwan Anoectochilus formosanus.

(3) Recovery of the fragment of interest

The specific band amplified in step (2) was quickly and accurately removed from the agarose using a clean blade under an ultraviolet lamp, and placed in a 1.5ml centrifuge tube, and the DNA fragment in the Gel was recovered using a Gel recovery Kit (E.Z.N.A.TM. Gel Extraction Kit from OMEGA).

(4) Ligation reaction

The recovered DNA fragment was cloned into the Pmd19-T vector of TaKaRa. Ligation was carried out overnight at 16 ℃ in a total volume of 10ul using a ligation kit (TaKaRa).

(5) Preparation of competent cells:

and (3) selecting a newly activated E.CoLiDH5a single colony from an LB plate, inoculating the colony in 3-5ml of an LB liquid culture medium, and carrying out shake culture at 37 ℃ and 225r/min for about 12h until the late logarithmic growth stage. The suspension was mixed with a suspension of 1: the culture medium is inoculated into 100ml LB liquid culture medium in the proportion of 10-1:50, and is cultured for 2-3h under shaking at 37 ℃ until OD600 is about 0.35-0.5.

Transferring the culture solution into a centrifuge tube, standing on ice for 10min, and centrifuging at 4 deg.C at 3000r/min for 10min.

The supernatant was discarded, and the cells were gently suspended in 10ml of a pre-cooled 0.05mol/L CaCl2 solution, allowed to stand on ice for 15-30min, and then centrifuged at 3000r/min at 4 ℃ for 10min.

The supernatant was discarded, 4ml of a pre-cooled 0.05mol/L CaCl2 solution containing 15% glycerol was added, the cells were gently suspended, and the suspension was allowed to stand on ice for several minutes to obtain a competent cell suspension.

The competent cells were divided into 100ul aliquots and stored at-70 ℃ for half a year.

(6) Transformation of plasmid DNA

Taking a tube of the E.coli competent cells DH5a in step (5), and thawing the tube on ice. Then adding 10ml of the ligation reaction solution obtained in the step (4) under the aseptic condition, shaking gently and mixing uniformly, and standing on ice for 30 min. The mixture is heated in a water bath at 42 ℃ for 90s without shaking, and then quickly placed in an ice bath for cooling for 2-3 min. Adding 890ul of LB liquid culture medium without Amp, mixing uniformly, shaking and culturing at 37 ℃ and 150r/min, and incubating for 1h to obtain the transformed bacterial liquid.

Spreading 100ul of transformed bacterial liquid on a culture plate of LB Amp, standing for 30min with the front side facing upwards, sealing with a sealing film after the bacterial liquid is completely absorbed by the culture medium, then inverting the culture dish, and culturing at 37 ℃ in the dark for 12-16 h; subsequently, positive colonies were screened.

(7) Identification and preservation of recombinant colonies

The generally white and round colonies were positive in appearance and were further characterized by PCR using bacterial suspension, as follows:

several white colonies were picked up on overnight-cultured plates with a sterilized small gun head, and seeded in 0.1g/L Amp LB liquid medium 1.5ml centrifuge tubes, respectively, and cultured at 37 ℃ for 4-6h with shaking at 150 r/min.

Taking 1uL bacterial suspension as a template, carrying out PCR amplification by using a primer CHSF/CHSR, prolonging the cracking time in the PCR reaction condition to 5min, and detecting the amplification product by using 1% non-denaturing agarose gel electrophoresis. If the product is the target band, the colony is a positive clone, otherwise, the colony is a negative clone. Meanwhile, a negative control without adding bacterial suspension is set.

750ul of colony suspension of the identified positive clone is taken, 250ul of sterilized glycerol is added, the mixture is uniformly mixed, and then the mixture is quickly frozen by liquid nitrogen and stored in a refrigerator at the temperature of 70 ℃ below zero for later use.

(8) Sequencing

And (4) sending the bacterial colony of the positive clone identified and stored in the step (7) to a Invitrogen biotechnology company for sequencing, and comparing and analyzing the obtained sequence in BLAstn of NCBI to verify that the cloned fragment is correct.

The product obtained by amplification is an AfCHS gene layer cDNA intermediate segment, and the obtained nucleotide sequence is shown as SEQ ID NO.1, the coded amino sequence is shown as SEQ ID NO.2, and the coding region sequence is shown as SEQ ID NO. 3.

Example 5

This example provides a protein bioinformatic analysis of the AfCHS gene comprising the steps of:

the physical and chemical properties of the AfCHS gene were analyzed using ProtParam (http:// web. expasy. org/ProtParam /). The total length of the gene CHS of anoectochilus formosanus is 1173bp, the sequence of a coding region is 1260bp, 1 intron with the length of 87bp is inserted between 180 bp and 267bp, and 390 amino acids are coded. 13 activation sites characteristic of CHS proteins

(G¹³⁸-G¹⁶³-G¹⁶⁷-L²¹⁴-D²¹⁷-G²⁵³-P³⁰⁵-G³⁰⁶-G³⁰⁷-G³³⁶-G³⁸⁵-P³⁸⁶-G³⁸⁷) 4 catalytic residues (Cys-His-Asp + F) and 6 conserved residues (G)³⁷⁹-V³⁸⁰-L³⁸¹-F³⁸²-G³⁸³-F³⁸⁴) Identical, only in the malonyl-CoA binding motif

(V³¹⁴-E³¹⁵-E³¹⁶-R³¹⁷-V³¹⁸-G³¹⁹-L³²⁰-K³²¹-P³²²-E³²³-K³²⁴-L³²⁵-T³²⁶-T³²⁷-S³²⁸-R³³⁰) The proximal C-terminal of (A) is different from that of phalaenopsis. In addition, 1 classical Nuclear Localization Signal (NLS) R was also found⁶⁶-K⁶⁷-R⁶⁸-H⁶⁹. The physicochemical property of CHS gene coding protein is predicted by using an online tool ProtParam provided by ExPASy Proteomics Server, and the relative molecular mass of the protein is presumed to be 42.9kDa and the isoelectric point pI is 6.04.

Secondary structure of CHS gene was predicted using GOR IV (http:// npsa-pbil. ibcp. fr/cgi-bin/npsa _ Automat. plpage ═ npsa _ gor4. html). The results of the on-line prediction of secondary structure showed that the Alpha-helix (Alpha helix) accounted for 32.82% of the total amino acids, the Extended strand (Extended strand) accounted for 20.51% of all amino acids, and the Random coil (Random coil) accounted for 46.67% of the total amino acids.

The FPS gene of Anoectochilus formosanus was predicted for protein tertiary structure by SWISS-MODEL (https:// swisssmall. expasy. org /), plotted by PyMOL Viewer, and the three-dimensional MODEL is shown in FIG. 2.

Finally, the CHS amino acid sequence of the plant with higher homology is found, the alignment of the amino acid sequence is carried out by utilizing the ClustalW method, and the Neighbor-join phylogenetic tree is constructed by MEGA7.0 and is shown in figure 3. Wherein, the box in fig. 3 is marked as the position of anoectochilus formosanus.

Example 6

This example provides an endogenous expression assay for the AfCHS gene comprising the steps of:

(1) material treatment

1.1 ultraviolet irradiation treatment:

transplanting the tissue culture seedlings of the anoectochilus formosanus cultured for 4 months into a flowerpot filled with nutrient soil (nutrient soil: vermiculite: 3:1), and culturing at the temperature of 25 ℃ (day)/20 ℃ (night), with the relative humidity of 60-70% and the illumination of 200 mu mol/m²S (14 h)/dark (10 h). Adapting to 3-5 days, taking root, stem and leaf samples from untreated seedlings with uniform growth vigor, and quickly freezing the samples at-70 ℃ by liquid nitrogen for storage. And (5) carrying out ultraviolet irradiation treatment on the rest seedlings with uniform growth.

The treatment conditions were: placing potted anoectochilus formosanus in an ultraviolet incubator, and respectively treating for 0h, 0.5h, 1h, 2h, 4h, 8h, 12h and 24h by using ultraviolet radiation with the wavelength of 253.7 nm.

Each treatment was repeated 3 times, and samples were immediately taken at each treatment time point and snap frozen in liquid nitrogen at-70 ℃ for storage.

1.2 Red light irradiation treatment:

transplanting the tissue culture seedlings of the anoectochilus formosanus cultured for 4 months into a flowerpot filled with nutrient soil (nutrient soil: vermiculite: 3:1), and culturing at the temperature of 25 ℃ (day)/20 ℃ (night), with the relative humidity of 60-70% and the illumination of 200 mu mol/m²S (14 h)/dark (10 h). Adapting to 3-5 days, taking root, stem and leaf samples from untreated seedlings with uniform growth vigor, and quickly freezing the samples at-70 ℃ by liquid nitrogen for storage. And (5) carrying out infrared light irradiation treatment on the rest seedlings with uniform growth.

The treatment conditions were: placing potted anoectochilus formosanus in a red light incubator, and treating for 0h, 0.5h, 1h, 2h, 4h, 8h and 12h respectively at the red light wavelength of 650 nm.

Each treatment was repeated 3 times, and samples were immediately taken at each treatment time point and snap frozen in liquid nitrogen at-70 ℃ for storage.

1.3 salt stress treatment:

transplanting the tissue culture seedlings of the anoectochilus formosanus cultured for 4 months onto a plastic foam plate with holes, culturing for 3-5 days by using Hoagland nutrient solution, and selecting the seedlings with uniform growth vigor for salt stress treatment. Salt stress treatment is as follows: adding NaCl into the Hoagland nutrient solution to a final concentration of 100mmol/L, and respectively treating for 0h, 0.5h, 1h, 2h, 4h, 8h, 12h and 24 h. Each treatment was repeated 3 times, and samples were immediately taken at each treatment time point and snap frozen in liquid nitrogen at-70 ℃ for storage.

1.4 phenylalanine treatment:

transplanting the tissue culture seedlings of the anoectochilus formosanus cultured for 4 months onto a plastic foam plate with holes, culturing for 3-5 days by using Hoagland nutrient solution, and selecting the seedlings with uniform growth vigor for phenylalanine treatment. The phenylalanine treatment is as follows: adding phenylalanine into Hoagland nutrient solution to a final concentration of 4mg/L, and treating for 0h, 0.5h, 1h, 2h, 4h, 8h, 12h and 24h respectively. Each treatment was repeated 3 times, and samples were immediately taken at each treatment time point and snap frozen in liquid nitrogen at-70 ℃ for storage.

(2) RNA extraction

Leaves of the 4 stress-treated and control seedlings were respectively subjected to liquid nitrogen quick-freezing and grinding, and then total RNA extraction kit Trizol (TaKaRa, Dalian) was used to extract total RNA. The procedure is as in example 1.

(3) First Strand cDNA Synthesis

Using the extracted RNA as a template, adding sample according to a system in a table 4, reacting for 2min at 42 ℃, removing possible genome DNA (gDNA), adding sample according to a system in a table 5 by using a PrimeScript RT reagent Kit with gDNA Eraser Kit (TaKaRa, Dalian), bathing for 30min at 37 ℃, keeping 5s at 85 ℃ to terminate the reaction so as to synthesize cDNA by reverse transcription, and storing at-20 ℃ for later use.

TABLE 4 gDNA removal reaction System

TABLE 5 cDNA Synthesis System

(4) Specific detection of qRT-PCR primers

The cDNA sample is diluted 3 times for 0h and then used as a template for qRT-PCR reaction, and qRT-PCR reaction is carried out at 50-65 ℃ to determine the optimal annealing temperature, and a 20 mu L reaction system shown in Table 6 is adopted. The qRT-PCR primer sequences are shown in Table 7.

TABLE 6 qRT-PCR reaction System

TABLE 7 qRT-PCR primer sequences

The reaction tube used 0.2mL PCR plate after siliconization. qRT-PCR at iQ^TM5thermal cycler (Bio-Rad USA). The reaction procedure is as follows: pre-denaturation at 95 ℃ for 10 s; then, the procedure of denaturation at 95 ℃ for 10s, annealing at 50-65 ℃ for 20s, and extension at 72 ℃ for 20s, and collecting fluorescence at this temperature, Plate reading (Plate read) was performed for 46 cycles. Thereafter, starting from 50 ℃ the temperature was increased to 95 ℃ with a temperature gradient of 0.5 ℃ per step, and the temperature was maintained for 5s per step.

(5) qRT-PCR reaction

The reverse transcribed cDNA samples of the different samples in step (3) of this example were diluted twice and used as a template for qRT-PCR amplification, and a siliconized 0.2mL PCR plate was used as a reaction tube, a 20. mu.L reaction system was used (Table 6), and ddH was set up₂O is a negative control for the template. A single reverse transcribed cDNA sample was made in triplicate.

The qRT-PCR reaction program was: pre-denaturation at 95 ℃ for 10s, followed by annealing at 95 ℃ for 10s, annealing at the optimal annealing temperature for 20s, extension at 72 ℃ for 20s, and collection of fluorescence at this temperature, Plate reading (Plate read) was performed for 46 cycles. Then finally, starting at 50 ℃ and increasing the temperature to 95 ℃ at a rate of 0.5 ℃ per step, the melting curve is plotted for 5s per temperature.

(6) qRT-PCR data analysis

The experiment adopts a double-standard curve method to carry out relative quantification on the expression level of key enzyme genes in the pathway of the metabolism and synthesis of flavone. The relative expression level of the Gene was calculated by the Delta-CT (normalized Gene expression) method.

The expression differences between the 0h control and treatment and between treatments were analyzed using SPSS (version10.0inc. chicago, IL) statistical analysis software. Two levels of differential significance were established, P0.05 and P0.01. FIG. 4 shows the expression pattern of CHS gene of Anoectochilus formosanus in different tissues.

FIG. 5 is a graph showing the expression pattern of the CHS gene of Anoectochilus formosanus in 24 hours at 4mg/L phenylalanine (dark columns indicate the CHS gene of Anoectochilus formosanus), and the difference between the expression levels at 4 hours and 8 hours is very significant compared with 0 hour. FIG. 6 is a graph showing the expression pattern of the CHS gene of Anoectochilus formosanus in 24 hours under 100mmol/L NaCl, and the difference between the expression levels at 8 hours, 12 hours and 24 hours is very significant compared with 0 hour. FIG. 7 is a graph of expression pattern of the CHS gene of Anoectochilus formosanus under 253.7nm ultraviolet stress for 24h, and the difference between the expression levels of the CHS gene of Anoectochilus formosanus at 0.5h, 1h, 2h, 4h, 8h, 12h and 24h is very significant compared with 0 h.

Example 7

The present embodiment provides a method for amplifying a promoter sequence of AfCHS gene of anoectochilus formosanus, comprising the following steps:

(1) nested specific primers SP1, SP2 and SP3 shown in Table 8 were designed and synthesized within 300bp of the transcription initiation site based on the AfCHS gene sequence, and degenerate primers for Thermal asymmetric staggered PCR (TAIL-PCR) shown in Table 9 were synthesized.

TABLE 8 nested specific primers for TAIL-PCR amplification

TABLE 9 degenerate primers for TAIL-PCR amplification

Note that S ═ G/C, W ═ a/T, and N ═ a/T/C/G.

(2) The extracted genomic DNA of Anoectochilus formosanus was diluted and used as a template, each degenerate primer was sequentially matched with specific primers SPC1, SPC2 and SPC3, the samples were added to the reaction system shown in Table 10, and 3 rounds of amplification by TAIL-PCR were performed according to the temperature cycle program shown in Table 14.

TABLE 10 TAIL-PCR reaction System

TABLE 11 temperature cycling for TAIL-PCR amplification

(3) The third round of amplified products was separated by 2% non-denaturing agarose gel electrophoresis, and the results are shown in FIG. 8. In FIG. 8, M is marker, and AD1-AD6 are the second and third rounds of fragments amplified by the six degenerate primers and specific primers. Recovering the specific fragment amplified by the purified degenerate primer AD 3.

(4) The nucleotide sequence of the recovered specific fragment was analyzed, and the promoter sequence of the amplified material of Anoectochilus formosanus was analyzed using Plant CARE software (http:// bioinformatics. psb. element. be/western tools/plantare/html /), and the cis-acting element was predicted, as shown in FIG. 9.

Example 8

This example provides subcellular localization of AfCHS protein of Anoectochilus formosanus including the following steps:

(1) construction of transient expression vectors:

1.1 according to the ORF sequence of CHS Gene of Anoectochilus formosanus, restriction sites and protected bases required for transient expression vector construction were added to the 5' and 3' ends of the gene, and as shown in FIG. 10, specific primers [ 5' -TCCCGGG (sma I) ] not containing a stop codon were designed using Premier5.0 software

ATGCCGAGCCTCGAATCCA-3′/5′-CGCGGATCC(BamH I)

AAGAGGAACGCTGCGAA-3′]。

1.2 Using pDM19-T plasmid having CHS gene ORF inserted therein as a template, the reaction system of Table 4 was applied and PCR amplification was carried out. The PCR temperature cycle system program is set as follows: 94 ℃ for 3 min; amplification is circulated for 38 times at 98 ℃ for 10s, 62 ℃ for 30s and 72 ℃ for 60 s; finally, extension is carried out for 5min at 72 ℃.

1.3 the amplification products were separated by electrophoresis on a 1% non-denaturing agarose gel,

the purified fragment was recovered using a gel recovery kit (Tiangen, Beijing) by imaging with a ChemiDocTM XRS type gel imaging system (Bio-Rad, USA).

1.4 the reaction system in Table 12 was loaded and digested with fast-cutting enzyme at 30 ℃ for 0.5 h. The digested product was separated by electrophoresis on 1.2% agarose gel, and recovered and purified using a gel recovery kit (Tiangen, Beijing).

TABLE 12 fragment Sma I/BamHI double digestion reaction system

1.5 samples were loaded according to the reaction system of Table 13, and the purified duplex products were recovered by ligation with T4DNA ligase and ligated for 8h at 16 ℃.

TABLE 13 ligation reaction System

1.6 the ligation products were transformed by heat shock transformation and recombinant colonies were identified by PCR.

1.7 extracting the plasmid DNA in the steps, carrying out double enzyme digestion identification on corresponding fast cutting enzymes Sma I and BamH I, taking a small amount of plasmid to carry out sequencing by bioengineering (Shanghai) corporation Limited, and verifying that the vector is constructed correctly.

(2) Transient expression vectors were detected in onion bulb epidermal cells.

2.1 taking the 5th layer scale of the fresh onion bulb, cutting into 2cm multiplied by 2cm squares, taking the inner epidermis, laying the inner epidermis on 1/2MS plates, and culturing for 4h at 25 ℃.

2.2 weigh 60mg of gold powder (diameter 60 μm) and place in a 1.5mL centrifuge tube, add 1mL 70% ethanol to the centrifuge tube containing the gold powder, shake vigorously on vortex for 15min, centrifuge at 1300g for 1min at room temperature, remove the supernatant from the centrifuge tube, and repeat the procedure three times. Finally, sterile water is added, and the mixture is stored at the temperature of minus 20 ℃ for standby.

2.3 put 5. mu.L of gold powder suspension into a 1.5mL inlet centrifuge tube, add 1. mu.L transient expression vector DNA (1.0. mu.g/. mu.L), 8. mu.L autoclaved 2.5mol/L CaCl ₂4. mu.L of 0.1mol/L spermidine which has been sterilized by suction filtration, mixed, shaken vigorously on a vortex shaker for 3min, and left to stand in an ice bath for 15 min.

2.4 at 1200g speed, room temperature, instant centrifugation for 10 seconds, taking and abandoning the supernatant, adding 100u L analysis pure concentration of absolute ethanol, in vortex oscillator vibration heavy suspension gold powder.

2.5 at 12000g, under room temperature conditions, instantaneous centrifugation for 10s, removing the supernatant, adding 15 u L analysis of pure concentration of absolute ethanol, vortex oscillator vibration heavy suspension, making the liquid uniform.

2.6 Gene gun A PDS-1000/He type Gene gun (Bio-Rad, USA) was used under the conditions: the sample chamber was at a vacuum of 26in Hg and a burst pressure of 1100psi at a target distance of 6 cm. And (3) taking 10 mu L of the suspension liquid to be evenly spotted on the central area of the transformation slide, and uniformly injecting gold powder which wraps the transient expression vector in the central area of the transformation slide into cultured onion bulb endothelial cells under the conditions.

2.7 the medium containing the transformed onion inner epidermis was wrapped in a black plastic bag and cultured at 25 ℃.

2.8 after culturing for 16 to 24 hours, the onion epidermis on the medium was sliced and photographed under a BX63 type fluorescence microscope (Olimpas, Japan). The results are shown in FIG. 11, with subcellular localization in the nucleus. In which FIG. 11A shows the subcellular localization of pC 2300-35S-eGFP, and FIG. 11B shows the subcellular localization of pC 2300-35S-CHS-eGFP.

Example 9

This example provides a prokaryotic expression method of CHS protein, comprising the following steps:

(1) prokaryotic expression vector construction

1.1 according to the ORF sequence of CHS gene, adding restriction enzyme cutting sites and protection bases required by construction of prokaryotic expression vector pET28a (+) -CHS (figure 12) at the 5 'and 3' ends, using Premier5.0 software to design specific primers, [5 '-CGGGATCC (BamHI) ATGCCGAGCCTCGAATCCA-3'/5 '-CCAAGCTT (Hind III) TTAAAGAGGAACGCTGCGAA-3' ].

1.2 Using pDM19-T plasmid inserted with the CHS gene ORF as a template, the reaction system in Table 4 was applied and PCR amplification was carried out. The temperature cycling program was: 3min at 94 ℃; circulating for 36 times at 98 deg.C for 10s, 62 deg.C for 30s, and 72 deg.C for 90 s; 5min at 72 ℃.

1.3 the amplification product is separated on a 1% non-denaturing agarose gel,

the purified fragment was recovered using a gel recovery kit (Tiangen, Beijing) by imaging with a ChemiDocTM XRS type gel imaging system (Bio-Rad, USA).

1.4 the reaction system in Table 12 was loaded and digested with fast-cutting enzyme at 30 ℃ for 0.5 h. The digested product was separated by electrophoresis on 1.2% agarose gel, and recovered and purified using a gel recovery kit (Tiangen, Beijing).

1.5 the reaction system according to Table 13 was loaded, the purified double enzyme product was recovered by ligation with T4DNA ligase and ligated for at least 8h at 16 ℃.

1.6 the ligation products were transformed by heat shock transformation and recombinant colonies were identified by PCR.

1.7 extracting the plasmid DNA in the steps, after double enzyme cutting identification by corresponding fast cutting enzymes BamH I and Hind III, taking a small amount of plasmid, sending the plasmid to a company Limited in bioengineering (Shanghai) for sequencing, and verifying that the vector is constructed correctly.

(2) Prokaryotic expression:

2.1 the constructed prokaryotic expression vector pET28a (+) -CHS is transformed into BL21 competent cells by a heat shock transformation method, and inoculated into an LB plate (containing 100mg/L kanamycin), a monoclonal in an LB solid medium plate is selected to have positive PCR detection of bacterial liquid, and then inoculated into an LB liquid medium (containing 100mg/L kanamycin) and cultured at 150g under the condition of 37 ℃ for overnight shaking.

2.2 the culture broth was diluted at a ratio of 1:100, inoculated into LB liquid medium (containing 100mg/L kanamycin), and cultured at 150g at 37 ℃ to an OD of about 0.6.

2.3 taking 20mL of culture solution, adding 20 μ L of 1mmol/L Isopropyl thiogalactoside (IPTG), and carrying out induction expression for 2h under the induction condition of 38 ℃.

2.4 at 8000g, at room temperature, centrifuging for 10min to collect thalli, resuspending with 1/25 volumes of binding buffer [25mmol/L Tris-HCl (pH 8.0), 0.5mol/L NaCl, 5mmol/L imidazole ], placing the tube into a conical flask with ice-water mixture, crushing for 40min with ultrasonic homogenizer, and changing the ice-water mixture every 20 min. A part of the bacterial solution was centrifuged at 14000g at room temperature for 2min, the supernatant was discarded, and the precipitate was collected, separated by 12% Sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) using the pre-induced bacteria as a control, and stained with Coomassie Brilliant blue, as shown in FIG. 13. In FIG. 13, CHS proteins of Anoectochilus formosanus and Anoectochilus fujianensis were induced to be expressed. M represents marker, 1 represents that pET-28a (+) -CHS of Anoectochilus formosanus CHS is not induced, 2 represents that pET-28a (+) -CHS of Anoectochilus formosanus CHS is not induced, 3 represents that pET-28a (+) -CHS of Anoectochilus formosanus CHS is induced, and 4 represents that pET-28a (+) -CHS of Anoectochilus formosanus CHS is induced.

2.5 protein purification: the Ni-NTA pre-column is equilibrated with a binding buffer, the liquid obtained in step 1.4 is taken, the liquid is washed with a washing buffer [ (25mmol/L Tris-HCl (pH 8.0), 0.5mol/L NaCl, 20mmol/L imidazole ] after loading, the target protein is eluted and collected with an elution buffer containing 25mmol/L Tris-HCl (pH 8.0), 0.5mol/L NaCl, 600mmol/L imidazole, 12% SDS-PAGE is separated, and Coomassie brilliant blue is stained, and the result is shown in FIG. 14, wherein M represents marker, 1 represents purified protein of Taiwan anoectochilus formosanus, 2 represents purified protein of Taiwan anoectochilus formosanus, 3 represents purified protein of Fujian anoectochilus formosanus CHS, and 4 represents purified protein of Fujian anoectochilus formosanus CHS, and both purified protein of Taiwan anoectochilus formosanus CHS are purified.

2.6 washing the PD-10 column with displacement buffer (phosphate buffer containing 10% glycerol).

Example 10

This example provides a method for detecting the activity of CHS enzymes in an ultrasonically disrupted bacterial suspension and a purified protein:

the detection by using a plant CHS enzyme activity detection kit (ABRaxis, USA) and a spectrophotometer comprises the following specific steps:

(1) the spectrophotometer (UV752) was turned on and a 100. mu.L cuvette was used, the wavelength was 412nm, the readings were taken every 5 minutes for 7 times (30 minutes total), and zeroed.

(2) Mixing 205 mu L of buffer solution and 25 mu L of substrate solution in a centrifuge tube; after 3min of warm bath at 30 ℃, 20 mu L of protein of a sample to be detected (200 mu g) is added, poured and mixed evenly, and detected by a spectrophotometer to be used as a blank control (30 minutes to 0 minute).

(3) Mixing 185 μ L buffer solution, 20 μ L reaction solution and 25 μ L substrate solution in a centrifuge tube; after 3min of warm bath at the temperature of 30 ℃, 20 mu L of protein of a sample to be detected (200 mu g) is added, poured and mixed evenly, and the sample reading is detected by a spectrophotometer (30 minutes to 0 minute).

(4) mu.L of the obligate solution and 20. mu.L of the protein of the sample to be tested (200. mu.g) are taken and incubated for 15min at 30 ℃.

(5) Uniformly mixing 165 mu L of buffer solution, 20 mu L of reaction solution and 25 mu L of substrate solution in a centrifuge tube; and (3) after 3min of warm bath at the temperature of 30 ℃, adding 40 mu L of the liquid in the step (3), pouring and mixing uniformly, and detecting a sample reading by a spectrophotometer (30 minutes to 0 minute).

(6) The relative values of enzyme activity between samples were calculated as shown in FIG. 15. FIG. 15A shows in vivo enzyme activity, and FIG. 15B shows in vitro enzyme activity. The jewel orchid Taiwan and the jewel orchid CHS have the same function domain of the translation protein, but the enzyme activity in vivo and the enzyme activity in vitro are different.

Example 11

This example provides heterologous expression of the CHS gene in rice, comprising the steps of:

(1) according to the ORF sequence of CHS gene, Premier5.0 software is used to design specific primers, and monocot over-expression vector pZZ00026-Ubi-CHS-T-nos (FIG. 16) is added at its 5' -end to construct the required restriction sites and protection bases [ 5' -TCCCGGG (sma I) ATGCCGAGCCTCGAATCCA-3 '/5 ' -CGCGGATCC(Bam HI) AAGAGGAACGCTGCGAA-3' ].

(2) Using the pDM19-T plasmid having the CHS gene ORF inserted therein as a template, samples were added to the reaction system shown in Table 4, and PCR amplification was carried out. The temperature cycling program was: pre-denaturation at 94 ℃ for 3 min; the temperature is 10s at 98 ℃, 30s at 62 ℃ and 60s at 72 ℃, and the three temperatures are cycled for 38 times; extension at 72 ℃ for 5 min.

(3) Separating the amplified product by using 1% non-denaturing agarose gel electrophoresis,

the purified fragment was recovered using a gel recovery kit (Tiangen, Beijing) by imaging with a ChemiDocTM XRS type gel imaging system (Bio-Rad, USA).

(4) The reaction system was loaded as in Table 12 and digested with fast-cutting enzyme at 30 ℃ for 0.5 h. The digested product was separated by electrophoresis on 1.2% agarose gel, and recovered and purified using a gel recovery kit (Tiangen, Beijing).

(5) The reaction system of Table 13 was loaded, and the purified duplex products were recovered by ligation using T4DNA ligase and ligated for at least 8h at 16 ℃.

(6) The ligation products were transformed by heat shock transformation and recombinant colonies were identified by PCR.

(7) Extracting the plasmid DNA in the steps, performing double enzyme digestion identification by corresponding fast cutting enzymes BamH I and Hind III, taking a small amount of plasmid, sending the plasmid to a company Limited in Biotechnology (Shanghai) for sequencing, and verifying that the vector is constructed correctly.

(8) The Taiwan anoectochilus formosanus CHS gene ORF monocotyledon over-expression vector pZZ00026-Ubi-CHS-T-nos, and Agrobacterium (Agrobacterium tumefaciens) EHA105 strain were transformed by heat shock method.

(9) And (3) carrying out glume removal and disinfection on the medium flower 11 rice seeds, then inoculating the medium flower 11 rice seeds to an improved N6 culture medium, and inducing callus.

(10) After subculture, selecting embryogenic callus, and transferring to a pre-culture medium for dark culture for about 3 d.

(11) Transferring the callus to co-culture medium, adding 100mL of activated Agrobacterium suspension, dark culturing at 19 deg.C for 3d, and adding sterile ddH₂Washing with O for 3 times, adding sterilized distilled water containing 400mg/mL Thiosporamycin (Cephalothin), and shaking at 200g for 30 min.

(12) Transferring the co-cultured callus to a screening culture medium, and culturing in the dark for about 20 days at the temperature of 28 ℃.

(13) Transferring the callus on the screening culture medium to a differentiation culture medium, and culturing the callus in light at 28 ℃ until seedlings are differentiated.

(14) Transferring the differentiated callus on rooting culture medium, culturing at 28 deg.C under illumination, hardening seedling for 7d, and transplanting in greenhouse or field.

Example 11

This example provides the method for verifying the PCR of the CHS transgenic rice of example 10, comprising the following steps:

(1) taking the regenerated seedling foot leaves, and extracting genome DNA.

(2) Specific primers (5'-GCTCACCCTGTTGTTTGGTG-3'/5'-AAGAGGAACGCTGCGAAGAA-3') were designed using Primeblast software (https:// blast. ncbi. nlm. nih. gov/blast. cgi) and a 1205bp fragment spanning the promoter was amplified.

(3) 1.2% native agarose gel electrophoresis separation,

positive transgenic plants were screened from regenerated plants by imaging with a ChemiDocTM XRS type gel imaging system (Bio-Rad, USA). KnotAs shown in fig. 17. In FIG. 17, F represents the CHS gene of Roxburgh Anoectochilus formosanus, R represents the CHS gene of Fujian Anoectochilus formosanus, and + represents a positive plasmid, and-represents a non-transgenic line. The CHS genes of anoectochilus formosanus and anoectochilus fujiangensis are transferred into the rice genome.

Example 12

The embodiment provides a method for detecting the content of total flavonoids in transgenic rice, which comprises the following steps:

(1) weighing the rice leaves of CHS gene of anoectochilus formosanus, drying and grinding 1.000g of powdery sample into 20mL of conical flask, and repeating for 3 times.

(2) Adding 10mL of 95% ethanol, extracting at 30 deg.C for 30min in KQ-100DV type ultrasonic instrument (ultrasonic instruments, Inc. of Kunshan), filtering with 3 μm filter paper, and collecting filtrate.

(3) Adding ethanol with the same concentration into the residue, performing ultrasonic extraction again according to the step (2), filtering with 3 μm filter paper, collecting filtrate, and combining the filtrate with the filtrate in the step (2).

(4) 2mL of each of the above filtrates (2 mL of 95% ethanol as a blank control) were taken, 31 mL of 100g/L Al (NO3) and 1mL of 9.8g/L potassium acetate were added, and the mixture was shaken well and allowed to stand for 30 min.

(5) The absorbance at 415nm was determined on a UV-1800 UV-visible spectrophotometer (Shimadzu, Japan) using a 1cm cuvette. The results are shown in FIG. 18. The CHS gene of anoectochilus formosanus is transferred into rice, and the change of the CHS gene of anoectochilus formosanus on the flavone content of the rice is different from that of the CHS gene of anoectochilus formosanus transferred into the rice. In fig. 18, F indicates the rotamasum formosanum roxburgh CHS gene, R indicates the trans-fujian roxburgh CHS gene (R-1 and R-2 represent two independent transformation events obtained by trans-fujian roxburgh CHS gene, respectively), indicates that the difference is significant, and indicates that the difference is extremely significant.

The embodiments described above are some, but not all embodiments of the invention. The detailed description of the embodiments of the present invention is not intended to limit the scope of the invention as claimed, but is merely representative of selected embodiments of the invention. All other embodiments, which can be derived by a person skilled in the art from the embodiments given herein without making any creative effort, shall fall within the protection scope of the present invention.

SEQUENCE LISTING

<110> Sanming academy of academic

<120> chalcone synthase gene sequence derived from anoectochilus formosanus and application thereof

<130> 1182628

<160> 3

<170> PatentIn version 3.5

<210> 1

<211> 1173

<212> DNA

<213> Anoectochilus formosanus

<400> 1

atgccgagcc tcgaatccat ccggaaggcg cccagagccg acggcttggc ctccatattg 60

gccatcggca gggccaatcc tgaaaacttc atggaacaaa gcaacttccc tgatttcttc 120

ttccgcgtca ccggcagcga ccacttggtc gacctcaaga agaaattcca acgcatatgc 180

gataggacgg caatcaggaa acgccatttt gtctggaacg aagagttcat caaagccaac 240

ccttgcttca gtaccttcat ggacaactct ttaaacgtca gacaagaggt agcgataagg 300

gagataccga agttgggtgc agaggcagcc accaaggcca tcaaggagtg ggggcagccc 360

aagtcaagca tcacccatct catcttttgc accaccagcg gcatggattt gcctggtgct 420

gactaccagc tcactcgaat tctaggcctc aacccgaacg tcgagagggt gatgctctac 480

cagcaaggat gttttgctgg cggaaccacg ctccggctag ccaagtgtct tgcagagagc 540

cgcaaaggcg cacgtgttct tatcgtttgt gcagagacca ccacagtgct cttccgcgca 600

ccctctgagg agcaccaaga ggaccttgtc actcaagctc tgtttgcgga tggcgcctcg 660

gcagttatag taggtgccga cccgaatgag gatgccaatg aacgtgccag ctttgtcatc 720

ttctccacat cacaggtatt attgccagac tctgaaggtg caattggcgg gcatgtatca 780

gagggaggcc tcttagccac gctccacagg gacgtcccac aacttgtttc caagaatgtc 840

gaaaaatgct tagaagaggc gttcactcct ttaggcattt cggactggaa ctccatcttt 900

tgggtgccgc acccaggtgg gcgtgccatt ctagaccaaa tcgaggagag ggtggggctg 960

aagccggaga aactaaccac ttccaggcac gtgcttgctg agtacggtaa catgtcaagc 1020

gtgtgtgtgc actttgttct ggatgagatg cgcaagaagt cttcaaaaga aggtaaagct 1080

acgacaggtg agggcctcga gtggggagtg ctcttcggat tcgggcctgg cctgactgtc 1140

gaaactgtag ttcttcgcag cgttcctctt taa 1173

<210> 2

<211> 390

<212> PRT

<213> Anoectochilus formosanus

<400> 2

Met Pro Ser Leu Glu Ser Ile Arg Lys Ala Pro Arg Ala Asp Gly Leu

1 5 10 15

Ala Ser Ile Leu Ala Ile Gly Arg Ala Asn Pro Glu Asn Phe Met Glu

20 25 30

Gln Ser Asn Phe Pro Asp Phe Phe Phe Arg Val Thr Gly Ser Asp His

35 40 45

Leu Val Asp Leu Lys Lys Lys Phe Gln Arg Ile Cys Asp Arg Thr Ala

50 55 60

Ile Arg Lys Arg His Phe Val Trp Asn Glu Glu Phe Ile Lys Ala Asn

65 70 75 80

Pro Cys Phe Ser Thr Phe Met Asp Asn Ser Leu Asn Val Arg Gln Glu

85 90 95

Val Ala Ile Arg Glu Ile Pro Lys Leu Gly Ala Glu Ala Ala Thr Lys

100 105 110

Ala Ile Lys Glu Trp Gly Gln Pro Lys Ser Ser Ile Thr His Leu Ile

115 120 125

Phe Cys Thr Thr Ser Gly Met Asp Leu Pro Gly Ala Asp Tyr Gln Leu

130 135 140

Thr Arg Ile Leu Gly Leu Asn Pro Asn Val Glu Arg Val Met Leu Tyr

145 150 155 160

Gln Gln Gly Cys Phe Ala Gly Gly Thr Thr Leu Arg Leu Ala Lys Cys

165 170 175

Leu Ala Glu Ser Arg Lys Gly Ala Arg Val Leu Ile Val Cys Ala Glu

180 185 190

Thr Thr Thr Val Leu Phe Arg Ala Pro Ser Glu Glu His Gln Glu Asp

195 200 205

Leu Val Thr Gln Ala Leu Phe Ala Asp Gly Ala Ser Ala Val Ile Val

210 215 220

Gly Ala Asp Pro Asn Glu Asp Ala Asn Glu Arg Ala Ser Phe Val Ile

225 230 235 240

Phe Ser Thr Ser Gln Val Leu Leu Pro Asp Ser Glu Gly Ala Ile Gly

245 250 255

Gly His Val Ser Glu Gly Gly Leu Leu Ala Thr Leu His Arg Asp Val

260 265 270

Pro Gln Leu Val Ser Lys Asn Val Glu Lys Cys Leu Glu Glu Ala Phe

275 280 285

Thr Pro Leu Gly Ile Ser Asp Trp Asn Ser Ile Phe Trp Val Pro His

290 295 300

Pro Gly Gly Arg Ala Ile Leu Asp Gln Ile Glu Glu Arg Val Gly Leu

305 310 315 320

Lys Pro Glu Lys Leu Thr Thr Ser Arg His Val Leu Ala Glu Tyr Gly

325 330 335

Asn Met Ser Ser Val Cys Val His Phe Val Leu Asp Glu Met Arg Lys

340 345 350

Lys Ser Ser Lys Glu Gly Lys Ala Thr Thr Gly Glu Gly Leu Glu Trp

355 360 365

Gly Val Leu Phe Gly Phe Gly Pro Gly Leu Thr Val Glu Thr Val Val

370 375 380

Leu Arg Ser Val Pro Leu

385 390

<210> 3

<211> 1256

<212> DNA

<213> Anoectochilus formosanus

<400> 3

atgccgagcc tcgaatccat ccggaaggcg cccagagccg acggcttggc ctccatattg 60

gccatcggca gggccaatcc tgaaaacttc atggaacaaa gcaacttccc tgatttcttc 120

ttccgcgtca ccggcagcga ccacttggtc gacctcaaga agaaattcca acgcatatgc 180

aagccgccct cgctctctcc ctgtactctc tcccttttag caaagctatg aacaaagatt 240

ggaattgata tataatcatc tgcgatagga cggcaatcag gaaacgccat tttgtctgga 300

acgaagagtt catcaaagcc aacccttgct tcagtacctt catggacaac tctttaaacg 360

tcagacaaga ggtagcgata agggagatac cgaagttggg tgcagaggca gccaccaagg 420

ccatcaagga gtgggggcag cccaagtcaa gcatcaccca tctcatcttt tgcaccacca 480

gcggcatgga tttgcctggt gctgactacc agctcactcg aattctaggc ctcaacccga 540

acgtcgagag ggtgatgctc taccagcaag gatgttttgc tggcggaacc acgctccggc 600

tagccaagtg tcttgcagag agccgcaaag gcgcacgtgt tcttatcgtt tgtgcagaga 660

ccaccacagt gctcttccgc gcaccctctg aggagcacca agaggacctt gtcactcaag 720

ctctgtttgc ggatggcgcc tcggcagtta tagtaggtgc cgacccgaat gaggatgcca 780

atgaacgtgc cagctttgtc atcttctcca catcacaggt attattgcca gactctgaag 840

gtgcaattgg cgggcatgta tcagagggag gcctcttagc cacgctccac agggacgtcc 900

cacaacttgt ttccaagaat gtcgaaaaat gcttagaaga ggcgttcact cctttaggca 960

tttcggactg gaactccatc ttttgggtgc cgcacccagg tgggcgtgcc attctagacc 1020

aaatcgagga gagggtgggg ctgaagccgg agaaactaac cacttccagg cacgtgcttg 1080

ctgagtacgg taacatgtca agcgtgtgtg tgcactttgt tctggatgag atgcgcaaga 1140

agtcttcaaa agaaggtaaa gctacgacag gtgagggcct cgagtgggga gtgctcttcg 1200

gattcgggcc tggcctgact gtcgaaactg tagttcttcg cagcgttcct ctttaa 1256

<210> 4

<211> 19

<212> DNA

<213> Artificial sequence

<400> 4

atgccgagcc tcgaatcca 19

<210> 5

<211> 19

<212> DNA

<213> Artificial sequence

<400> 5

ttaaaagggaacgctgcgaa 19

Claims (5)

1. A chalcone synthase gene derived from anoectochilus formosanus, wherein the nucleotide sequence of the chalcone synthase gene is shown as SEQ ID NO: 1 is shown.

2. A recombinant plasmid containing the chalcone synthase gene according to claim 1.

3. The recombinant plasmid of claim 2 wherein said plasmid is pZZ00026-Ubi-CHS-T-nos。

4. Use of the chalcone synthase gene according to claim 1 for regulating the content of rice flavonoids.

5. Use according to claim 4, characterized in that it comprises the following steps:

s1, the ORF sequence of chalcone synthase gene of Anoectochilus formosanus was inserted into pZZ00026-Ubi-CHS-T-nosObtaining an expression vector from the monocotyledon overexpression vector;

s2, transforming the expression vector to agrobacterium, and then infecting and transforming the rice by using the transformed agrobacterium to obtain the transgenic rice.

Images