CN113789312A - Eggplant E3 ubiquitin ligase gene SmDDA1b and application thereof in improving bacterial wilt resistance - Google Patents

Abstract

The invention belongs to the technical field of molecular biology, and discloses an eggplant E3 ubiquitin ligase gene SmDDA1b and application thereof in improving bacterial wilt resistance. The research aims to provide theoretical reference for the molecular mechanism of eggplant bacterial wilt resistance.

Description

Eggplant E3 ubiquitin ligase gene SmDDA1b and application thereof in improving bacterial wilt resistance

Technical Field

The invention belongs to the technical field of molecular biology, and particularly relates to an eggplant E3 ubiquitin ligase gene SmDDA1b and application thereof in improving bacterial wilt resistance.

Background

Eggplant (Solanum melongena L.) is an annual or perennial vegetable crop of the genus Solanum (Solanum L.) of the family Solanaceae, originating in india and in the southwest region of china. Is a summer vegetable widely cultivated in Asia, Mediterranean, Central Europe and southeast Europe. Eggplant is rich in nutrition, has protein, fat, carbohydrate and various trace elements, is rich in vitamin P and solanine, has the effects of protecting heart and cerebral vessels, resisting aging and the like, can be eaten by vegetables and fruits, can be used as medicines for roots, stems and leaves, and can be used as anesthetic for leaves.

However, eggplants are susceptible to disease attack, especially bacterial wilt, which can cause the quality of the eggplants to be reduced and the yield to be greatly reduced. When eggplant suffers from bacterial wilt, the yield is reduced by 20-30% generally, and can reach 50-60% in severe cases. The current situation of great economic loss and difficult treatment caused by bacterial wilt seriously threatens the production and development of solanaceae plants. Researches show that the cultivars of many solanaceae crops do not resist bacterial wilt, and the disease-resistant cultivars of eggplant which do not resist bacterial wilt in production are mostly semi-cultivars or wild species. At present, the disease resistance inheritance of solanaceae bacterial wilt is reported in various ways, and the current report has no definite theory.

The currently verified eggplant bacterial wilt resistance related genes are few, the eggplant bacterial wilt resistance relates to multiple factors, and the molecular mechanism is complex and is not clear yet. Xiao et al verify that the RE-bw gene of eggplant is an important gene for resisting bacterial wilt and can interact with the avirulent effector Popp2 of ralstonia solanacearum. The shouxin research finds that the eggplant ERF transcription factor SmERF participates in the bacterial wilt resistance process, and SmERF66 and SmERF88 related to the bacterial wilt resistance of the eggplant are obtained. Plum and the like verify that the eggplant EDS1 gene has positive regulation and control effect on bacterial wilt resistance through a gene silencing (VIGS) technology. Meanwhile, Chen and the like perform functional identification analysis on eggplant SmNAC transcription factors to obtain SmNAC negative regulation eggplant bacterial wilt resistance. Qiu and other researches show that exospermidine (Spd) can obviously improve the resistance of eggplant to bacterial wilt, and the R2R3-MYB transcription factor SmMYB44 can be directly combined with a promoter of a spermidine synthase gene SPDS and enhance the expression of the spermidine synthase gene SPDS, so that the synthesis of spermidine is promoted.

Ubiquitin (Ubiquitin, Ub) was first discovered in calf thymus and is a conserved low molecular weight (8.5kDa) protein, consisting of 76 amino acids, ubiquitous in eukaryotes. Ubiquitin is involved in almost all aspects of eukaryotes, including growth development and immune regulation. The Ubiquitin/26S Proteasome System (UPS) is a conserved System for dominating ubiquitination, and consists of 5 basic parts of Ubiquitin, Ubiquitin activating enzyme (E1), Ubiquitin conjugated enzyme (E2), Ubiquitin ligase (E3) and 26S Proteasome, wherein the central component is Ubiquitin molecule, and Ubiquitin is combined with target protein through interaction of E1, E2 and E3, thereby changing protein composition to regulate and control functions of eukaryotes. In the ubiquitin system, the gene number of E3 ligase is relatively high and has an important role in recognizing substrate specificity.

Unlike the E1 activating and E2 binding enzymes, the E3 ligase is abundant and diverse. According to the current report, the E3 ligase is mainly divided into three families, HECT E3s, RING E3s and RBR E3s, according to the structural feature domain and the action mechanism of transferring ubiquitin to target protein. Among these, the RING type family is the largest and contains a zinc binding domain or U-box binding domain called RING. Structurally, the RING domain and the U-box domain are similar, but the U-box domain transfers ubiquitin from E2 to the target protein mainly through salt bridges, ionic chelation, and hydrogen bonding. While the RING domain transfers ubiquitin mainly through the formation of covalent bonds by chelation of 8 amino acids with zinc ions. CRLs (cullin-RING-ligases) are multi-subunit complexes, and are the largest family in the RING-type family, which are composed mainly of cullin proteins, RING proteins, substrate receptors, and Adaptor proteins. The cullin protein is used as a core scaffold, the RING protein is anchored at the C end, the N end interacts with an Adaptor of the CRL, and the Adaptor helps the CRL to connect with a substrate receptor. Ubiquitination modification post-translationally modifies the covalent linkage to NEDD8 by conformationally activating CRLs, altering the Cullin-RING interface, to activate ligase activity.

Researches show that the E3 ligase not only regulates the growth and development of plants, but also plays an important role in the stress resistance of the plants. In Arabidopsis, MIEL1 is a RING-type E3 ligase and is a negative regulator of defense responses. StPUB17 is a known target protein of E3s StPOB1 as E3 ligase and is proved to positively regulate plant diseases such as late blight, and recent research shows that a degradation substrate of StPUB17 is RNA binding protein StKH17, the gene negatively regulates plant immunity, and StKH17 function needs to be performed in combination with RNA. UPS may also participate in stress responses as a positive regulator. In tobacco, E3 ligase NbUbE3R1 positively regulates immune response, and VIGS, Y2H and co-IP experiments show that the replicase of BaMV is a possible substrate of NbUbE3R 1. Desaki et al found that E3 ubiquitin ligase PUB4, which positively regulates plant immune response, can interact with LysM receptor-like kinase CERK 1.

In addition, the E3 ligase mediates a variety of plant signaling pathways in plants, including hormones and the like. Hana et al have shown that apple U-box E3s MdPUB29 enhances plant resistance to Phyllostachys malorum (Botryosphaeria dothidea) by modulating the SA pathway. In apple, BTB-BACK domain E3s MdPOB1 regulates apple H by degrading MdPUB29₂O₂Content, relative expression level of SA related gene and signal gene thereof. TIR1 is a substrate recognition subunit of SCFTIR1 ligase, and can perform protein degradation on a transcription inhibitor of Aux/IAA protein. The SA pathway signal gene NPR1 may be a ubiquitination substrate of CUL3, and the two indirectly interact through an adaptor protein. In arabidopsis, E3 ubiquitin ligase atrarre can negatively regulate ABA signaling.

E3 ubiquitin ligase is present in UPS and plays an important role in the protein degradation pathway of plant cells, and many studies indicate that E3 ligase plays a role in plant disease resistance. Eggplant is an important economic crop, is easily damaged by bacterial wilt, seriously influences the economic value of the eggplant, has more researches on the bacterial wilt resistance of the eggplant, but has almost no report on the bacterial wilt resistance of the E3 ubiquitin ligase, so that the research on the resistance of the E3 ubiquitin ligase gene to the bacterial wilt resistance of the eggplant can provide theoretical reference and breeding value for the bacterial wilt resistance of the eggplant.

Disclosure of Invention

The technical problem to be solved by the invention is to overcome the problems in the prior art, and the eggplant E3 ubiquitin ligase gene SmDDA1b is provided firstly.

The second purpose of the invention is to provide the application of eggplant E3 ubiquitin ligase gene SmDDA1 b.

The third purpose of the invention is to provide a method for improving the bacterial wilt resistance of eggplants.

The purpose of the invention is realized by the following technical scheme:

eggplant E3 ubiquitin ligase gene SmDDA1b, the nucleotide sequence of which is shown as SEQ ID NO: 1, and the coded amino acid sequence is shown as SEQ ID NO: 2, respectively. The ORF of SmDDA1b is 504bp, 167 amino acids, 18.27kDa, has a DDA1 structural domain and belongs to the main component of the DDB type E3 ubiquitin ligase of CRL.

The invention also provides biological materials containing the gene SmDDA1b, wherein the biological materials include but are not limited to vectors, plasmids, host cells and plants.

In the research, 417bp bases of the N-terminal NAM-containing domain of the eggplant bacterial wilt-resistant negative regulation transcription factor SmNAC are used as baits in the subject group, and an eggplant cDNA library is screened to obtain an E3 ubiquitin ligase gene SmDDA1b, and the function verification is carried out. Experiments such as VIGS and the like preliminarily screen the E3 ubiquitin ligase gene SmDDA1b which has the most obvious result and is not subjected to functional verification before, and then the overexpression experiments are carried out on the E3 ubiquitin ligase gene SmDDA1b, so that the E3 ubiquitin ligase gene is verified to have positive regulation and control effects on bacterial wilt resistance of plants, and is presumed to be an important gene of eggplant for resisting bacterial wilt.

Therefore, the invention also provides application of the eggplant E3 ubiquitin ligase gene SmDDA1b in developing and screening functional products of eggplant with resistance to bacterial wilt.

Preferably, the functional product has a function of up-regulating the expression, transcription or an expression product thereof of the SmDDA1b gene.

More preferably, the functional product is selected from one or two of a substance for promoting SmDDA1b gene expression and an SmDDA1b gene overexpression gene recombination construct.

From the results of hormone treatment experiments, VIGS, measurement of overexpressed hormone signaling pathway gene expression and overexpressed SA content, SmDDA1b is positively regulated by the SA pathway and the JA pathway in defense reactions against eggplant bacterial wilt, and also can target the signaling pathway genes of SA and JA, and therefore, preferably, expression of SmDDA1b gene is positively regulated by the SA pathway.

The invention also provides a method for improving the bacterial wilt resistance of eggplants, which comprises the following steps:

s1, constructing an overexpression vector taking the SmDDA1b gene as a target gene;

s2, transforming the constructed over-expression vector into eggplant;

and S3, screening to obtain the positive transgenic eggplant.

Compared with the prior art, the invention has the following beneficial effects:

the invention utilizes eggplant negative regulation transcription factor SmNAC as bait, screens E3 ubiquitin ligase gene SmDDA1b from cDNA library and carries out functional verification, and the result shows that eggplant E3 ligase gene SmDDA1b positively regulates eggplant bacterial wilt resistance. The research aims to provide theoretical reference for the molecular mechanism of eggplant bacterial wilt resistance.

Drawings

FIG. 1 shows the results of the acquisition of eggplant E3 ubiquitin ligase gene SmDDA1b, phylogenetic analysis, tissue specificity analysis, subcellular localization and the results of ralstonia solanacearum inoculation and hormone treatment; (A) Y2H results of SmNAC and SmDDA1b, BD-53 cotransforming with AD-T Y2H-Gold is a positive control, BD-Lam and AD-T cotransforming with Y2H-Gold is a negative control; (B) phylogenetic analysis results of E3 ubiquitin ligase gene SmDDA1 b; phylogenetic tree analysis of homologous protein sequences of SmDDA1b and SmDDA1b in other different families, marking the homologous protein sequences with different colors, wherein the protein sequences are obtained from NCBI, the number on the branch represents the support degree, the larger the value is, the higher the reliability is, and the highest value is 100; (C) the relative expression of SmDDA1b in the root, stem part 1, stem part 2 and leaf of eggplant E31 and E32; error bars indicate standard deviations of 3 biological replicates, "x" indicates that the p-value of both data was less than 0.05 and greater than 0.01, with significant differences, "x" indicates that the p-value of both data was less than 0.01, with very significant differences; (D) the diagram is a schematic diagram of a tissue part of an eggplant seedling, namely a schematic diagram of a leaf, an upper part of a stem, a lower part of the stem and a root, and a white scale in the diagram indicates a length of 5 cm; (E) e31 and E32 are inoculated with ralstonia solanacearum and then subjected to SmDDA1b relative expression condition analysis within 24h, the sampling time is 0h, 1h, 3h, 6h, 12h and 24h after ralstonia solanacearum inoculation, error lines indicate standard deviations of 3 biological repetitions, multiple comparison results among data are indicated by adopting an alphabetical notation method (p is less than 0.05), and the final result is indicated as the relative expression amount of a treatment group gene relative to a control group gene; (F) relative expression of SmDDA1b in 24h after the treatment of E31 by SA and MeJA, sampling time is 0h, 1h, 3h, 6h, 12h and 24h after the treatment of hormones respectively, error bars represent standard deviation of 3 biological replicates, multiple comparison results among data are represented by a letter mark method (p is less than 0.05), and final results are represented by relative expression of genes of a treatment group relative to genes of a control group; (G) subcellular localization results for SmDDA1 b. The subcellular localization material is Nicotiana benthamiana, Bright represents the tobacco Bright field of a fluorescence microscope, GFP represents green fluorescence emitted by cell nucleus or cell membrane, etc., the gene is expressed at subcellular level, NLS represents red fluorescence emitted by cell nucleus, and Merge represents the combination of the three as reference; the red scale of Bright and merge and the white scale of GFP and NLS plots each represent a length of 1 mm; (H) BiFC results from SmDDA1b and SmNAC indicate that the material is tobacco; the proteasome inhibitor MG132 is injected after co-injection of YNE-SmDDA1b and YCE-SmNAC Agrobacterium; the red and white scales in the YFP, NLS, Bright and Merge plots all represent lengths of 1 mm;

FIG. 2 shows the SmDDA1b gene sequence and amino acid sequence; (A) the SmDDA1b gene sequence has the total length of SmDDA1b of 504bp, comprises a DDA1 domain and an SAP domain and is marked by red and blue green respectively; (B) the amino acid sequence of SmDDA1b, 76 amino acids in full length, and the structural domain comprising DDA1 and SAP, labeled with red and blue-green, respectively;

FIG. 3 shows the detection of disease resistance to bacterial wilt for E31 and E32; (A) e32 phenotype at day 0 and day 10 after inoculation with Ralstonia solanacearum; (B) e31 inoculation with Ralstonia solanacearum on day 0 and day 10 phenotype E31; inoculating 81 strains E31 and 73 strains E32 respectively by using ralstonia solanacearum GMI 1000; the results show that E32 shows obvious wilting phenotype and E31 has no obvious change after 10 days of inoculation; statistics of morbidity and disease index show that the morbidity of E32 is 89.04%, the disease index is 47.6, and the E32 belongs to susceptible materials; the morbidity of E31 is 11.11%, the disease index is 2.78, and the E31 belongs to a high-resistance material; the size of the plug tray is 5 multiplied by 10, and the total number of the holes is 50;

FIG. 4 shows the VIGS experiment result of E31 ubiquitin ligase gene SmDDA1 b; (A) after silencing the SmDDA1b gene of E31, control plants (plants injected with pTRV2 and pTRV1 agrobacterium fluid only) and treated plants (plants injected with pTRV2-SmDDA1b and pTRV1 agrobacterium fluid) were analyzed for relative expression of the SmDDA1b gene; error bars represent standard deviations of three or more biological replicates. P-values below 0.01 are considered to have very significant differences, denoted by; (B) after 4 weeks of ralstonia solanacearum inoculation, counting disease indexes of the control strain and the treated strain after E31 treatment; disease grades are classified into grade 0, grade 1, grade 2, grade 3 and grade 4, grade 0 is plant disease-free, grade 1 is plant 1-2 leaf wilting, grade 2 is plant 3-4 leaf wilting, grade 3 is all leaf wilting except top leaves, grade 4 is plant death, ordinate represents the percentage of the number of plants of each disease grade in the total number, and 10E 31 are silenced in the experiment. P-values below 0.01 are considered to be very significantly different, indicated by (C) the E31-VIGS phenotype of control and treated plants changed 4 weeks after inoculation with ralstonia solanacearum, indicated by a length of 5cm on the white scale;

FIG. 5 shows the results of experiments for overexpression of SmDDA1b in tomato; (A) at the DNA level, carrying out bar gene verification on a tomato single strain obtained by tissue culture; (B) on the RNA level, the relative expression of the SmDDA1b gene of individual tomato lines obtained by tissue culture was analyzed. P<0.05, denoted by x, p<0.01, denoted by x; (C) wild type tomato seedlings (WT) and transgenic tomato seedlings (OET)₁) Phenotype of day 7 after inoculation of ralstonia solanacearum, including front, near and top views; (D) phenotype of wild tomato seedlings and transgenic tomato seedlings 14 days after inoculation of ralstonia solanacearum, wherein CK represents wild tomato seedlings and transgenic tomato seedlings which are not inoculated with ralstonia solanacearum and are cultured simultaneously under the same conditions; (E) incidence statistics of wild type tomato seedlings and over-expressed tomato seedlings inoculated for 14 days, wherein OET_1-12，OET_1-17And OET_1-31-2Respectively, over-expressed individual strain, OET₁Represents the average incidence of 3 overexpression lines; (F) disease index statistical chart of wild type tomato seedlings and overexpression tomato seedlings inoculated for 14 days, wherein OET_1-12，OET_1-17And OET_1-31-2Respectively, over-expressed individual strain, OET₁Represents the average disease index of 3 overexpression lines; (G) SA content determination results of wild tomato seedlings inoculated and not inoculated with ralstonia solanacearum and tomato seedlings over-expressing SmDDA1 b; the significant difference is marked by a letter method;

FIG. 6 is an analysis of expression of SA pathway signal genes in VIGS and overexpression; (A) analysis results of SA pathway signal gene expression in VIGS plants, wherein pTRV2 represents a control plant, and p-SmDDA1b represents a VIGS-treated plant pTRV2-SmDDA1 b; (B) analyzing the expression condition of SA pathway signal genes in the over-expressed plants, wherein OET0 represents a T0 generation tomato over-expressed plant, and WT represents a wild plant; values of P-value above 0.01 and below 0.05 are considered to have significant differences, indicated by x, and values of P-value below 0.01 are considered to have very significant differences, indicated by x. Dots of different colors represent different biological replicates and dots of the same color represent technical replicates.

Detailed Description

The following further describes the embodiments of the present invention. It should be noted that the description of the embodiments is provided to help understanding of the present invention, but the present invention is not limited thereto. In addition, the technical features involved in the embodiments of the present invention described below may be combined with each other as long as they do not conflict with each other.

The test methods used in the following examples and experimental examples are conventional methods unless otherwise specified; the materials, reagents and the like used, unless otherwise specified, are commercially available reagents and materials; the equipment used, unless otherwise specified, is conventional laboratory equipment.

Plant material: eggplant high bacterial wilt resistance inbred line "E31" (R) and eggplant high bacterial wilt resistance inbred line "E32" (S) of professor Caobihao, university of agriculture (Guangdong, Guangzhou) in south China were used as eggplant materials (FIG. 2, Table 4). The tomato material is a Money marker variety provided by the Qieukun teacher of southern China agricultural university (Guangdong, Guangzhou), and the variety is a material which does not resist bacterial wilt. Tobacco was Nicotiana benthamiana and was provided by this group of subjects. Eggplant cDNA library was provided by this group of subjects.

Example 1 cloning of the SmDDA1b Gene

RNA extraction, reverse transcription of cDNA and RT-qPCR data analysis reference Qiu, etc. (2019), relative expression quantity

And

calculation method (primers refer to table 1). Another 14 sequenced whole genome dicotyledonous plants were selected uniformly from phylogenetic trees (table 2), and all protein sequences from each species were downloaded from the NCBI, with only the longest remaining for different variable spliceosomes belonging to the same gene. Hidden markov model files of DDA1 were downloaded from the PFAM database and hmmsearch v3.3 was used to extract protein sequences containing DDA1 per species. The obtained protein sequence was subjected to multiple sequence alignment with two protein sequences of eggplant containing DDA1 using mafft v7.455, and a phylogenetic tree was constructed using iqtree v 1.6.12. hmmsearch uses the "- -cut _ nc" to limit the result, iqtree uses the "-bb" parameter to calculate the bootstrap value, and in addition, default parameters are used. Phylogenetic trees were drawn using iTOL.

For all protein sequences comprising DDA1, the domains possessed by these sequences were scanned and mapped using ggplot2, aligned to the Pfam-a database. Combining the phylogenetic tree and domain maps, it was found that, as early as before the appearance of dicotyledonous plants, DDA1 was divided into two distinct genes, one containing DDA1 only, and the other, the branch in which SmDDA1b is located, containing both DDA1 and SAP domains. The latter is of major interest in this study, and the branch is then extracted to obtain the phylogenetic tree in the article.

TABLE 1 primers used for qRT-PCR analysis

SmDDA1b homologous Gene accession numbers for Table 214 dicotyledonous plants

As a result: the research in the subject group previously obtains the negative regulation transcription factor SmNAC for resisting bacterial wilt of eggplant, 139 amino acids of the N end of the negative regulation transcription factor SmNAC containing the NAM structural domain of the eggplant are constructed in a pGBKT7 vector to be used as bait protein, and an eggplant cDNA library is screened to obtain an E3 ubiquitin ligase gene SmDDA1b (figure 1A). The ORF of SmDDA1b is 504bp, 167 amino acids, 18.27kDa, has a DDA1 structural domain and belongs to the main component of the DDB type E3 ubiquitin ligase of CRL. In Arabidopsis thaliana, DDA1 gene (Q9FFS4) has been studied, which forms protein complexes with Cul4, DDB1, COP10 and DET1, binds Ub on E2 to abscisic acid (ABA) receptor protein PYL8, completing the ubiquitination process. In addition, DDA1 is a conserved essential component in the evolution of the CRL4 core complex, and it can directly interact with DDB1 to facilitate substrate supplementation or regulate the overall topology of the CRL4 substrate complex. At the same time, SmDDA1b also has an SAP domain, which is also more conserved, SAP being thought to be involved in substrate recognition and activity of ligases and is common in many SUMO E3. Phylogenetic analysis (figure 1B) of SmDDA1B revealed that, in 15 dicotyledonous plants, the homologous protein of SmDDA1B contained DDA1 and SAP domains, indicating that the domains are conserved in dicotyledonous plants and may play an important role in the evolution of plant survival. It is noted that there are only two genes containing the DDA1 domain, one containing only the DDA1 domain and the other containing the DDA1 and SAP domains (fig. 2).

Example 2 SmDDA1b functional exploration

First, tissue specificity analysis

Respectively taking roots, stems and leaves of E31 and E32 of 4-5 true leaves for tissue specificity analysis, extracting RNA, reverse transcribing cDNA and performing RT-qPCR, wherein the relative expression adopts

And (4) a calculation method.

Two, subcellular localization

A target gene fragment with a homologous arm (5 'end primer: ctgcccaaattcgcgaccggtATGGAGGATACCTCATCATCCATT; 3' end primer: gcccttgctcaccataccggtTGTGTCCCCCCTTAACCGTG) is connected to an Age I single-enzyme digested pEAQ-EGFP vector by a one-step cloning method, and is screened by a large intestine (DH5 alpha) heat shock method and transferred into a GV3101(pSoup) agrobacterium strain. Streaking the constructed Agrobacterium with a nuclear localization NLS (Sun et al, 2020) Agrobacterium, picking up a single colony at 28 deg.C, shaking initially at 200rpm, shaking widely, centrifuging the Agrobacterium liquid at 6000rpm, removing the supernatant, and treating with an invasion solution (10mM MgCL)₂10mM MES and 100 mu M AS), standing and activating for 2h at 28 ℃, mixing an infection solution containing target gene agrobacterium with an infection solution containing nuclear localization agrobacterium according to the volume ratio of 1:1, injecting the infection solution into tobacco by a head-removed injector to ensure that tobacco leaves are water-soaked, and then placing the tobacco leaves in dark for culturing for 2-3 days at 22 ℃. GFP fluorescence was visualized using fluorescence microscopy. The experiment was repeated at least three times.

Third, double molecule fluorescence complementation experiment (BiFC)

A target gene and a gene to be verified are respectively constructed on pSPYNE-35S/pUC-SPYNE (YNE) and pSPYCE-35S/pUC-SPYCE (YCE) vectors (5 '-end restriction enzyme is BamH I, 3' -end is Sal I) by a one-step cloning method to form recombinant vectors, and the recombinant vectors are transferred into a GV3101(pSoup) agrobacterium strain. Marking out constructed agrobacterium and nuclear localization NLS agrobacterium, picking up a single colony at 28 ℃, shaking initially at 200rpm, shaking widely, centrifuging agrobacterium liquid at 6000rpm, removing supernatant, re-suspending the thallus by using an infection liquid (10mM MgCL2, 10mM MES, 100 mu M AS), adjusting OD600 to 0.6, standing and activating at 28 ℃ for 2h, mixing the infection liquid containing YNE-target gene agrobacterium, YCE-target gene agrobacterium and the infection liquid containing nuclear localization agrobacterium according to the volume ratio of 1:1:1, injecting the infection liquid into tobacco by using a head-removed injector to enable tobacco leaves to be water-soaked, and then placing the tobacco leaves in dark at 22 ℃ for 3-4 days. GFP fluorescence was visualized using fluorescence microscopy. The experiment was repeated at least three times.

TABLE 3 summary of BiFC Experimental primers

As a result: the full length of the SmDDA1b gene is cloned from E31, and whether the gene has the function of resisting bacterial wilt of eggplants or not is verified. The root, stem and leaf of eggplant disease-resistant material E31 and disease-susceptible material E32 (figure 3) are used as materials for tissue specificity analysis. The results show that the SmDDA1b gene is expressed in roots, stems and leaves of disease-resistant materials and susceptible materials, the expression level in leaves is the largest, and the expression level of the SmDDA1b gene in the disease-resistant materials is generally higher than that of the susceptible materials (FIGS. 1C-D). It was then sub-cellularly mapped to determine its expression region at the sub-cellular level, indicating that pEAQ-EGFP-SmDDA1b fluoresces only in the nucleus, that SmDDA1b is expressed in the nucleus (fig. 1G), and that BiFC results indicate that SmNAC can interact with SmDDA1b in plant cell nuclei.

Inoculation of Ralstonia solanacearum

The ralstonia solanacearum strain is GMI1000, provided by southern China university of agriculture (Guangdong, Guangzhou). The inoculation method adopts a conventional 'root-cutting and root-irrigating method', and the disease index is divided into 5 grades (0 grade is no disease of the plant, 1 grade is 1-2 leaf wilting, 2 grade is 3-4 leaf wilting, 3 grade is top leaf removing, the rest leaves are wilting, and 4 grade is plant death). E31 and E32 are cut off roots, the control group is treated by clear water, and the treatment group is inoculated with ralstonia solanacearum. Sampling is carried out at 8:00 in the morning, samples of 0h, 1h, 3h, 6h, 12h and 24h are respectively taken, each sample contains 3 biological repeats, RNA is extracted, reverse transcription is carried out to cDNA, and RT-qPCR is carried out, wherein the final result is expressed as the relative expression quantity of the genes of the treatment group relative to the genes of the control group. The multiple comparison results for each point in time are represented by alphabetical notation.

Fifth, hormone treatment

Eggplant seedlings with 4-5 true leaves were sprayed with 1mM SA (Jia et al, 2013; Mahesh et al, 2018) and 0.25mM MeJA (Deng et al, 2021), and the control group was sprayed with clear water at 26 ℃, 16h at 22 ℃, and cultured in the dark for 8 hours. Sampling from 8:00 in the morning, taking samples of 0h, 1h, 3h, 6h, 12h and 24h respectively, performing at least 3 biological repetitions at each time point, performing RNA extraction on the samples, performing reverse transcription on cDNA, and performing qPCR. Referring to Table 1, the results of multiple comparisons at each time point are indicated by alphabetical notation.

As a result: e31 was treated by SA and MeJA, and the change of the relative expression of SmDDA1b gene in one day after hormone treatment was measured by qPCR, as shown in FIG. 1F, after E31 was treated by SA, SmDDA1b showed the tendency of descending first and then ascending; the SA is sprayed in a short period, the gene expression is influenced by the SA, and finally the SA is in an ascending trend, and the SA has a certain promotion effect on the gene expression; and after MeJA is sprayed on E31, the expression level of SmDDA1b is continuously reduced, which shows that the expression of SmDDA1b can be inhibited by spraying MeJA in a short period.

And respectively inoculating ralstonia solanacearum to the eggplant disease-resistant material E31 and the disease-susceptible material E32, determining the relative expression change of genes by qPCR, and analyzing whether the expression of the SmDDA1b gene is mobilized when the ralstonia solanacearum infects different materials, wherein the result shows that the expression level of SmDDA1b in the disease-resistant plant is in the trend of descending firstly and then ascending, and the expression level of SmDDA1b gene in the disease-susceptible plant is in the trend of descending firstly and then flattening, which indicates that the expression of the SmDDA1b gene in E31 can be improved when the ralstonia solanacearum infects the disease-resistant plant (figure 1E).

Experiment of VIGS six

A specific fragment of 300bp is intercepted from a target gene, the specific fragment is constructed on a pTRV2 vector by a double-enzyme digestion method (the 5 'end enzyme digestion site is EcoR I, the primer is ggaattcCCTCCGAACAATGCCACA, the 3' end enzyme digestion site is Sma I, and the primer is tcccccgggGAAATCCCCTTGCCGTCT), and then the specific fragment is transferred into an agrobacterium GV3101 strain. Treating 4-5 true leaves with clear waterE31 plants and plants injected with pTRV2 and pTRV1 no-load agrobacterium liquid according to the volume ratio of 1:1 are used as a control, pTRV2-SmDDA1b and pTRV1 no-load agrobacterium liquid are injected with E31 plants according to the volume ratio of 1:1 as a treatment group, after injection, the treatment is carried out for one day at 16 ℃ under the dark condition, then the normal culture is carried out for 1-2 weeks, (26 ℃, 16h illumination, 22 ℃, 8h dark), each treatment is carried out for at least 10 biological repetitions, then sampling is carried out, and RNA and qPCR are carried out. Then adopting 'root-cutting and root-pouring method' to make ralstonia solanacearum (GMI1000) inoculation (OD)₆₀₀0.6), the phenotype was observed around one month of inoculation.

As a result: in order to further verify whether the E3 ubiquitin ligase gene SmDDA1b resists eggplant bacterial wilt or not, a gene silencing (VIGS) experiment is carried out on the E3 ubiquitin ligase gene and the morbidity index after the bacterial wilt is inoculated is counted, Liu et al (2005) set out the resistance evaluation standard of the eggplant to the bacterial wilt (Table 5). The results show that when the gene expression level of SmDDA1B in the high-resistance material E31 is reduced and then the high-resistance material is inoculated with ralstonia solanacearum (figure 4A), E31 shows obvious susceptible symptoms, the disease incidence reaches 100%, the disease index is 70, and the high-susceptibility bacterial wilt level of eggplant is shown (figures 4B-C). It was preliminarily shown that SmDDA1B is associated with eggplant resistance to bacterial wilt and may be a key site in eggplant resistance to bacterial wilt network (FIG. 4B).

Seventhly, overexpression experiment

The 5 'end upstream primer gagaacacgggggactctagaATGGAGGATACCTCATCATCCATTC and the 3' end downstream primer gtggctagcgttaacactagtTCATGTGTCCCCCCTTAACCG are used for amplifying the fragment of an over-expressed target gene SmDDA1b, then restriction endonucleases Xba I and Spe I37 ℃ are used for double digestion of an over-expressed vector pCAMBIA-1380 for 1h, vector recombination is carried out by a fed-in one-step cloning kit, a universal primer (5 'upstream primer GGCTCCTACAAATGCCATCATTGCG; 3' downstream primer ATAATTTATCCTAGTTTGCGCGC) of pCAMBIA-1380 is used for detection, a recombined over-expressed vector is obtained, and then the recombined over-expressed vector is transferred into the GV3101 agrobacterium strain. The tomato over-expression plant is obtained by adopting an agrobacterium-mediated transformation method. MM tomato seeds are sown in a tissue culture bottle containing MS solid culture medium (4.43 g/L MS powder, 30g/L sucrose and 0.5% plant gel), after two cotyledons grow, the middle section and hypocotyl of the cotyledons are cut out and taken as explants to be placed on a solid pre-culture medium (MS solid culture medium, 0.2 mu g/L trans-zeatin TZT) for 1 day in the dark at 26 ℃. The Agrobacterium containing the recombinant vector was centrifuged at 6000rpm for 5min, the supernatant removed, the cells resuspended in MS medium, OD600 adjusted to 0.6, 100. mu.M AS added and left to stand in the dark at 28 ℃ for 1 h. Putting the explant which is pre-cultured for 1 day into an invasive stain, shaking in the dark for 10 minutes, filtering out the invasive stain, sucking water of the explant by using filter paper, putting the explant on a solid pre-culture medium, culturing in the dark at 28 ℃ for 1 day, putting a solid screening culture medium (MS solid culture medium, 2 mug/L TZT,0.2mg/L Tim, 0.5 mug/L IAA and corresponding antibiotics) into the solid pre-culture medium, performing normal culture (26 ℃, illumination for 16h, 22 ℃, darkness for 8h), changing every two weeks, selecting the explant with strong growth to continue the experiment, when the explant grows out of a callus and differentiates out of a bud, transferring the explant into a bud elongation culture medium (MS solid culture medium, 0.2 mug/L TZT,0.2mg/L Tim and corresponding antibiotics) to continue the bud elongation, when the stem grows to be about 3-4cm, cutting off the bud and inserting the bud into a rooting culture medium (MS solid culture medium, 0.2mg/L Tim, 0.5 mu g/L IAA and corresponding antibiotics), when plants take roots and grow to a bottle cap, opening the cap to practice seedling hardening, transferring to sterilized soil after one week, covering a transparent plastic bag for one week, sampling, carrying out DNA detection on a bar gene (an upstream primer ATGAGCCCAGAACGACGCCCG at the 5 'end and a downstream primer TTAGATCTCGGTGACGGGCAGGACC at the 3' end) of the plants, detecting the relative expression quantity of the SmDDA1b gene, and finishing an overexpression experiment.

Eight, yeast two hybrid (Y2H)

A SmNAC N-end 417bp fragment with a homologous arm is connected to a pGBKT7 vector which is subjected to double enzyme digestion by EcoR I (5 'end) and BamH I (3' end) by a one-step cloning method, and specific primers are an upstream primer atggccatggaggccgaattcATGGGTGTTCAAGAAAAAGATCCT at the 5 'end and a downstream primer ccgctgcaggtcgacggatccTAATCTATATTCATGCATGATCCAATTAG at the 3' end. Making yeast Y2H Gold competence, streaking Y2H Gold strain on YPDA plate, culturing at 30 deg.C for 2-3 days, selecting yeast single colony with diameter of 2-3mm, inoculating to 3-4ml YPDA culture medium, culturing at 30 deg.C and 220rpm for 12-18h, shaking to concentrate, adding 50ml YPDA, further shaking for 3-5h, shaking to concentrate, 3000rpm, centrifuging for 5min, removing supernatant, and adding 30ml ddH₂O resuspending and cleaning twice, centrifuging to remove supernatant, and resuspending with 1ml of 1 × TE/LiAc prepared on site to obtainAnd (4) competence.

100 mu l Y2H Gold competed in a 1.5ml centrifuge tube, 0.5 mu g pGBKT7-bait and cDNA library plasmid (0.5 mu g), 5 mu l Carry DNA, 600 mu l sterile PEG/LiAc solution are added, mixed evenly, cultured by shaking at 30 ℃ and 200rpm for 20min, then added with 70 mu l DMSO and mixed evenly, and water bath at 42 ℃ for 15min and ice bath for 2 min. Centrifuge at 14000rpm for 15s at room temperature, discard the supernatant, resuspend the cells in 100. mu.l of 1 XTE buffer, spread 100. mu.l on the corresponding defect medium, and culture at 30 ℃ for 3-4 days in an inverted manner.

As a result: tomato Money Marker is used as a material, and the SmDDA1b is subjected to an overexpression experiment to obtain a plant capable of stabilizing a genetic gene, and the function of SmDDA1b is verified from the front. 12T seedlings obtained from 60 tissue culture seedlings by performing bar gene detection on tomato seedlings obtained by tissue culture₀Transgenic plants (figure 5A) are generated, RT-qPCR technology is utilized to detect the relative expression quantity of SmDDA1b gene, and 3 single plants with better over-expression effect are selected to carry out T₁Propagation generation, respectively T_0-12，T_0-17And T_0-31-2(FIG. 5B). Then for the obtained T₁The lines of generations and wild tomato seedlings were inoculated with ralstonia solanacearum, and the results showed that the attack time of the wild tomato seedlings and the over-expressed tomato seedlings was the same, and the disease was initiated the fifth day after ralstonia solanacearum inoculation, but the incidence and disease index of the wild tomato seedlings were significantly higher than those of the over-expressed tomato seedlings within 14 days after ralstonia solanacearum inoculation (fig. 5E-F, table 6). When WT and overexpressed plants at 7 th and 14 th days after inoculation of ralstonia solanacearum were observed, wild-type tomato seedlings were substantially wilted, and overexpressed tomato seedlings exhibited partial wilting and were more resistant to the phenotype of bacterial wilt than wild-type plants (fig. 5C-D, table 7). The result shows that the overexpression of SmDDA1b can improve the resistance of the plant to the ralstonia solanacearum, and SmDDA1b has the function of bacterial wilt resistance. SA content measurement is carried out on wild tomato seedlings inoculated with or not inoculated with ralstonia solanacearum and tomato seedlings over-expressing SmDDA1b, and the results show that the SA content of the wild tomato seedlings not inoculated with the ralstonia solanacearum is obviously lower than that of the tomato seedlings over-expressing, the SA content of WT and over-expressing tomato seedlings is obviously increased after ralstonia solanacearum is inoculated, but the SA content of the wild tomato seedlings is still obviously lower than that of the over-expressing tomato seedlings, which shows that the SA content can be induced to increase when the plants are stressed by organisms, and meanwhile, the way between SmDDA1b and SAThe expression of SmDDA1b can induce the increase of SA content, and the plants show stronger disease resistance.

Meanwhile, hormone signal pathway gene expression quantity analysis is carried out on SmDDA1b overexpression plants and VIGS plants. EDS1, GluA, NPR1, TGA, SGT1, PAD4, PR-1a and ICS1 are screened from SA pathway signal genes, and 8 genes for positively regulating resistance of ralstonia solanacearum. It was found that the SA pathway signal gene in VIGS showed significant difference in all genes except TGA compared to the control, and the expression level of the SA pathway signal gene in the silenced plants was decreased (fig. 6A). In the over-expressed plants, compared with wild type, the expression measures of other genes except PR-1a in the SA pathway signal gene are significantly different and show an ascending trend. This result preliminarily indicates that the SA pathway is regulating expression of SmDDA1B (fig. 6B).

Discussion: in the research, 417bp bases of the N-terminal NAM-containing domain of the eggplant bacterial wilt-resistant negative regulation transcription factor SmNAC are used as baits in the subject group, and an eggplant cDNA library is screened to obtain an E3 ubiquitin ligase gene SmDDA1b, and the function verification is carried out. The results show that the expression trends of SmDDA1b after the inoculation of ralstonia solanacearum on E31 and E32 are different, the expression trend of SmDDA1b in disease-resistant plants is firstly reduced and then increased, and the expression trend of SmDDA1b in disease-sensitive plants is firstly reduced and then becomes gentle. The result shows that when the plant is stressed by pathogen, the innate immune system of the plant can react, namely immune response (PTI) stimulated by pathogen-related molecular patterns and immune response (ETI) stimulated by effector proteins, wherein PTI is a basic defense response and is non-specific, and ETI is a specific response caused by the effector proteins of the plant, wherein the effector proteins of the pathogen are identified by disease-resistant proteins (R proteins). When a plant is stressed by pathogen, the plant firstly makes nonspecific defense reaction, and then the pathogen releases effector protein to inhibit PTI, so that the expression of E3 ubiquitin ligase SmDDA1b is in a descending trend in a disease-resistant plant and a disease-susceptible plant, the latter plant makes ETI reaction, and at the moment, the expression of SmDDA1b is increased in the disease-resistant plant. This result suggests that E3 ubiquitin ligase SmDDA1b is likely to be a gene that is positively regulating eggplant resistance to bacterial wilt. Meanwhile, the specificity of the gene of E3 ubiquitin ligase is also shown in a side face.

Ralstonia solanacearum contains a variety of secretory systems, but acts mainly through type III secretory systems. T3SS can cause host infection or Hypersensitivity (HR) by injecting its own effector into the host. Meanwhile, researches show that UPS in plants can specifically recognize pathogenic effectors and play a role in plant-pathogen interaction. Gabri et al have shown that UPS can target the motor protein 69k of Turnip yellow mosaic virus in vitro, modulating its activity. In tobacco, RING type E3 ubiquitin ligase NtRFP1 could mediate geminivirus encoded β C1 degradation. In the process, according to the specificity of SmDDA1b on the defense reaction of the ralstonia solanacearum, the ralstonia solanacearum can interact with a toxic gene of the ralstonia solanacearum, namely effector protein, and the bacterial wilt is ubiquitinated and degraded so as to carry out the plant defense reaction.

In addition, from hormone treatment experiments, VIGS, over-expressed hormone signal pathway gene expression and over-expressed SA content measurement results, SmDDA1b is under positive control of SA pathway and JA pathway in defense reaction against eggplant bacterial wilt, and can also target SA and JA signal pathway genes. For example, previous studies have shown that the E3 ligase CUL3^BPMMYC2, MYC3 and MYC4 can be targeted, MYC protein abundance is reduced, JA channels are regulated and the like.

Experiments such as VIGS and the like preliminarily screen the E3 ubiquitin ligase gene SmDDA1b which has the most obvious result and is not subjected to functional verification before, and then the overexpression experiments are carried out on the E3 ubiquitin ligase gene SmDDA1b, so that the E3 ubiquitin ligase gene is verified to have positive regulation and control effects on bacterial wilt resistance of plants and is presumed to be an important gene of eggplant for resisting bacterial wilt.

TABLE 4 statistics of disease indexes of E31 and E32 for eggplant resistance to bacterial wilt

TABLE 5 evaluation criteria of disease index for eggplant resistance to bacterial wilt

TABLE 6 statistical table of morbidity and disease index of wild tomato seedlings and over-expressed tomato seedlings inoculated with ralstonia solanacearum for 14 days

TABLE 7 statistical Table of morbidity and disease index 14 days after inoculation of ralstonia solanacearum on wild type and over-expressed tomatoes

The embodiments of the present invention have been described in detail, but the present invention is not limited to the described embodiments. It will be apparent to those skilled in the art that various changes, modifications, substitutions and alterations can be made in these embodiments without departing from the principles and spirit of the invention, and the scope of protection is still within the scope of the invention.

Sequence listing

<110> southern China university of agriculture

<120> eggplant E3 ubiquitin ligase gene SmDDA1b and application thereof in improving bacterial wilt resistance

<130> ZM211189ZL

<160> 2

<170> SIPOSequenceListing 1.0

<210> 1

<211> 504

<212> DNA

<213> 2 Ambystoma laterale x Ambystoma jeffersonianum

<400> 1

atggaggata cctcatcatc cattcctccg aacaatgcca caacttccgg tgcggccaaa 60

tacctagccg gcctcccttc tcggggactc ttctcctcca acgtcctctc ctctactccg 120

ggtggaatgc gagtatatat ttgcgatcac gaaacgtcac ctccggagga ccagtttatt 180

aagacaaacc agcaaaacat attgattagg tctctcatgc ttaagaagca gagaggtgac 240

catagttcaa aagacggcaa ggggatttcc tcgaatgaca atggtagaaa aagagctgct 300

gaaaaaacat tggatagtag gacatcaaac aagaaggcta ccaccagtaa ccaagttgca 360

tctccccaag aaacttcaag aattcgtaca cctgacatac aaaatatgac tgttgagaag 420

ctacgggctc tgttaaagga gaaaggtctt tctctgagag gaaggaagga tgaactaatt 480

gcacggttaa ggggggacac atga 504

<210> 2

<211> 167

<212> PRT

<213> 2 Ambystoma laterale x Ambystoma jeffersonianum

<400> 2

Met Glu Asp Thr Ser Ser Ser Ile Pro Pro Asn Asn Ala Thr Thr Ser

1 5 10 15

Gly Ala Ala Lys Tyr Leu Ala Gly Leu Pro Ser Arg Gly Leu Phe Ser

20 25 30

Ser Asn Val Leu Ser Ser Thr Pro Gly Gly Met Arg Val Tyr Ile Cys

35 40 45

Asp His Glu Thr Ser Pro Pro Glu Asp Gln Phe Ile Lys Thr Asn Gln

50 55 60

Gln Asn Ile Leu Ile Arg Ser Leu Met Leu Lys Lys Gln Arg Gly Asp

65 70 75 80

His Ser Ser Lys Asp Gly Lys Gly Ile Ser Ser Asn Asp Asn Gly Arg

85 90 95

Lys Arg Ala Ala Glu Lys Thr Leu Asp Ser Arg Thr Ser Asn Lys Lys

100 105 110

Ala Thr Thr Ser Asn Gln Val Ala Ser Pro Gln Glu Thr Ser Arg Ile

115 120 125

Arg Thr Pro Asp Ile Gln Asn Met Thr Val Glu Lys Leu Arg Ala Leu

130 135 140

Leu Lys Glu Lys Gly Leu Ser Leu Arg Gly Arg Lys Asp Glu Leu Ile

145 150 155 160

Ala Arg Leu Arg Gly Asp Thr

165

Claims (7)

1. Eggplant E3 ubiquitin ligase gene SmDDA1b is characterized in that the nucleotide sequence is shown as SEQ ID NO: 1, and the coded amino acid sequence is shown as SEQ ID NO: 2, respectively.

2. Biological material containing the gene SmDDA1b as defined in claim 1, wherein the biological material includes, but is not limited to, vectors, plasmids, host cells, plants.

3. The application of the gene of claim 1 in developing and screening eggplant functional products with resistance to bacterial wilt.

4. The use according to claim 3, wherein the functional product has a function of up-regulating the expression, transcription or an expression product thereof of the SmDDA1b gene.

5. The use as claimed in claim 4, wherein the functional product is selected from one or both of a substance for promoting expression of SmDDA1b gene, a SmDDA1b gene over-expression gene recombination construct.

6. The use as claimed in any one of claims 3 to 5 wherein the expression of the SmDDA1b gene is under the positive control of the SA pathway.

7. The method for improving the resistance of eggplant to bacterial wilt is characterized by comprising the following steps of:

s1, constructing an overexpression vector taking the SmDDA1b gene as a target gene;

s2, transforming the constructed over-expression vector into eggplant;

and S3, screening to obtain the positive transgenic eggplant.

Images