CN111088260A

CN111088260A - Radish salt-tolerant gene RsNHX1 and application thereof

Info

Publication number: CN111088260A
Application number: CN202010046089.0A
Authority: CN
Inventors: 王燕; 应佳丽; 柳李旺; 张旸; 徐良
Original assignee: Nanjing Agricultural University
Current assignee: Nanjing Agricultural University
Priority date: 2020-01-16
Filing date: 2020-01-16
Publication date: 2020-05-01

Abstract

The invention belongs to the field of plant biotechnology and molecular breeding, and relates to a significantly-changed gene in a radish salt stress response processRsNHX1In particular to a radish salt-resistant geneRsNHX1And application thereof, radish salt-resistant geneRsNHX1The nucleotide sequence is shown as SEQ ID N O.1, and the salt-tolerant gene is containedRsNHX1The amino acid sequence of the transporter is shown in SEQ ID NO. 2. The invention fills up the salt-tolerant gene of radishRsNHX1Providing a salt-tolerant gene of radishRsNHX1The sequence of the cDNA of (a),analyzing different time under salt stress by RT-qPCR technologyRsNHX1The expression characteristics of the gene, further design the cloning primer to construct pCAMBIA2301-RsNHX1Overexpression vector and suppression vector, post-kan transformation of Arabidopsis thaliana⁺Screening, and salt treatment phenotypic identification.

Description

Radish salt-tolerant gene RsNHX1 and application thereof

Technical Field

The invention belongs to the field of plant biotechnology and molecular breeding, relates to a significantly-changed gene RsNHX1 in a radish salt stress response process, and particularly relates to a radish salt-tolerant gene RsNHX1 and application thereof.

Background

Radish (Raphanus sativus l., 2n ═ 2x ═ 18), also known as radish, is a annual and biennial herb plant of the brassicaceae radish genus, and is an important root vegetable crop originally produced in China. The radish takes the expanded fleshy straight roots as main product organs, has rich nutrition, various purposes and extremely high food therapy value, is deeply loved by people and plays an important role in vegetable production and annual supply in China.

In recent years, potential hazards of salinization of soil in vegetable bases force vegetable crops to be affected by salt damage of different degrees, and the phenomena of slow seedling emergence, inhibited root growth, short and small plants, curled and withered and yellow leaves, withered and yellow stems and leaves, growth stagnation and the like are shown, so that the yield and the quality of the vegetables are seriously affected. Key functional genes for identifying the salt tolerance of the plants are separated, and biotechnology means such as molecular marker-assisted breeding and transgenosis are used, so that the germplasm innovation of salt-tolerant vegetable crops is accelerated, and the breeding process of salt-tolerant varieties is greatly shortened.

Na⁺/H⁺Antiporter (Na)⁺/H⁺exchangeable antigen), NHX, NHE or NHA for short, is a transmembrane protein capable of converting excessive Na in cytoplasm⁺Compartmentalization and incorporation of Na within the vacuole⁺Discharging to outside of the cell to maintain cytoplasmic Na⁺And (4) steady state. Previous researches in model plants, namely arabidopsis thaliana and rice, show that related members of an NHX gene family can play important roles in the plant adversity stress resistance aspects, such as cell expansion, pH and ion balance regulation, osmotic regulation, membrane vesicle transport, protein processing, floral organ development and the like, but the separation identification and biological function analysis of the NHX gene in radish are not reported yet.

Virus Induced Gene Silencing (VIGS) technology is a Virus-mediated post-transcriptional gene silencing that can reverse the biological function of genes from changes in plant phenotype or physiological indices. The VIGS technology is applied to plants such as tobacco, tomato, Chinese cabbage and the like at present, has the advantages of simple operation, short period, high silencing efficiency, capability of taking effect under different genetic backgrounds and the like, and is suitable for identifying gene functions. However, in the earlier research, the defects of low impregnation efficiency, random infection of virus on other parts of plants and the like easily occur mainly through a vacuum impregnation and in-vivo injection method.

Disclosure of Invention

The invention aims to fill the blank of a radish salt-tolerant gene RsNHX1, provide a cDNA sequence of the radish salt-tolerant gene RsNHX1, analyze the expression characteristics of the RsNHX1 gene at different times under salt stress by adopting an RT-qPCR technology, further design a cloning primer to construct a pCAMBIA2301-RsNHX1 overexpression vector, and transform kan after arabidopsis thaliana⁺Screening, and salt treatment phenotypic identification. Furthermore, the invention also uses a virus-induced gene silencing vector pTY-s derived from Turnip Yellow Mosaic Virus (TYMV) to construct a pTY-RsNHX1 suppression expression vector, and a system for verifying the biological function of the radish salt-tolerant gene by inducing endogenous gene silencing through virus is established in radish for the first time.

In order to achieve the purpose, the invention adopts the following technical scheme: the invention provides a radish salt-tolerant gene RsNHX1, wherein the nucleotide sequence of the radish salt-tolerant gene RsNHX1 is shown as SEQ ID No. 1.

Preferably, the complete ORF of the radish salt-tolerant gene RsNHX1 comprises 1635bp, and the theoretical molecular weight and isoelectric point of the radish salt-tolerant gene RsNHX1 are 60233.35 and 7.16 respectively.

Preferably, the nucleotide sequence of an upstream primer RsNHX1-F for cloning the radish salt-tolerant gene RsNHX1 is shown as SEQ ID NO. 3; the nucleotide sequence of the downstream primer RsNHX1-R for cloning the radish salt-tolerant gene RsNHX1 is shown as SEQ ID NO. 4.

The invention also provides a transport protein containing the salt-tolerant gene RsNHX 1.

Wherein the amino acid sequence of the transport protein is shown as SEQ ID NO. 2.

The invention also provides an acquisition method of the radish salt-tolerant gene RsNHX1, which comprises the following steps:

1) selecting a variety of 'NAU-XBC' to extract RNA;

2) reverse transcription to obtain 'NAU-XBC' cDNA;

3) using cDNA of 'NAU-XBC' as a template, and carrying out PCR amplification and purification by using specific primers RsNHX1-F and RsNHX 1-R; the nucleotide sequence of the specific primer RsNHX1-F is shown in SEQ ID NO. 3; the nucleotide sequence of the specific primer RsNHX1-R is shown in SEQ ID NO. 4;

4) and cloning the purified product T-A, detecting a PCR product, and selecting a recombinant of a corresponding fragment for DNA sequencing to obtain the radish salt-tolerant gene RsNHX 1.

The invention also provides the radish salt-tolerant gene RsNHX1, an overexpression vector, an expression inhibiting vector, a cell or a recombinant bacterium of the transport protein.

Preferably, the overexpression vector is pCAMBIA2301-RsNHX 1.

The invention also provides an inhibition expression vector of the radish salt-tolerant gene RsNHX1, wherein the inhibition expression vector is pTY-RsNHX 1.

The invention also provides application of the radish salt-tolerant gene RsNHX1, the transport protein, the over-expression vector, the suppression expression vector, the cell or the recombinant bacterium in cultivation of salt-resistant arabidopsis thaliana or salt-tolerant radish.

Preferably, the conditions for cultivating the salt-tolerant radish are as follows: the treatment was performed under hydroponic salt-added stress conditions, with a salt concentration of 250mM NaCl.

Compared with the prior art, the invention has the beneficial effects that: the radish salt-tolerant gene RsNHX1 has obvious up-regulation expression after being stressed by 250mM NaCl for different time (0h, 3h, 6h, 12h, 24h, 48h and 96h), reaches the highest relative expression level after being subjected to salt treatment for 24h, and the expression level basically returns to the expression level before treatment after a period of time. An overexpression vector is also constructed to transform arabidopsis thaliana genetically and a transient expression vector silences a radish salt-tolerant gene RsNHX1, so that the function of the radish salt-tolerant gene RsNHX1 is verified. The invention discovers that the RsNHX1 gene of the radish NHX family member has obvious change in the salt stress response process by transcriptome and proteome isomics combined analysis and combining with RT-qPCR technology, and simultaneously, the invention adopts the gene gun bombardment method to overcome the defects of vacuum soaking and dip dyeing and in vivo injection, and realizes the biological function of rapidly and reversely identifying the salt-tolerant gene on the leaves of the specific part of the radish for the first time. The research result provides an important theoretical basis for improving the salt tolerance of the radish and the germplasm genetic improvement and germplasm innovation by utilizing a genetic engineering technical means. The invention adopts the technical scheme to provide a system for discovering and function verification of the radish salt-tolerant gene RsNHX1, overcomes the defects of the prior art, and has reasonable design and convenient operation.

Drawings

FIG. 1 shows the cDNA sequencing of RsNHX1 aligned with the genomic database.

FIG. 2 shows tissue-specific expression of the RsNHX1 gene at different times of 250mM NaCl treatment.

FIG. 3 is an electrophoretogram of RsNHX1 gene clone.

FIG. 4 is the electrophoresis diagram of the double restriction enzyme recombinant plasmid and the expression vector pCAMBIA 2301; among them,

lanes

1 and 2 show the double digestion of pMD18-RsNHX1 with the respective restriction enzymes BamH I and Kpn I, and lane 3 shows the double digestion of pCAMBIA2301 vector stored in this laboratory with the respective restriction enzymes BamH I and Kpn I.

FIG. 5 is a double-restriction electrophoretic picture of the RsNHX1 overexpression vector.

FIG. 6 is an electrophoresis chart of Agrobacterium tumefaciens liquid detection; wherein, the left picture is: detecting a result of the specific primer bacterial liquid; the right picture is: detecting the result of the M13 universal primer; lanes 1-5 represent the different monoclonals, 5 of which were randomly picked on the Agrobacterium transformation plate.

FIG. 7 is T₁The PCR detection of the transgenic Arabidopsis thaliana over-expressed by RsNHX1 is shown in lane 1, and the PCR detection result of the wild Arabidopsis thaliana is shown in lanes 2-6₁The PCR detection result of transgenic arabidopsis thaliana is overexpressed by the generation of RsNHX 1.

FIG. 8 is a screen of Arabidopsis thaliana overexpressing RsNHX 1; WT was wild type, OENHX1 was over-expressed RsNHX 1.

FIG. 9 shows the GUS (β -glucuronidase) staining pattern of Arabidopsis thaliana over-expressing RsNHX1, WT is wild type, and OENHX1 is over-expressing RsNHX 1.

FIG. 10 depicts phenotypic identification of Arabidopsis thaliana overexpressing RsNHX 1.

FIG. 11 is a photograph showing phenotype of leaves after transfer of radish pTY-s; wherein, the left picture is: WT wild type; the right picture is: pTY-s.

FIG. 12 is a photograph of leaf phenotype of radish RsPDS gene silencing; wherein, the left picture is: WT wild type; the right picture is: pTY-RsPDS (recombinant vector carrying the gene of interest RsPDS).

FIG. 13 is a photograph of phenotype of leaf blade in radish RsNHX1 gene silencing; wherein, the left picture is: WT wild type; the right picture is: pTY-RsNHX1 (recombinant vector carrying the gene of interest RsNHX 1).

FIG. 14 shows the identification of the plasmid transferred by electrophoresis, and the underlines indicate the corresponding plants, WT (3 lanes), pTY (2 lanes), pTY-RsPDS (4 lanes), pTY-RsNHX1(5 lanes).

FIG. 15 is a graph showing the significance of relative expression difference after RT-qPCR detection, and the abscissa shows the individuals confirmed to be transferred into the target fragment after electrophoretic identification, WT (1), pTY (2, PTY-1 and PTY-3, respectively), pTY-RsNHX1(5, NHX1-1 to NHX 1-5).

FIG. 16 shows the silenced gene phenotype of radish seedlings after hydroponic salt treatment, wherein the left panel is: pre-salt phenotype; the right picture is: phenotype after salt treatment.

Detailed Description

The technical process of the present invention will be described in further detail with reference to specific embodiments. It should be noted that the following examples are merely illustrative, and the present invention is not limited to these examples.

Application example 1 cloning of radish RsNHX1 Gene

Selecting a radish high-generation inbred line 'NAU-XBC' with obvious salt tolerance difference as an experimental material, separating and identifying the differential expression genes before and after different salt stress treatment by using a digital gene expression profiling (DGE) technology based on transcriptome sequencing, separating differential response functional proteins of fleshy roots under different salt stress by using a quantitative proteomic iTRAQ technology, and separating cDNA sequences of key candidate genes RsNHX1, RsAPX1, RsSOS2, RsNHX2 and the like based on proteomic, transcriptome and miRNA multiomic correlation analysis.

Taking cDNA of a high-generation inbred line 'NAU-XBC' cultured by a radish subject group of Nanjing agriculture university college as a template, designing specific primers RsNHX1-F and RsNHX1-R by using Primer 5.0 software based on the cDNA sequence of a separated key candidate gene RsNHX1, wherein the Primer sequences are shown as SEQ ID NO: 3 and SEQ ID NO: 4, submitting the cDNA to Nanjing Sipu gold Biotech Limited for synthesis, cloning the cDNA, performing electrophoresis identification by using 1.2% agarose gel, recovering and purifying by using a gel kit to obtain an RsNHX1 fragment, connecting the recovered fragment with a pMD19-T vector (Takara) (the connector is 0.5 mu l PMD19-TVector (50 ng/mu l) +2.5 mu l solution I (ligantiomix) +2 mu l recovered product), transforming into Escherichia coli 5 α, sequencing by coating a plate, performing single-plate sequencing, selecting a single-colony amplification after breeding, and performing PCR detection on a cDNA sequence of a cDNA amplified by a cDNA sample of Nanjing Sijing cDNA library (CDS 1) and performing PCR detection.

RsNHX1-F：5’-CGGGATCCAAGAGGAAATTGGTGGAT-3’，SEQ ID NO：3

RsNHX1-R：5’-GGGGTACCCTCAAAACGTAGGGACAG-3’，SEQ ID NO：4

The sequencing result (as shown in SEQ ID NO: 1) shows that the total length of RsNHX1 cDNA is 1717bp, the ORF length of RsNHX1 is 1635bp respectively, and 545 amino acids (as shown in SEQ ID NO: 2) are coded. The RsNHX1 gene of radish has higher similarity with NHX1 genes of other species, and the theoretical molecular weight and the isoelectric point are 60233.35 and 7.16 respectively. The genomic DNA of RsNHX1 consists of 12 introns and 13 exons, and the detailed sequence alignment information is shown in fig. 1.

Application example 3 analysis of expression characteristics of RsNHX1 Gene

In order to confirm the analysis method of the expression quantity of the RsNHX1 gene in radish tissues at different times, a specific primer of the RsNHX1 gene and an internal reference primer of an internal reference gene Actin are designed, and the primer sequences are shown as SEQ ID NO: 5 to SEQ ID NO: shown in fig. 8. In order to study the expression of the radish RsNHX1 gene under NaCl stress, RT-qPCR was used to analyze the expression of the radish RsNHX1 gene at the same NaCl concentration (250mM) under stress for different times (0, 3, 6, 12, 24, 48 and 96h) (the results are shown in FIG. 2). The results show that the RsNHX1 gene is obviously up-regulated in expression after salt stress treatment, reaches the highest relative expression level after salt treatment for 24 hours, and the expression level is basically returned to the expression level before the treatment after a period of time.

Application example 4 radish RsNHX1 Gene overexpression vector construction and phenotypic identification

Using cDNA of radish 'NAU-XBC' treated by NaCl stress as a template, designing specific primers RsNHX1-F (SEQID NO: 3) and RsNHX1-R (SEQ ID NO: 4) for amplification, recovering, connecting, transforming and sequencing positive clones of PCR amplification products, using corresponding restriction endonucleases BamH I and Kpn I to carry out double enzyme digestion on pMD19-RsNHX1 and pCAMBIA2301 vectors respectively, carrying out electrophoresis detection, recovering fragments with correct length (as shown in figure 3), recovering a target gene fragment (a second band in lanes 1 and 2) and a pCAMBIA2301 vector fragment (as shown in figure 4, recovering the target gene fragment in lanes 1 and 2, namely a second band, directly recovering the bands by double enzyme digestion of pCAMBIA 2301), and directly recovering the bands by using T₄Ligation with ligase, transformation of Escherichia coli competence DH5 α, PCR detection of positive bacterial colony with bacterial liquid, extraction of plasmid of positive bacterial colony, double restriction enzyme digestion verification (as shown in figure 5) of plasmid, correct length of target fragment after restriction enzyme digestion, showing successful construction of overexpression vector pCAMBIA2301-RsNHX1, transformation of EHA105 Agrobacterium infection with overexpression vector pCAMBIA-RsNHX1, PCR detection of bacterial liquid with specific primer RsNHX1-F, RsNHX1-R and general primer M13, amplification of band of 1774bp with specific primer, amplification of band of about 2800bp with M13 primer (in this laboratory pCAMBIA2301, no-load, band of about 1000bp can be amplified with M13 primer, target fragment is 1774bp, amplification of band of about 2800bp with M13 is consistent with expected fragment size, showing successful acquisition of band of amplified fragment of about 2800bp with M1 bp, detection of normal bacterial liquid, where the detection result of bacterial liquid is shown in drawing 20, where the detection of right bacterium immersion in drawing, and the test of normal bacterial liquid, where the detection of the left side of the test is shown in figure 20And (5) culturing. Infecting again after one week, and obtaining T after the seeds are mature₀And (5) seed generation. Will T₀Seed generation is processed at 4 ℃ for 1-2 days, and then sowed in the seed containing 25mg/Lkan⁺Culturing in a culture room for about 2 weeks in 1/2MS solid medium, wherein the non-transgenic Arabidopsis (including WT control Arabidopsis and part of unsuccessfully transformed Arabidopsis) grow to abnormal or yellow and die, and the positive plants can grow to more than 4 true leaves with developed root system until T is screened₃Transgenic arabidopsis seeds were generated, see fig. 8.

In order to further verify whether the arabidopsis resistant plant is transferred with a target gene or not, extracting and screening the obtained arabidopsis resistant plant leaf genome DNA, taking a wild type arabidopsis leaf as a negative control, carrying out PCR amplification by using specific primers RsNHX1-F and RsNHX1-R, carrying out electrophoresis results (shown in figure 7), wherein lane 1 is a wild type arabidopsis control, lanes 2-6 are bands for overexpression of RsNHX1 transgenic arabidopsis amplification, wherein lane 3 does not amplify a band,

lanes

2, 4, 5 and 6 amplify a band (1774bp) with the size of a target gene RsNHX1 fragment, and wild type arabidopsis plants do not amplify the band.

Respectively randomly selecting wild type and RsNHX 1T₃Salt stress treatment is carried out on transgenic arabidopsis thaliana (the result is shown in detail in figure 10), NaCl aqueous solution with the concentration of 200mM is poured every 1 day, wild type arabidopsis thaliana without salt treatment is simultaneously poured with clear water with the same volume, the growth conditions such as temperature, illumination, humidity and the like are the same, and the wild type arabidopsis thaliana and T are observed and recorded₃The morphological expression of the transgenic arabidopsis thaliana comprises the growth condition, the development degree and the like of a plant. The results show that after 7 days of salt treatment, the old leaves of wild arabidopsis thaliana are basically wilted and etiolated, the leaves grow slowly, the growth is almost stopped, the plant development degree is slightly increased compared with that before the treatment, obvious salt sensitivity is shown, andt of RsNHX1₃Most leaves of the transgenic arabidopsis have no obvious change in color, only the leaf edges of a few leaves are slightly yellowed, the transgenic arabidopsis grows slowly compared with WT arabidopsis which is not subjected to salt treatment, and the transgenic arabidopsis shows certain salt tolerance compared with the WT arabidopsis which is subjected to salt treatment. The results show that the over-expression of RsNHX1 gene has the function of improving the salt tolerance of plants.

Application example 5 construction of expression vector for suppressing radish RsNHX1 gene and silencing verification

In this embodiment, the method of combining the TYMV virus-induced gene silencing technology with the function verification of the radish salt stress response gene is used to analyze the function of the radish salt stress response gene, and the specific steps are as follows:

1) preparation of radish Material

The test material is a radish high-generation inbred line 'NAU-YH', new radish seeds with full and mature seeds are selected, the upper layer water is sucked out after the seeds are soaked in a dark phytotron for 1h, the seedlings are sowed in 50-hole trays after 1-2d of germination, and when the plants grow to two leaves and one heart, 5 radish seedlings with the same growth vigor are selected.

2) Construction of recombinant viral vectors

Phytoene Desaturase (PDS) is an essential enzyme for carotenoid synthesis, CDS sequences of RsPDS and RsNHX1 genes are searched from NCBI, 40bp and 80bp in total are selected and reversely complemented, vector pTY-s (presented by Zhang Changwei teacher of gardening institute of Nanjing university of agriculture) is adopted to construct pTY-RsPDS and pTY-RsNHX1 recombinant vectors respectively through fusion and connection of infusion enzyme, the Escherichia coli Stb13 is transformed by the ligation products to obtain positive colonies, namely pTY-RsPDS recombinant bacteria and pTY-RsNHX1 recombinant bacteria, 100 mu l of bacterial liquid is added into 200ml of SOC culture medium to be massively propagated in a shaker at 30 ℃, the large-quality-improved particles are obtained to obtain pTY-RsPDS recombinant plasmids and pTY-RsNHX1 recombinant plasmids, and the concentrator is rotated, evaporated and concentrated to enable the concentration to reach 1mg ml^-1The above. After the pTY-RsPDS recombinant strain is inoculated, the mRNA expression of the RsPDS is inhibited, and the radish leaves are de-greened and whitened. Therefore, the RsPDS gene can be used as an indicator gene for confirming that radish leaves can be infected by TYMV virus. When the recombinant pTY-RsNHX1 strain is inoculated, the radish leaves have different degrees of diseased spots.

The 80bp sequence selected for RsPDS is:

TTGAGGAACAACGAGATGCTGACATGGCCAGAGAAAATAATTATTTTCTCTGGCCATGTCAGCATCTCGTTGTTTCTCAA；

the 80bp sequence selected by RsNHX1 is:

CTAGGACAGTGCATTACTACTGGAGACAGTTTGATGACTCGAGTCATCAAACTGTCTCCAGTAGTAATGCACTGTCCTAG。

3) radish 'NAU-YH' seedling bombarded by table type gene gun

After the gold powder is wrapped with plasmid, 5 radish seedlings are bombarded at one time by using a PDS-1000/He type gene gun, the bombarded seedlings are quickly transferred into a hydroponic device filled with Hoagland nutrient solution for culture, and the seedlings injected with water are used as a control test. And (3) placing the water culture device in an artificial climate chamber for dark culture for 22-26h, setting the culture temperature to be 22-25 ℃, the relative humidity to be 48-52%, the light cycle to be 13L/11D, and culturing for about 30D under the condition of illumination of 120001x, and observing the phenotype of the radish leaves.

In the embodiment, a table-type gene gun bombardment method is used for transferring the recombinant plasmid vector into radish cells, intensively infecting leaves at a specific part of a radish seedling, hydroponically culturing the radish seedling by using a Hoagland nutrient solution, and culturing in an artificial climate chamber.

4) Salt-tolerant gene silencing phenotype and RT-qPCR detection

(1) Silent phenotypic observations

Compared with radish seedlings injected with normal wild type water for about 30 days, the radish new leaves carrying the target gene viral vector have lesion symptoms of different degrees, and phenotype identification shows that the radish leaves carrying the target gene viral vector have obvious chlorosis and lesions, wherein the radish new leaves transferred with the vector pTY-s have lesions, and the spots have chlorosis and yellowing, which shows that the viral vector pTY-s is successfully introduced into radish bodies (see figure 11 in detail, wherein the left figure is WT wild type, and the right figure is pTY-s); plants transferred with the pTY-RsPDS recombinant plasmid have different degrees of disease-causing chlorosis symptoms, new leaves begin to chlorosis and whiten from veins and gradually diffuse until large-area chlorosis and whitening appear, which shows that radish RsPDS can be infected by TYMV (see figure 12 in detail, the left figure is WT wild type; and the right figure is pTY-RsPDS (recombinant vector carrying target gene RsPDS)); 5 plants transferred with the pTY-RsNHX1 recombinant plasmid have different degrees of morbidity symptoms, new leaves show scabs, the spots are green and yellow, the growth is slow, and the growth vigor is weak, which shows that the recombinant virus vector pTY-RsNHX1 can infect radish leaves to cause the morbidity of radish seedlings (see the detail in figure 13, wherein the left figure is WT wild type, and the right figure is pTY-RsNHX1 (recombinant vector carrying target gene RsNHX 1)).

(2) Electrophoresis to determine whether infection is successful

Radish seedlings with disease phenotype are quickly frozen in liquid nitrogen immediately after taking disease leaf samples, RNA is extracted and is reversely transcribed into cDNA, and primers CP-F are used: TCCACCCTCACCACCTTCTACCG, CP-R: GTGTGGGGACAGACCTCGCTAACT electrophoresis identification whether successfully transferred into the vector pTY-s identifies that 2 strains of the TYMV derived vector pTY-s have electrophoresis bands at 442bp, 4 strains of the pTY-RsPDSS recombinant vector (the virus recombinant vector inserted with the target fragment RsPDSS) have electrophoresis bands at 522bp, and 5 strains of the pTY-RsNHX1 recombinant vector have electrophoresis bands at 522bp, which shows that the virus recombinant vector pTY-RsNHX1 successfully infects radish leaves, and further determines the number of radish strains successfully infected by the detected gene, and the result is detailed in figure 14.

(3) Hydroponic salting-in phenotype identification

Selecting radish seedling vectors pTY-s and pTY-RsNHX1 recombinant vector 1 which are successfully infected through electrophoretic identification to perform water culture and salt stress treatment (adding 250mM NaCl) with wild radish seedlings, wherein radish seedlings inoculated with pTY-RsNHX1 plasmids show obvious wilting shrinkage and yellowing compared with radish seedlings of wild injection water, and radish seedlings inoculated with pTY-s plasmids have weak growth compared with radish seedlings of wild injection water, which indicates that the radish seedling growth is inhibited due to successful infection of pTY-RsNHX 1.

(3) RT-qPCR detection

RT-qPCR analysis shows that relative expression amount is obviously reduced compared with a control (see figure 15 in detail, the abscissa shows that single plants transferred into a target fragment, WT (1), pTY (2) and pTY-RsNHX1 (5) are confirmed after electrophoretic identification, the gene RsNHX1 to be detected is confirmed to be silenced, 250mM NaCl salt solution is added into Hoagland nutrient solution for water culture, and observation and discovery are carried out after one week, the radish seedlings inoculated with pTY-RsNHX1 are obviously withered, shrunk and yellow compared with the radish seedlings injected with wild type water after gene gun bombardment (see figure 16, wherein, the left figure is phenotype before salt treatment, the right figure is phenotype after salt treatment), which shows that the salt tolerance of the radish plants after the RsNHX1 is inhibited is obviously weakened, the identification result proves that the detected gene is inhibited, and the radish infected by a recombinant vector can effectively inhibit the expression of the target gene RsNHX1 to cause the silencing, the gene to be detected is proved to be closely related to the salt tolerance of the radish, and the gene is further proved to play an important role in improving the salt tolerance of the radish.

The implementation case mainly comprises the steps of using an SOC culture medium to propagate bacteria liquid after constructing a carrier, bombarding radish leaves by using a desktop gene gun after greatly extracting plasmids, and effectively silencing the expression of a radish salt-tolerant gene RsNHX 1. And (3) identifying the radish salt-tolerant gene RsNHX1 silence by adopting morbidity symptom phenotype observation, electrophoresis identification, water culture 250mM NaCl salt stress treatment phenotype identification and RT-qPCR detection. The method is simple to operate and obvious in phenotype, does not need plant genetic transformation with a long period, and can realize rapid identification of the genes influencing the salt tolerance of the radish on the premise of not influencing the research of other characters of the radish plant. Reverse verification shows that the radish plant infected by the recombinant plasmid vector can effectively inhibit the expression of the target gene RsNHX1, and a virus-induced endogenous gene silencing system is established in radish 'NAU-YH' for the first time.

Sequence listing

<110> Nanjing university of agriculture

<120> radish salt-tolerant gene RsNHX1 and application

<130>WY-PYW20200115_01

<160>8

<170>SIPOSequenceListing 1.0

<210>1

<211>1717

<212>DNA

<213> radish salt-tolerant gene RsNHX1 (Raphaussativus L)

<400>1

atgatggcat cacttttgga ttctttggta tctagaatgg cttcattttc ggcctctgat 60

cacgcctctg ttgtttcact caatctcttt gttgcacttc tctgtgcttg tattgtcctt 120

ggccatcttt tggaggagaa tcgatggatg aacgaatcca tcaccgcctt attgattggg 180

ctggccactg gtgttgtcat tttattgatt agtaatggaa aaagctcaca tcttctggtc 240

ttcagtgaag atcttttctt catttatctt ttgcctccca ttatattcaa tgctgggttt 300

caagtgaaaa agaaacagtt cttccgaaac ttcgtcacta ttatgctttt tggtgctatt 360

ggaactgtta tctcttgcac cgtcataact ctaggtgtaa cgcagttctt taagaaactg 420

gacattggaa cctttgactt gggtgattat cttgcaattg gtgctatctt cgctgcaaca 480

gattcagtct gcacactgca ggttctgaac caagatgaga cacctttgct ttacagtctt 540

gtattcggag aaggtgttgt gaatgatgcc acatcggttg ttatcttcaa cgcaattcag 600

agctttgacc tcacccacct taaccatgaa gctgcttttc aacttctagg caactttttc 660

tacttgttta tcctcagcac cttacttggt gttgcgactg gtctgataag tgcatattgc 720

atcaaaaagc tatattttgg aagacactca actgacagag aggttgccct catgatgctt 780

atggcgtatc tttcttatat gcttgctgag cttttcgact tgagtggtat tctcactgtg 840

ttcttctgtg ggattgcgat gtctcattac acctggcaca acgtaaccga gagctcaaga 900

atcaccacca agcacacctt tgccactctg tcgtttcttg cggagacatt catcttcttg 960

tacgtcggaa tggatgcatt ggacattgac aagtggagat cagtgagtga cagcccggga 1020

acatcggtgg cagtgagctc aatcctaata ggtttgctca tgcttggaag agcagcattc 1080

gtctttccct tgtcgtttct ttcaaactta ggcaagaaga accaaagtga aaaaatcgac 1140

ttcaagacgc aagttgtgat ttggtggtct ggtcttatga gaggtgctgt atcaatggcc 1200

cttgcgtaca acaagtttac aagagctggg aaaacggatt tgcgcgggaa tgcaatcatg 1260

atcaccagta ctatcaccgt ctgtcttttt agcacagtgg tgtttggtat gttgacaaaa 1320

ccactcataa gattcctttt gccgcaccag aaagccacaa ctagcttttt atctgatggc 1380

aacaacacac caaagtccat ccagatccct ctgatagatc aagactcgtt cattgagttt 1440

gcagggaacc ccaatgttcc tcggccagac agtatacgtg gcttcttgac acggcccact 1500

aggacagtgc attactactg gagacagttt gatgactcct tcatgagacc tgtttttgga 1560

gggcgtggct ttgtcccttt cgtccctggt tctccaacgg agagagaccc ccctcctact 1620

gatctcagta gagcttgata gtatgtgtgc attgtgtaat gtttttatat ttgtattatt 1680

tgtttgtgag ggacagagag ctgtccctac gttttga 1717

<210>8

<211>545

<212>PRT

<213> transporter of radish salt-tolerant gene RsNHX1 (RaphaussatusL)

<400>8

Met Met Ala Ser Leu Leu Asp Ser Leu Val Ser Arg Met Ala Ser Phe

1 5 10 15

Ser Ala Ser Asp His Ala Ser Val Val Ser Leu Asn Leu Phe Val Ala

20 25 30

Leu Leu Cys Ala Cys Ile Val Leu Gly His Leu Leu Glu Glu Asn Arg

35 40 45

Trp Met Asn Glu Ser Ile Thr Ala Leu Leu Ile Gly Leu Ala Thr Gly

50 55 60

Val Val Ile Leu Leu Ile Ser Asn Gly Lys Ser Ser His Leu Leu Val

65 70 75 80

Phe Ser Glu Asp Leu Phe Phe Ile Tyr Leu Leu Pro Pro Ile Ile Phe

85 90 95

Asn Ala Gly Phe Gln Val Lys Lys Lys Gln Phe Phe Arg Asn Phe Val

100 105 110

Thr Ile Met Leu Phe Gly Ala Ile Gly Thr Val Ile Ser Cys Thr Val

115 120 125

Ile Thr Leu Gly Val Thr Gln Phe Phe Lys Lys Leu Asp Ile Gly Thr

130 135 140

Phe Asp Leu Gly Asp Tyr Leu Ala Ile Gly Ala Ile Phe Ala Ala Thr

145 150 155 160

Asp Ser Val Cys Thr Leu Gln Val Leu Asn Gln Asp Glu Thr Pro Leu

165 170 175

Leu Tyr Ser Leu Val Phe Gly Glu Gly Val Val Asn Asp Ala Thr Ser

180 185 190

Val Val Ile Phe Asn Ala Ile Gln Ser Phe Asp Leu Thr His Leu Asn

195 200 205

His GluAla Ala Phe Gln Leu Leu Gly Asn Phe Phe Tyr Leu Phe Ile

210 215 220

Leu Ser Thr Leu Leu Gly Val Ala Thr Gly Leu Ile Ser Ala Tyr Cys

225 230 235 240

Ile Lys Lys Leu Tyr Phe Gly Arg His Ser Thr Asp Arg Glu Val Ala

245 250 255

Leu Met Met Leu Met Ala Tyr Leu Ser Tyr Met Leu Ala Glu Leu Phe

260 265 270

Asp Leu Ser Gly Ile Leu Thr Val Phe Phe Cys Gly Ile Ala Met Ser

275 280 285

His Tyr Thr Trp His Asn Val Thr Glu Ser Ser Arg Ile Thr Thr Lys

290 295 300

His Thr Phe Ala Thr Leu Ser Phe Leu Ala Glu Thr Phe Ile Phe Leu

305 310 315 320

Tyr Val Gly Met Asp Ala Leu Asp Ile Asp Lys Trp Arg Ser Val Ser

325 330 335

Asp Ser Pro Gly Thr Ser Val Ala Val Ser Ser Ile Leu Ile Gly Leu

340 345 350

Leu Met Leu Gly Arg Ala Ala Phe Val Phe Pro Leu Ser Phe Leu Ser

355 360 365

Asn Leu Gly LysLys Asn Gln Ser Glu Lys Ile Asp Phe Lys Thr Gln

370 375 380

Val Val Ile Trp Trp Ser Gly Leu Met Arg Gly Ala Val Ser Met Ala

385 390 395 400

Leu Ala Tyr Asn Lys Phe Thr Arg Ala Gly Lys Thr Asp Leu Arg Gly

405 410 415

Asn Ala Ile Met Ile Thr Ser Thr Ile Thr Val Cys Leu Phe Ser Thr

420 425 430

Val Val Phe Gly Met Leu Thr Lys Pro Leu Ile Arg Phe Leu Leu Pro

435 440 445

His Gln Lys Ala Thr Thr Ser Phe Leu Ser Asp Gly Asn Asn Thr Pro

450 455 460

Lys Ser Ile Gln Ile Pro Leu Ile Asp Gln Asp Ser Phe Ile Glu Phe

465 470 475 480

Ala Gly Asn Pro Asn Val Pro Arg Pro Asp Ser Ile Arg Gly Phe Leu

485 490 495

Thr Arg Pro Thr Arg Thr Val His Tyr Tyr Trp Arg Gln Phe Asp Asp

500 505 510

Ser Phe Met Arg Pro Val Phe Gly Gly Arg Gly Phe Val Pro Phe Val

515 520 525

Pro Gly Ser Pro Thr GluArg Asp Pro Pro Pro Thr Asp Leu Ser Arg

530 535 540

Ala

545

<210>2

<211>26

<212>DNA

<213>RsNHX1-F(Artificial Sequence)

<400>2

cgggatccaa gaggaaattg gtggat 26

<210>3

<211>26

<212>DNA

<213>RsNHX1-R(Artificial Sequence)

<400>3

ggggtaccct caaaacgtag ggacag 26

<210>4

<211>19

<212>DNA

<213>RsActin-F(Artificial Sequence)

<400>4

gcatcacact ttctacaac 19

<210>5

<211>19

<212>DNA

<213>RsActin-R(Artificial Sequence)

<400>5

cctggatagc aacatacat 19

<210>6

<211>19

<212>DNA

<213>RsCPA31-F(Artificial Sequence)

<400>6

gaaggtgttg tgaatgatg 19

<210>7

<211>18

<212>DNA

<213>RsCPA31-R(Artificial Sequence)

<400>7

agtaaggtgc tgaggata 18

Claims

1. A radish salt-tolerant gene RsNHX1 is characterized in that the nucleotide sequence of the radish salt-tolerant gene RsNHX1 is shown in SEQ ID NO. 1.

2. A transporter containing the salt-tolerant gene RsNHX1 of claim 1.

3. The transporter protein according to claim 2, wherein the amino acid sequence is as shown in SEQ ID No. 2.

4. A method for obtaining a radish salt-tolerant gene RsNHX1 is characterized by comprising the following steps: the acquisition method comprises the following steps:

1) selecting a variety of 'NAU-XBC' to extract RNA;

2) reverse transcription to obtain 'NAU-XBC' cDNA;

5. The radish salt-tolerant gene RsNHX1 as claimed in claim 1, an overexpression vector, an inhibition expression vector, a cell or a recombinant bacterium of the transporter as claimed in claim 2.

6. The overexpression vector of claim 5, wherein the overexpression vector is pCAMBIA2301-RsNHX 1.

7. An expression inhibiting vector of a radish salt-tolerant gene RsNHX1 is characterized in that the expression inhibiting vector is pTY-RsNHX 1.

8. Application of the radish salt-tolerant gene RsNHX1 of claim 1, the transporter of claim 3, the overexpression vector, the suppression expression vector, the cell or the recombinant bacterium of claim 5 in cultivation of salt-resistant arabidopsis thaliana or salt-tolerant radish.

9. The use of claim 8, wherein the conditions for cultivating the salt-tolerant radish are: the treatment was performed under hydroponic salt-added stress conditions, with a salt concentration of 250mM NaCl.