CN113789312B - Eggplant E3 ubiquitin ligase gene SmDDA1b and application thereof in extracting Gao Qing blight resistance - Google Patents

Abstract

The invention belongs to the technical field of molecular biology and discloses an eggplant E3 ubiquitin ligase gene SmDDA1b and application thereof in extracting Gao Qing bacterial wilt resistance. The research is expected to provide theoretical reference for molecular mechanism of eggplant bacterial wilt resistance.

Description

Eggplant E3 ubiquitin ligase gene SmDDA1b and application thereof in extracting Gao Qing blight resistance

Technical Field

The invention belongs to the technical field of molecular biology, and in particular relates to an eggplant E3 ubiquitin ligase gene SmDDA1b and application thereof in extracting Gao Qing blight resistance.

Background

Eggplant (Solanum melongena l.) is a annual or perennial vegetable crop of the genus Solanaceae (Solanaceae), originating in india and southwestern china. Is a summer vegetable widely cultivated in Asia, mediterranean, european and southeast Europe. The eggplant is rich in nutrition, protein, fat, carbohydrate and various trace elements, and is rich in vitamin P and solanine, has the effects of protecting cardiac and cerebral vessels, resisting aging and the like, can be eaten by vegetables and fruits, can be used as medicines for roots, stems and leaves, and can be used as anesthetic.

However, eggplants are susceptible to attack by diseases, especially bacterial wilt, and the quality of the eggplants can be reduced, so that the yield of the eggplants is greatly reduced. When the eggplant is affected by bacterial wilt, the yield is generally reduced by 20-30%, and the yield can reach 50-60% in severe cases. The serious economic loss and the current situation of difficult management caused by bacterial wilt have seriously threatened the production and development of solanaceae plants. It is found that many crops of Solanaceae are not resistant to bacterial wilt, and most of eggplant disease-resistant varieties which are not resistant to bacterial wilt are half-cultivated varieties or wild varieties. At present, the genetic report of the disease resistance of the bacterial wilt of the Solanaceae is various, and no theories exist so far.

The existing verified resistance related genes of the bacterial wilt of the eggplant are fewer, the resistance of the eggplant to the bacterial wilt relates to various factors, the molecular mechanism is complex, and the method is still unclear. Xiao et al verify that the eggplant RE-bw gene is an important gene for resisting bacterial wilt and can interact with the bacterial wilt non-toxic effector Popp 2. Shao Xinxin researches find that the eggplant ERF transcription factor SmERF participates in the bacterial wilt resistance process, and SmERF related genes SmERF66 and SmERF88 of eggplant bacterial wilt resistance are obtained. Li Ke and the like verify that the eggplant EDS1 gene has positive regulation and control effect on bacterial wilt resistance through a gene silencing (VIGS) technology. Meanwhile, chen et al perform functional identification analysis on the SmNAC transcription factor of the eggplant to obtain the resistance of the SmNAC to the bacterial wilt of the eggplant. The research of Qia et al shows that the external Shi Ya spermine (Spd) can obviously improve the resistance of eggplants to bacterial wilt, and the R2R3-MYB transcription factor SmMYB44 can be directly combined with the promoter of the spermidine synthase gene SPDS and enhance the expression of the promoter, so that the synthesis of spermidine is promoted.

Ubiquitin (Ub), a conserved low molecular weight (8.5 kDa) protein commonly found in eukaryotes, was first found in calf thymus and consisted of 76 amino acids. Ubiquitin is involved in almost all aspects of eukaryotes, including growth and immune regulation. The Ubiquitin/26S protease system (Ubiquitin/26S Proteasome System,UPS) is a conserved system leading ubiquitination, consisting of 5 basic parts of Ubiquitin, ubiquitin activating enzyme (E1), ubiquitin binding enzyme (E2), ubiquitin ligase (E3) and 26S proteasome, the central component being Ubiquitin molecules, ubiquitin binding to target proteins through E1, E2 and E3 interactions, thereby altering protein composition and regulating functions of eukaryotes. In the ubiquitin system, the number of genes for the E3 ligase is relatively high and plays an important role in recognizing substrate specificity.

Unlike the E1 activating enzyme and the E2 binding enzyme, the E3 ligase is numerous and diverse. According to the prior report, E3 ligase is mainly divided into three families, HECT E3s, RING E3s and RBR E3s according to the structural characteristic domain and the action mechanism for transmitting ubiquitin to target proteins. Of these, the RING type family is the largest, containing a zinc binding domain or U-box binding domain known as RING. Structurally, the RING domain is similar to the U-box domain, but the U-box domain transfers ubiquitin from E2 to the target protein primarily through salt bridges, ion chelation, and hydrogen bonding. While the RING domain transfers ubiquitin primarily through the chelation of 8 amino acids with zinc ions to form a covalent bond. CRLs (cullin-RING-ligands) are multi-subunit complexes, and are also the largest of the RING-type families, consisting mainly of cullin proteins, RING proteins, substrate receptors, and Adaptor proteins. The pellin protein serves as a core scaffold, the C-terminus anchors the RING protein, and the N-terminus interacts with an adapter of the CRL, which aids in the attachment of the CRL to the substrate receptor. Ubiquitination modification post-translational modification by conformational activation of CRLs, altering the Cullin-RING interface, covalent linkage to NEDD8, to activate ligase activity.

Research shows that the E3 ligase not only regulates the growth and development of plants, but also plays an important role in the aspect of stress resistance of plants. In Arabidopsis, MIEL1 is a RING type E3 ligase, a negative regulator of the defensive response. StPUB17 is taken as an E3 ligase, is a known target protein of E3s StPOB1, has been proved to positively regulate plant diseases such as late blight and the like, and recent researches show that a degradation substrate of StPUB17 is RNA binding protein StKH17, the gene negatively regulates plant immunity, and the function of StKH17 needs to be combined with RNA for running. UPS can also be involved in stress as a positive regulator. In tobacco, E3 ligase NbUbE3R1 positively regulates immune response, and experiments of VIGS, Y2H and co-IP show that the replicase of BaMV is a possible substrate of NbUbE3R 1. Desaki et al found that E3 ubiquitin ligase PUB4, which positively regulates plant immune response, interacted with LysM receptor like kinase CERK 1.

In addition, E3 ligases mediate a variety of plant signaling pathways in plants, including hormones and the like. Hana et al have shown that apple U-box E3s MdPUB29 enhances plant resistance to Rhizoctonia cerealis (Botryosphaeria dothidea) by modulating the SA pathway. Whereas BTB-BACK domain E3s MdPOB1 in apple regulates apple H by degrading MdPUB29 ₂ O ₂ Content, relative expression level of SA-related genes and signal genes thereof. TIR1 is a substrate recognition subunit of the SCFAR 1 ligase, which can proteolytically degrade the transcription repressor of Aux/IAA proteins. The SA pathway signaling gene NPR1 may be a ubiquitinated substrate of CUL3, which interact indirectly through the adapter protein. In arabidopsis, the E3 ubiquitin ligase atare can negatively regulate ABA signaling.

The presence of E3 ubiquitin ligase in UPS plays an important role in the pathway of degrading proteins in plant cells, and many studies indicate that E3 ligase plays a role in plant disease resistance. Eggplants are important cash crops, are vulnerable to bacterial wilt, have serious influence on the economic value, have more researches on the bacterial wilt resistance of the eggplants, and have few reports on the bacterial wilt resistance of the eggplants E3 ubiquitin ligase, so that the research on the bacterial wilt resistance of the eggplants by the E3 ubiquitin ligase gene can provide theoretical reference and breeding value for the bacterial wilt resistance of the eggplants.

Disclosure of Invention

The technical problem to be solved by the invention is to overcome the problems in the prior art, and firstly, an eggplant E3 ubiquitin ligase gene SmDDA1b is provided.

The second object of the present invention is to provide the application of eggplant E3 ubiquitin ligase gene SmDDA1b.

A third object of the present invention is to provide a method for improving resistance to bacterial wilt of eggplants.

The aim of the invention is achieved by the following technical scheme:

eggplant E3 ubiquitin ligase gene SmDDA1b, the nucleotide sequence of which is shown in SEQ ID NO:1, the coded amino acid sequence is shown as SEQ ID NO: 2. The ORF of SmDDA1b is 504bp,167 amino acids, 18.27kDa, with DDA1 domain, belonging to the main component of the CRL DDB type E3 ubiquitin ligase.

The invention also provides biological materials comprising the gene SmDDA1b, including but not limited to vectors, plasmids, host cells, plants.

In the study, the subject group takes 417bp base containing NAM domain at N end of negative regulation transcription factor SmNAC of eggplant for resisting bacterial wilt as bait, and obtains E3 ubiquitin ligase gene SmDDA1b after screening eggplant cDNA library, and performs function verification. The E3 ubiquitin ligase gene SmDDA1b which has the most obvious result and is not subjected to functional verification is initially screened out by experiments such as VIGS and the like, and then an over-expression experiment is carried out on the E3 ubiquitin ligase gene SmDDA1b, so that the E3 ubiquitin ligase gene SmDDA is verified to have positive regulation and control effect on plant bacterial wilt resistance, and is presumed to be an important gene for resisting bacterial wilt of eggplants.

Therefore, the invention also provides application of the eggplant E3 ubiquitin ligase gene SmDDA1b in developing and screening functional products of eggplant resistance to bacterial wilt.

Preferably, the functional product has the function of up-regulating the expression, transcription or expression product thereof of the SmDDA1b gene.

More preferably, the functional product is selected from one or two of a substance for promoting expression of the SmDDA1b gene, and a recombinant construct of SmDDA1b gene over-expression gene.

From hormone treatment experiments, VIGS, over-expressed hormone signaling pathway gene expression and over-expressed SA content measurement results can be obtained, smDDA1b is positively regulated by the SA pathway and the JA pathway in the defense reaction against eggplant bacterial wilt, and signaling pathway genes of SA and JA can be targeted, so that preferably, the expression of SmDDA1b gene is positively regulated by the SA pathway.

The invention also provides a method for improving the bacterial wilt resistance of the eggplants, which comprises the following steps:

s1, constructing an overexpression vector taking SmDDA1b gene as a target gene;

s2, transforming the constructed over-expression vector into eggplant;

s3, screening to obtain positive transgenic eggplants.

Compared with the prior art, the invention has the following beneficial effects:

the invention uses the negative regulation transcription factor SmNAC of the eggplant as a bait, screens the E3 ubiquitin ligase gene SmDDA1b from a cDNA library and performs function verification, and the result shows that the E3 ubiquitin ligase gene SmDDA1b of the eggplant positively regulates the eggplant to resist bacterial wilt. The research is expected to provide theoretical reference for molecular mechanism of eggplant bacterial wilt resistance.

Drawings

FIG. 1 shows the results of obtaining the E3 ubiquitin ligase gene SmDDA1b of eggplant, phylogenetic analysis, tissue-specific analysis, subcellular localization, bacterial wilt inoculation and hormone treatment; (A) Y2H results of SmNAC and SmDDA1b, BD-53 and AD-T cotransformation Y2H-Gold were positive controls, BD-Lam and AD-T cotransformation Y2H-Gold were negative controls; (B) Phylogenetic analysis of E3 ubiquitin ligase gene SmDDA1b; phylogenetic tree analysis of SmDDA1b and SmDDA1b homologous protein sequences in other different families, marked with different colors, protein sequences obtained from NCBI, the number on the branch representing the support, the larger the number, the higher the reliability, the highest the number is 100; (C) The relative expression of SmDDA1b in the root, stem part 1, stem part 2 and leaf of eggplant "E31", "E32"; error bars represent standard deviations of 3 biological replicates, "+" represents p-values of both data less than 0.05 and greater than 0.01 with significant differences, "+" represents p-values of both data less than 0.01 with significant differences; (D) Is a schematic diagram of tissue parts of eggplant seedlings, which are respectively a leaf, an upper part of a stem, a lower part of the stem and a root, wherein a white scale in the diagram represents the length of 5 cm; (E) Analyzing the relative expression condition of SmDDA1b in 24h after inoculating bacterial wilt in E31 and E32, wherein the sampling time is 0h, 1h, 3h, 6h, 12h and 24h after inoculating bacterial wilt, error bars represent standard deviations of 3 biological repetitions, multiple comparison results among the data are represented by adopting a letter mark method (p < 0.05), and final results are represented as the relative expression quantity of genes of a treatment group relative to genes of a control group; (F) E31 is treated by SA and MeJA, the relative expression condition of SmDDA1b in 24h, sampling time is respectively 0h, 1h, 3h, 6h, 12h and 24h after hormone treatment, error bars represent standard deviations of 3 biological repetition, multiple comparison results among the data are expressed by adopting a letter mark method (p < 0.05), and final results are expressed as relative expression quantity of genes of a treatment group relative to genes of a control group; (G) subcellular localization results of SmDDA1b. The subcellular localization material is Nicotiana benthamiana, bright represents the Bright field of the tobacco of a fluorescence microscope, GFP represents green fluorescence emitted by cell nuclei or cell membranes and the like, the subcellular level expression of the gene is carried out at the subcellular localization material, NLS represents red fluorescence emitted by the cell nuclei, and Merge represents the combination of the above three materials as a reference; the red scale for Bright and merge and the white scale in GFP and NLS figures each represent a length of 1 mm; (H) The BiFC results of SmDDA1b and SmNAC indicate that the material is tobacco; proteasome inhibitor MG132 was injected after YNE-SmDDA1b and YCE-SmNAC agrobacterium coinjection; the red scale and the white scale in the YFP, NLS, bright and Merge plots represent lengths of 1 mm;

FIG. 2 shows the SmDDA1b gene sequence and amino acid sequence; (A) The gene sequence of SmDDA1b, the total length of SmDDA1b is 504bp, the gene sequence comprises a DDA1 domain and an SAP domain, and the gene sequence is marked with red and blue green respectively; (B) The amino acid sequence of SmDDA1b, 76 amino acids in total, the domain comprising DDA1 and SAP, is marked red and blue-green, respectively;

FIG. 3 is a graph of the resistance detection of E31 and E32 to bacterial wilt; (a) phenotypes of day 0 and day 10 after E32 inoculation with ralstonia solanacearum; (B) phenotype of E31 on days 0 and 10 of E31 inoculated with ralstonia solanacearum; inoculating 81 strains E31 and 73 strains E32 respectively by utilizing the bacterial wilt GMI 1000; the results show that E32 shows a significant wilting phenotype and E31 has no significant change after 10 days of inoculation; the morbidity and disease index statistics show that the morbidity of E32 is 89.04%, the disease index is 47.6, and the composition belongs to a susceptibility material; the incidence rate of E31 is 11.11 percent, the disease index is 2.78, and the material belongs to high-resistance materials; the size of the hole tray is 5×10, and 50 holes are formed in the hole tray;

FIG. 4 shows the result of a VIGS experiment of the E31 ubiquitin ligase gene SmDDA1b; (A) After silencing the SmDDA1b gene of E31, the relative expression of the SmDDA1b gene in control plants (plants injected with pTRV2 and pTRV1 agrobacterium only) and treated plants (plants injected with pTRV2-SmDDA1b and pTRV1 agrobacterium) was analyzed; error bars represent standard deviations of more than three biological replicates. P values below 0.01 are considered to have very significant differences, expressed as x; (B) Counting the disease indexes of the control strain and the treated strain after E31 treatment after inoculating the bacterial wilt for 4 weeks; the disease class is classified into 0, 1, 2, 3, 4, 0 is plant noninductive, 1 is plant 1-2 leaf wilting, 2 is plant 3-4 leaf wilting, 3 is leaf wilting except top leaf, 4 is plant death, and the ordinate represents the percentage of the total number of plants of each disease class, and 10 plants E31 are silenced in the experiment. P-values below 0.01 were considered to have very significant differences, expressed as x, (C) 4 weeks after bacterial inoculation with ralstonia solanacearum, the E31-VIGS phenotype of control and treated plants changed, the white scale in the figure representing a length of 5 cm;

FIG. 5 shows the results of an experiment for overexpression of SmDDA1b in tomato; (A) At the DNA level, bar gene verification of the tomato single plant line obtained by tissue culture; (B) On the RNA level, smDDA1b gene relative expression amount analysis of the tomato single strain obtained by tissue culture is carried out. P (P)<0.05, p<0.01, expressed in x; (C) Wild tomato seedlings (WT) and transgenic tomato seedlings (OET) ₁ ) Phenotype at day 7 after bacterial infection, including front, near and top; (D) Wild tomato seedlings and transgenic tomato Miao Jiechong phenotype of 14 days after bacterial wilt, CK represents wild type and transgenic tomato seedlings which are simultaneously cultured under the same conditions and are not inoculated with bacterial wilt; (E) Statistical plot of morbidity of wild-type tomato seedlings and overexpressed tomato seedlings at 14 days of inoculation, where OET _1-12 ，OET _1-17 OET (optical emission test) _1-31-2 Over-expressed single strain, OET ₁ Represents the average incidence of 3 overexpressing lines; (F) Statistical plot of disease index of wild tomato seedlings and overexpressed tomato seedlings at 14 days of inoculation, wherein OET _1-12 ，OET _1-17 OET (optical emission test) _1-31-2 Respectively is the overstockReaching single strain, OET ₁ Mean disease index representing 3 overexpressing lines; (G) SA content measurement results of wild tomato seedlings inoculated and not inoculated with ralstonia solanacearum and tomato seedlings overexpressing SmDDA1b; the significance differences are noted by letter method;

FIG. 6 is an analysis of expression of SA pathway signal genes in VIGS and overexpression; (A) Analysis results of SA path signal gene expression conditions in VIGS plants, wherein pTRV2 represents a control plant and p-SmDDA1b represents a VIGS treated plant pTRV2-SmDDA1b; (B) Analysis results of SA pathway signal gene expression conditions in the over-expression plants show that OET0 represents a T0 generation tomato over-expression plant, and WT represents a wild plant; p-value values above 0.01, below 0.05 are considered significant differences, expressed as a x, P-value values below 0.01 are considered very significant differences, expressed as a x. Dots of different colors represent different biological replicates, and dots of the same color represent technical replicates.

Detailed Description

The following describes the invention in more detail. The description of these embodiments is provided to assist understanding of the present invention, but is not intended to limit the present invention. In addition, the technical features of the embodiments of the present invention described below may be combined with each other as long as they do not collide with each other.

The test methods used in the following examples and experimental examples are all conventional methods unless otherwise specified; materials, reagents, and the like used, unless otherwise specified, are commercially available reagents and materials; the equipment used, unless otherwise specified, is conventional experimental equipment.

Plant material: eggplant material used the eggplant high resistance bacterial wilt inbred line "E31" (R) and the eggplant high susceptibility bacterial wilt inbred line "E32" (S) taught well by soh on agricultural university in south China (guangzhou, guangdong) (fig. 2, table 4). Tomato material used was the Money Maker variety from the agricultural university of south China (Guangzhou, guangdong) Zhengkun teacher, which is a material that is not resistant to bacterial wilt. Tobacco is Nicotiana benthamiana, and is provided by the subject group. Eggplant cDNA libraries are provided by the subject group.

EXAMPLE 1 cloning of SmDDA1b Gene

RNA extraction, reverse transcription of cDNA and RT-qPCR data analysis reference Qia et al (2019), the relative expression level was used

Is->

Calculation method (primer reference table 1). Dicots of another 14 sequenced whole genomes were selected uniformly from phylogenetic trees (Table 2), all protein sequences of each species were downloaded from NCBI, and only the longest was retained for different alternative spliceosomes belonging to the same gene. The hidden Markov model file for DDA1 was downloaded from the PFAM database and hmmsearch v3.3 was used to extract the protein sequences containing DDA1 for each species. The obtained protein sequence was subjected to multiple sequence alignment with two protein sequences containing DDA1 of eggplant using mafft v7.455, and a phylogenetic tree was constructed using iqtree v 1.6.12. hmmsearch uses the "- -cut_nc" parameter to calculate bootstrap values, except that the iqtree uses the "- -bb" parameter, all of which use default parameters. Phylogenetic trees were drawn using iTOL.

For all protein sequences containing DDA1, the domains owned by these sequences were scanned and mapped using ggplot2, aligned with Pfam-a database. By combining the phylogenetic tree and domain diagrams, it was found that, as early as the dicotyledonous plant emergence, DDA1 was split into two different genes, one comprising only DDA1 and the other, the branch in which SmDDA1b is located, comprising both DDA1 and SAP domains. The present study focused on the latter, and then the branches were extracted to obtain phylogenetic trees in the article.

TABLE 1 qRT-PCR analysis primers used

/>

TABLE 2 SmDDA1b homologous Gene accession numbers of 14 dicots

Results: the subject group previously studied to obtain negative control transcription factor SmNAC for resisting bacterial wilt of eggplant, constructing 139 amino acids containing NAM domain at N end of SmNAC in pGBKT7 vector as bait protein, screening eggplant cDNA library to obtain E3 ubiquitin ligase gene SmDDA1b (figure 1A). The ORF of SmDDA1b is 504bp,167 amino acids, 18.27kDa, with DDA1 domain, belonging to the main component of the CRL DDB type E3 ubiquitin ligase. In arabidopsis, the DDA1 gene (Q9 FFS 4) has been studied, which forms a protein complex with Cul4, DDB1, COP10 and DET1, binds Ub on E2 to abscisic acid (ABA) receptor protein PYL8, completing the ubiquitination process. In addition, DDA1 is a conserved fundamental component of the evolution of the CRL4 core complex, which can interact directly with DDB1, promoting substrate supplementation or modulating the overall topology of the CRL4 substrate complex. Meanwhile, smDDA1b also has an SAP domain, which is also relatively conserved, and SAP is thought to be involved in substrate recognition and activity of ligases, and is common to many SUMO E3. Phylogenetic analysis of SmDDA1b (FIG. 1B) showed that, of 15 dicots, the homologous proteins of SmDDA1b all contained DDA1 and SAP domains, indicating that the domains are more conserved in dicots and likely play a more important role in survival and evolution of plants. It is worth mentioning that there are only two genes comprising the DDA1 domain, one comprising only the DDA1 domain and the other comprising the DDA1 domain and the SAP domain (fig. 2).

EXAMPLE 2 SmDDA1b functional exploration

1. Tissue-specific analysis

Taking the roots, stems and leaves of E31 and E32 growing 4-5 true leaves respectively for tissue specificity analysis, extracting RNA, reversely transcribing cDNA and performingRT-qPCR, relative expression quantity is adopted

A calculation method.

2. Subcellular localization

A target gene fragment (5 '-end primer: ctgcccaaattcgcgaccggtATGGAGGATACCTCATCATCCATT;3' -end primer: gcccttgctcaccataccggtTGTGTCCCCCCTTAACCGTG) having a homology arm was ligated to the Age I single-digested pEAQ-EGFP vector by a one-step cloning method, screened by the E.coli (DH 5. Alpha.) heat shock method, and transferred into the GV3101 (pSoup) Agrobacterium strain. Streaking constructed Agrobacterium with nuclear localization NLS (Sun et al 2020), picking single colony at 28deg.C, shaking at 200rpm, shaking at later stage, centrifuging Agrobacterium solution at 6000rpm, removing supernatant, and washing with a washing solution (10 mM MgCL) ₂ 10mM MES,100 mu M AS) re-suspension thalli, standing and activating for 2 hours at 28 ℃, mixing the invasion solution containing the target gene agrobacterium with the invasion solution containing the nuclear localization agrobacterium according to the volume ratio of 1:1, injecting the invasion solution into tobacco by a headless injector to enable the tobacco leaves to be water-stained, and then placing the tobacco leaves in dark culture at 22 ℃ for 2-3 days. GFP fluorescence was visualized using a fluorescence microscope. This experiment was repeated at least three times.

3. Bimolecular fluorescence complementation experiment (BiFC)

The target gene and the gene to be verified are respectively constructed on pSPYNE-35S/pUC-SPYNE (YNE) and pSPYCE-35S/pUC-SPYCE (YCE) vectors (BamH I is used as a 5 '-end restriction endonuclease, sal I is used as a 3' -end) by a one-step cloning method to form a recombinant vector, and the recombinant vector is transferred into a GV3101 (pSoup) agrobacterium strain. Streaking constructed agrobacterium and nuclear localization NLS agrobacterium, picking single colony at 28 ℃, initially shaking at 200rpm, then shaking widely, centrifuging the agrobacterium liquid at 6000rpm, removing supernatant, resuspending thalli with a dip solution (10mM MgCL2, 10mM MES,100 mu M AS), adjusting OD600 to 0.6, standing at 28 ℃ for activation for 2 hours, mixing the dip solution containing YNE-target gene agrobacterium, YCE-target gene agrobacterium dip solution and the dip solution containing nuclear localization agrobacterium according to the volume of 1:1:1, injecting the dip solution into tobacco by a headless injector, making tobacco leaves water stain, and then placing the tobacco leaves in dark culture at 22 ℃ for 3-4 days. GFP fluorescence was visualized using a fluorescence microscope. This experiment was repeated at least three times.

TABLE 3 BiFC experiment primer summary table

Results: the SmDDA1b gene full length is cloned from E31, and whether the gene has the function of resisting bacterial wilt of eggplant or not is verified. Tissue specificity analysis was performed using eggplant disease-resistant material "E31" and disease-sensitive material "E32" (fig. 3) as materials. The results show that the SmDDA1b gene is expressed in the roots, stems and leaves of disease-resistant materials and disease-sensitive materials, and the expression quantity is maximum in the leaves, and the expression quantity of the SmDDA1b gene in the disease-resistant materials is generally higher than that of the disease-sensitive materials (figures 1C-D). Thereafter, it was subcellular localized to determine its expression region at the subcellular level, and the results indicated that pEAQ-EGFP-SmDDA1b only fluoresced in the nucleus, smDDA1b was expressed in the nucleus (fig. 1G), and BiFC results indicated that SmNAC interacted with SmDDA1b within the plant cell nucleus.

4. Bacterial wilt inoculation

The bacterial strain was GMI1000, supplied by the agricultural university of south china (guangzhou, guangdong). The inoculation method adopts a conventional root cutting and root irrigation method, and the disease index is divided into 5 grades (grade 0 is that plants do not attack, grade 1 is that 1-2 leaves wilt, grade 2 is that 3-4 leaves wilt, grade 3 is that leaves except the top end are wilt, and grade 4 is that plants die). And E31 and E32, after root breaking, carrying out clear water treatment on the control group, and inoculating bacterial wilt for treatment on the treatment group. Sampling is started in 8:00 a.m., samples of 0h, 1h, 3h, 6h, 12h and 24h are taken respectively, each sample contains 3 biological repeats, RNA is extracted, reverse conversion is carried out to cDNA, RT-qPCR is carried out, and the final result is expressed as the relative expression quantity of the genes in the treatment group relative to the genes in the control group. The multiple comparison results of the data at each time point are expressed by an letter mark method.

5. Hormone treatment

Eggplant seedlings of 4-5 true leaves were sprayed with 1mM SA (Jia et al, 2013;Mahesh et al, 2018) and 0.25mM MeJA (Deng et al, 2021), and the control group was sprayed with water and incubated in the dark at 26℃for 16h,22℃for 8 h. Samples were taken from 8:00 a.m., 0h, 1h, 3h, 6h, 12h, 24h, at least 3 biological replicates per time point, RNA extracted, and cDNA reverse transcribed for qPCR. Primers referring to table 1, the multiple comparison results of the data at each time point are expressed by letter notation.

Results: the E31 is treated by SA and MeJA, and the relative expression amount change of the SmDDA1b gene in one day after hormone treatment is measured by qPCR, as shown in FIG. 1F, after the E31 is treated by SA, the SmDDA1b shows a tendency of descending and ascending; the result shows that SA is sprayed in a short period, the gene expression is influenced by the SA, and finally the SA is in an ascending trend, so that the SA has a certain promoting effect on the gene expression; and after spraying MeJA on E31, the expression level of SmDDA1b continuously decreases, which indicates that the SmDDA1b expression can be inhibited by spraying the MeJA in a short period.

Then inoculating the bacterial wilt into eggplant disease-resistant material E31 and disease-sensitive material E32 respectively, qPCR measuring the relative expression quantity change of genes, analyzing whether the bacterial wilt infects different materials to mobilize the expression of SmDDA1b genes, and the result shows that the expression quantity of SmDDA1b in disease-resistant plants is in a trend of descending first and then ascending, and in disease-sensitive plants is in a trend of descending first and then gradually and gently, which indicates that the bacterial wilt infects the disease-resistant plants to improve the expression of SmDDA1b genes in E31 (figure 1E).

6. VIGS experiment

The specific fragment of 300bp is intercepted from the target gene, and is constructed on pTRV2 vector by adopting a method of double enzyme digestion (EcoR I is the 5 '-end enzyme digestion site, ggaattcCCTCCGAACAATGCCACA is the primer, sma I is the 3' -end enzyme digestion site, tcccccgggGAAATCCCCTTGCCGTCT is the primer), and then transferred into the Agrobacterium GV3101 strain. E31 plants of 4-5 real leaves are treated by clear water and pTRV2 is injected according to the volume ratio of 1:1, pTRV1 empty-load agrobacterium tumefaciens bacteria liquid plants are used as a control, pTRV2-SmDDA1b and pTRV1 empty-load agrobacterium tumefaciens bacteria liquid are used as a treatment group, E31 plants are injected according to the volume ratio of 1:1, the treatment is carried out for one day under the dark condition after injection, then normal culture is carried out for 1-2 weeks, (26 ℃,16h light, 22 ℃,8h dark), at least 10 biological replicates per treatment, post-sampling, RNA and qPCR were performed. Then adopting a root-cutting and root-filling method to carry out bacterial wilt (GMI 1000) inoculation (OD) ₆₀₀ =0.6), the phenotype was observed around one month of inoculation.

Results: to further verify whether the E3 ubiquitin ligase gene SmDDA1b was resistant to bacterial wilt in eggplant, a gene silencing (VIGS) experiment was performed on it and the disease index after bacterial wilt inoculation was counted, liu et al (2005) established a resistance evaluation criterion for eggplant against bacterial wilt (Table 5). The results showed that, after the gene expression level of SmDDA1B in the high-resistance material E31 was reduced, bacterial wilt was inoculated (FIG. 4A), E31 showed obvious disease symptoms, and the incidence rate reached 100%, and the incidence index was 70, belonging to the high-susceptibility bacterial wilt level of eggplants (FIG. 4B-C). Preliminary demonstration that SmDDA1B is associated with eggplant resistance to bacterial wilt and may be a key site in the eggplant resistance to bacterial wilt network (fig. 4B).

7. Overexpression experiments

The 5 '-end upstream primer gagaacacgggggactctagaATGGAGGATACCTCATCATCCATTC and the 3' -end downstream primer gtggctagcgttaacactagtTCATGTGTCCCCCCTTAACCG are utilized to amplify the SmDDA1b fragment of the over-expression target gene, then the restriction endonuclease Xba I and Spe I37 ℃ are utilized to double-enzyme cut the over-expression vector pCAMBIA-1380 for 1h, the holy one-step cloning kit is utilized to carry out vector recombination, the universal primer (5 '-upstream primer GGCTCCTACAAATGCCATCATTGCG;3' -downstream primer ATAATTTATCCTAGTTTGCGCGC) of pCAMBIA-1380 is utilized to detect, and the recombinant over-expression vector is obtained and then transferred into the GV3101 agrobacterium strain. The tomato over-expression plants are obtained by adopting an agrobacterium-mediated transformation method. MM tomato seeds were first sown in tissue culture flasks containing MS solid medium (MS powder 4.43g/L, sucrose 30g/L,0.5% plant gel), after two cotyledons had grown, the cotyledon middle sections and hypocotyls were cut off and placed as explants on solid preculture medium (MS solid medium, 0.2. Mu.g/L trans-zeatin TZT) and incubated in darkness at 26℃for 1 day. The recombinant vector-containing Agrobacterium was centrifuged at 6000rpm for 5min, the supernatant was removed, the cells were resuspended in MS medium to an OD600 of 0.6, and 100. Mu.M AS was added and allowed to stand in the dark at 28℃for 1h. Placing the explant which is pre-cultured for 1 day into an invasion dye solution, carrying out dark shaking infection for 10 minutes, filtering the invasion dye solution, sucking water of the explant by using filter paper, placing the explant on a solid pre-culture medium, carrying out dark culture at 28 ℃ for 1 day, then placing a solid screening culture medium (MS solid culture medium, TZT of 2 mug/L, tim of 0.2mg/L, IAA of 0.5 mug/L and corresponding antibiotics) into the solid pre-culture medium, carrying out normal culture (26 ℃,16h of illumination, 22 ℃ and 8h of darkness) and changing every two weeks, selecting the explant which grows well for continuous experiment, transferring into bud elongation (MS solid culture medium when the explant grows callus and buds are differentiated, and (3) continuously elongating buds in a culture medium of 0.2 mug/L TZT,0.2mg/L Tim and corresponding antibiotics, cutting off buds when the stems grow to about 3-4cm, inserting the buds into a rooting culture medium (MS solid culture medium, 0.2mg/L Tim,0.5 mug/L IAA and corresponding antibiotics) for rooting, opening a cover for seedling training when plants root and grow to a bottle cap, transferring the plants into sterilized soil after one week, sleeving a transparent plastic bag for treating for one week, sampling, detecting the DNA of plant bar genes (5 '-end upstream primer ATGAGCCCAGAACGACGCCCG and 3' -end downstream primer TTAGATCTCGGTGACGGGCAGGACC), detecting the relative expression quantity of SmDDA1b genes, and completing an over-expression experiment.

8. Yeast double hybridization (Y2H)

A SmNAC N-terminal 417bp fragment with homology arms was ligated to EcoR I (5 'terminal) and BamH I (3' terminal) double digested pGBKT7 vector using a one-step cloning method, with specific primers being 5 'terminal upstream primer atggccatggaggccgaattcATGGGTGTTCAAGAAAAAGATCCT,3' terminal downstream primer ccgctgcaggtcgacggatccTAATCTATATTCATGCATGATCCAATTAG. Making yeast Y2H Gold competence, streaking Y2H Gold strain on YPDA plate, culturing at 30deg.C for 2-3 days, picking single colony of yeast with diameter of 2-3mm, inoculating into 3-4ml YPDA culture medium, culturing at 30deg.C and 220rpm for 12-18H, adding 50ml YPDA until it is concentrated, continuously shaking for 3-5H, shaking, centrifuging at 3000rpm for 5min, removing supernatant, and adding 30ml ddH ₂ O is resuspended and washed twice, supernatant is removed by centrifugation, and 1ml of 1 xTE/LiAc prepared at present is used for resuspension, thus obtaining competence.

Mu. l Y2H Gold competent is taken and placed in a 1.5ml centrifuge tube, 0.5. Mu.g pGBKT7-bait and cDNA library plasmid (0.5. Mu.g) are added, 5. Mu.l Carry DNA and 600. Mu.l sterile PEG/LiAc solution are mixed uniformly, cultured for 20min at 30℃under shaking at 200rpm, then 70. Mu.l DMSO is added and mixed uniformly, water bath at 42℃is carried out for 15min, and ice bath is carried out for 2min. The cells were resuspended in 100. Mu.l of 1 XTE buffer at room temperature 14000rpm for 15s, centrifuged, and the supernatant was applied to the corresponding defect medium for 100. Mu.l, and cultured upside down at 30℃for 3-4 days.

Results: and (3) performing an overexpression experiment on the SmDDA1b by taking a tomato Money Marker as a material to obtain a plant capable of stabilizing a genetic gene, and verifying the function of the SmDDA1b from the front. By performing bar gene detection on tomato seedlings obtained by tissue culture, 12T obtained from 60 tissue culture seedlings ₀ Transgenic plants (figure 5A) are replaced, the relative expression amount of SmDDA1b gene is detected by using RT-qPCR technology, and 3 single plants with better over-expression effect are selected to carry out T ₁ Reproduction of the generation, respectively T _0-12 ，T _0-17 T and T _0-31-2 (FIG. 5B). Then for the obtained T ₁ The bacterial wilt inoculation of the generation strain and the wild tomato seedling shows that the disease time of the wild tomato seedling and the over-expression tomato seedling is the same, and the disease occurs the fifth day after bacterial wilt inoculation, but the disease rate and the disease index of the wild plant are obviously higher than those of the over-expression plant within 14 days after bacterial wilt inoculation (figures 5E-F and table 6). WT and over-expressed plants on days 7 and 14 after bacterial wilt inoculation were observed, with wild-type tomato seedlings substantially wilting, over-expressed tomato seedlings exhibiting partial wilting and a more wilt resistant phenotype than the wild-type plant phenotype (fig. 5C-D, table 7). The result shows that the over-expression of SmDDA1b can improve the resistance of plants to bacterial wilt, and the SmDDA1b has the function of resisting bacterial wilt. SA content measurement is carried out on wild tomato seedlings and over-expression SmDDA1b tomato seedlings which are inoculated with and not inoculated with the bacterial wilt, the result shows that the SA content of the wild tomato seedlings which are not inoculated with the bacterial wilt is obviously lower than that of the over-expression tomato seedlings, after the bacterial wilt is inoculated, the SA content of the wild tomato seedlings is obviously lower than that of the over-expression tomato seedlings, and the SA content of the wild tomato seedlings is obviously higher than that of the over-expression tomato seedlings, so that the SA content of the plants can be induced to be increased when the plants are subjected to biological stress, meanwhile, the SmDDA1b has correlation with SA paths, the SA content can be induced to be increased by over-expression SmDDA1b, and the plants show stronger disease resistance.

Meanwhile, the gene expression quantity analysis of hormone signal paths is carried out on SmDDA1b over-expression plants and VIGS plants. Among the SA pathway signal genes, 8 genes for positive regulation of resistance to eggplant bacterial wilt are selected from EDS1, gluA, NPR1, TGA, SGT1, PAD4, PR-1a and ICS 1. The SA pathway signaling genes in VIGS were found to show significant differences compared to the control, except for TGA, and the amount of SA pathway signaling gene expression was reduced in the silenced plants (FIG. 6A). In the over-expressed plants, the amount of the SA pathway signal gene was significantly different from that of the wild type except PR-1a, and the amount was increased. This result preliminarily indicates that the SA pathway positively regulates expression of SmDDA1B (fig. 6B).

Discussion: in the study, the subject group takes 417bp base containing NAM domain at N end of negative regulation transcription factor SmNAC of eggplant for resisting bacterial wilt as bait, and obtains E3 ubiquitin ligase gene SmDDA1b after screening eggplant cDNA library, and performs function verification. From the results, the expression trends of SmDDA1b after inoculating bacterial wilt in E31 and E32 are different, the disease-resistant plants firstly decline and then rise, and the disease-resistant plants firstly decline and then tend to be gentle. The results show that when plants are subjected to pathogenic stress, the innate immune system of the plants reacts, namely immune response (PTI) stimulated by pathogenic related molecular patterns and immune response (ETI) stimulated by effector proteins, wherein PTI is basic defense response and has non-specificity, and ETI is specific response caused by the recognition of pathogenic effector proteins by disease-resistant proteins (R proteins) of the plants. When the plant is stressed by pathogen, the plant firstly makes nonspecific defense reaction, and then the pathogen releases effector protein to inhibit PTI, so that E3 ubiquitin ligase SmDDA1b expression is in a descending trend in the disease-resistant plant and the disease-resistant plant, and then the plant performs ETI reaction, and at the moment, the SmDDA1b expression is increased in the disease-resistant plant. The result shows that E3 ubiquitin ligase SmDDA1b is likely to be a gene for positively regulating the bacterial wilt resistance of eggplants. Meanwhile, it was also demonstrated that the gene of E3 ubiquitin ligase was specific.

Bacterial wilt contains a variety of secretion systems, but acts primarily through type III secretion systems. T3SS may inject its effector into a host to cause a host to feel illness or Hypersensitivity (HR). Meanwhile, studies have shown that UPS in plants can specifically recognize pathogenic effectors and play a role in plant-pathogen interactions. Gabrile et al have shown that UPS can target the motor protein 69k of Turnip yellow mosaic virus and regulate its activity in vitro. In tobacco, RING type E3 ubiquitin ligase NtRFP1 can mediate geminivirus encoded βC1 degradation. In this process, depending on the specificity of SmDDA1b for the bacterial wilt defence reaction, it may interact with the toxic genes of bacterial wilt, i.e. effector proteins, ubiquitination and degradation of the same, thus carrying out plant defence reaction.

In addition, from hormone treatment experiments, the expression of the over-expressed hormone signaling pathway genes and the measurement result of the over-expressed SA content can be obtained, and SmDDA1b is positively regulated and controlled by the SA pathway and the JA pathway in the defense reaction against the eggplant bacterial wilt, and can target the signaling pathway genes of SA and JA. For example, previous studies have shown that the E3 ligase CUL3 ^BPM Can target MYC2, MYC3 and MYC4, reduce the abundance of MYC proteins, regulate and control JA pathway, etc.

The E3 ubiquitin ligase gene SmDDA1b which has the most obvious result and has not been subjected to functional verification is initially screened out by experiments such as VIGS and the like, and then an over-expression experiment is carried out on the E3 ubiquitin ligase gene SmDDA1b, so that the E3 ubiquitin ligase gene SmDDA is verified again to have positive regulation and control effect on plant bacterial wilt resistance, and is presumed to be an important gene for resisting bacterial wilt of eggplants.

TABLE 4 statistical Table of E31 and E32 disease indices of eggplant against bacterial wilt

TABLE 5 evaluation criteria for the disease index of eggplant against bacterial wilt

TABLE 6 statistical Table of morbidity and disease index of wild type tomato seedlings and over-expressed tomato Miao Jiechong bacterial wilt for 14 days

TABLE 7 statistics of morbidity and disease index 14 days after inoculation of wild type and overexpressed tomato with ralstonia solanacearum

/>

The embodiments of the present invention have been described in detail above, but the present invention is not limited to the described embodiments. It will be apparent to those skilled in the art that various changes, modifications, substitutions and alterations can be made to these embodiments without departing from the principles and spirit of the invention, and yet fall within the scope of the invention.

Sequence listing

<110> agricultural university of south China

<120> eggplant E3 ubiquitin ligase gene SmDDA1b and application thereof in extracting Gao Qing blight resistance

<130> ZM211189ZL

<160> 2

<170> SIPOSequenceListing 1.0

<210> 1

<211> 504

<212> DNA

<213> 2 Ambystoma laterale x Ambystoma jeffersonianum

<400> 1

atggaggata cctcatcatc cattcctccg aacaatgcca caacttccgg tgcggccaaa 60

tacctagccg gcctcccttc tcggggactc ttctcctcca acgtcctctc ctctactccg 120

ggtggaatgc gagtatatat ttgcgatcac gaaacgtcac ctccggagga ccagtttatt 180

aagacaaacc agcaaaacat attgattagg tctctcatgc ttaagaagca gagaggtgac 240

catagttcaa aagacggcaa ggggatttcc tcgaatgaca atggtagaaa aagagctgct 300

gaaaaaacat tggatagtag gacatcaaac aagaaggcta ccaccagtaa ccaagttgca 360

tctccccaag aaacttcaag aattcgtaca cctgacatac aaaatatgac tgttgagaag 420

ctacgggctc tgttaaagga gaaaggtctt tctctgagag gaaggaagga tgaactaatt 480

gcacggttaa ggggggacac atga 504

<210> 2

<211> 167

<212> PRT

<213> 2 Ambystoma laterale x Ambystoma jeffersonianum

<400> 2

Met Glu Asp Thr Ser Ser Ser Ile Pro Pro Asn Asn Ala Thr Thr Ser

1 5 10 15

Gly Ala Ala Lys Tyr Leu Ala Gly Leu Pro Ser Arg Gly Leu Phe Ser

20 25 30

Ser Asn Val Leu Ser Ser Thr Pro Gly Gly Met Arg Val Tyr Ile Cys

35 40 45

Asp His Glu Thr Ser Pro Pro Glu Asp Gln Phe Ile Lys Thr Asn Gln

50 55 60

Gln Asn Ile Leu Ile Arg Ser Leu Met Leu Lys Lys Gln Arg Gly Asp

65 70 75 80

His Ser Ser Lys Asp Gly Lys Gly Ile Ser Ser Asn Asp Asn Gly Arg

85 90 95

Lys Arg Ala Ala Glu Lys Thr Leu Asp Ser Arg Thr Ser Asn Lys Lys

100 105 110

Ala Thr Thr Ser Asn Gln Val Ala Ser Pro Gln Glu Thr Ser Arg Ile

115 120 125

Arg Thr Pro Asp Ile Gln Asn Met Thr Val Glu Lys Leu Arg Ala Leu

130 135 140

Leu Lys Glu Lys Gly Leu Ser Leu Arg Gly Arg Lys Asp Glu Leu Ile

145 150 155 160

Ala Arg Leu Arg Gly Asp Thr

165

Claims (6)

1. Eggplant E3 ubiquitin ligase geneSmDDA1bThe nucleotide sequence of the polypeptide is shown as SEQ ID NO:1, the coded amino acid sequence is shown as SEQ ID NO: 2.

2. Comprising the gene according to claim 1SmDDA1bIs characterized in that the biological material is a carrier.

3. Comprising the gene according to claim 1SmDDA1bIs characterized in that the biological material is a plasmid.

4. Upregulating the gene of claim 1SmDDA1bThe application of the functional product with the expression level in improving the resistance of eggplant bacterial wilt is characterized in that the functional product is a geneSmDDA1bAn over-expression vector.

5. The use according to claim 4, wherein the gene isSmDDA1bIs positively regulated by the SA pathway.

6. A method for improving resistance to bacterial wilt of eggplants, comprising the steps of:

s1 construction of the Gene according to claim 1SmDDA1bAs an over-expression vector for the target gene;

s2, transforming the constructed over-expression vector into eggplant;

s3, screening to obtain positive transgenic eggplants.

Images