NL2031934B1 - Proanthocyanidin transport-related gst protein gene in brown cotton fiber and use thereof - Google Patents

Proanthocyanidin transport-related gst protein gene in brown cotton fiber and use thereof Download PDF

Info

Publication number
NL2031934B1
NL2031934B1 NL2031934A NL2031934A NL2031934B1 NL 2031934 B1 NL2031934 B1 NL 2031934B1 NL 2031934 A NL2031934 A NL 2031934A NL 2031934 A NL2031934 A NL 2031934A NL 2031934 B1 NL2031934 B1 NL 2031934B1
Authority
NL
Netherlands
Prior art keywords
gene
proanthocyanidin
brown cotton
leu
transport
Prior art date
Application number
NL2031934A
Other languages
Dutch (nl)
Inventor
Xie Yongfei
Gao Junshan
Chen Wen
Xu Lei
Meng Yan
Original Assignee
Univ Anhui Agricultural
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Univ Anhui Agricultural filed Critical Univ Anhui Agricultural
Priority to NL2031934A priority Critical patent/NL2031934B1/en
Application granted granted Critical
Publication of NL2031934B1 publication Critical patent/NL2031934B1/en

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/415—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from plants
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/10—Transferases (2.)
    • C12N9/1085—Transferases (2.) transferring alkyl or aryl groups other than methyl groups (2.5)
    • C12N9/1088—Glutathione transferase (2.5.1.18)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y205/00—Transferases transferring alkyl or aryl groups, other than methyl groups (2.5)
    • C12Y205/01—Transferases transferring alkyl or aryl groups, other than methyl groups (2.5) transferring alkyl or aryl groups, other than methyl groups (2.5.1)
    • C12Y205/01018—Glutathione transferase (2.5.1.18)

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • Molecular Biology (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • General Engineering & Computer Science (AREA)
  • Biomedical Technology (AREA)
  • Biotechnology (AREA)
  • Microbiology (AREA)
  • Biophysics (AREA)
  • Medicinal Chemistry (AREA)
  • Cell Biology (AREA)
  • Physics & Mathematics (AREA)
  • Plant Pathology (AREA)
  • Botany (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Breeding Of Plants And Reproduction By Means Of Culturing (AREA)

Abstract

The present disclosure provides a proanthocyanidin transport-related GST protein gene in a brown cotton fiber and use thereof. The gene has a nucleotide sequence shown in 5 SEQ ID NO: l, and a protein encoded by the gene has an amino acid sequence shown in SEQ ID NO: 2. In the present disclosure, an analysis on an encoding sequence of the gene and genetic transformation of Arabidopsis lhaliana are conducted to find that the gene is capable of controlling formation of fiber pigments to improve plant colors. This mechanism provides a reference for genetic improvement of brown cotton fiber color 10 traits by genetic engineering, and provides a new way for cultivating new brown cotton cultivars with stable fiber pigments.

Description

PROANTHOCYANIDIN TRANSPORT-RELATED GST PROTEIN GENE IN
BROWN COTTON FIBER AND USE THEREOF
TECHNICAL FIELD
[0001] The present disclosure relates to the technical field of plant molecular biology, in particular to a brown cotton (477179 gene and use thereof.
BACKGROUND ART
[0002] TRANSPARENT TESTAI19 is a free protein involved in the transport of proanthocyanidins and anthocyanins, belonging to the GST family. An Arabidopsis thaliana TT19 gene (4¢1719) encodes a Phi-like transport protein of the GST family essential for a flavonoid metabolic pathway. A biological function of the Phi-like transport protein is to transport monomers of polyphenolic pigments such as anthocyanins and proanthocyanidins synthesized in the cytoplasm to subcellular organs such as vacuoles, and the anthocyanins develop color under acidic conditions or the proanthocyanidins are further polymerized to form pigments.
SUMMARY
[0003] To overcome the deficiencies of the prior art, a purpose of the present disclosure is to provide a proanthocyanidin transport-related GST protein gene in a brown cotton fiber and use thereof. The present disclosure aims to provide a novel cotton gene related to pigment transport, thereby laying a foundation for cultivating new cultivars of brown cotton with stable fiber pigments.
[0004] The present disclosure is achieved by the following technical solutions.
[0005] The present disclosure provides a proanthocyanidin transport-related GST protein gene in a brown cotton fiber, where the gene is named GA77/9 and has a nucleotide sequence shown in SEQ ID NO: 1; and a protein encoded by the gene has an amino acid sequence shown in SEQ ID NO: 2.
[0006] The present disclosure further provides use of the proanthocyanidin transport-related GST protein gene in a brown cotton fiber in cultivating a novel brown cotton cultivar.
[0007] The present disclosure further provides a plant expression vector, including the proanthocyanidin transport-related GST protein gene in a brown cotton fiber.
[0008] Further, the plant expression vector may be a pCambial301la vector including the gene.
[0009] The present disclosure further provides a genetically engineered host cell, where the host cell includes the plant expression vector, or a genome of the host cell is integrated with the exogenous proanthocyanidin transport-related GST protein gene in a brown cotton fiber.
[0010] Further, the host cell may be an Agrobacterium cell including the plant expression vector or integrated with the exogenous gene.
[0011] The present disclosure further provides a preparation method of a transgenic plant, where the plant is Arabidopsis thaliana, and the preparation method includes the following steps:
[0012] (1) preparation of an infection solution: activating host cells, resuspending the host cells in a buffer to obtain the infection solution; where the buffer is a 1/2MS liquid medium containing 5% sucrose and 0.02% Silwet L-77 by mass percentage, and the infection solution has an ODgoo value of 0.8;
[0013] (2) cutting off all fruit pods and opened flowers from pre-transformed
Arabidopsis thaliana seedlings, leaving only flower buds; immersing all the flower buds upside down in the infection solution obtained in step (1) for 45 sec, culturing in the dark for 1 d, and continuing culturing in a light incubator at an illumination time of 16 h/d;
[0014] (3) repeating step (2) every 1 week until seeds are mature, to obtain
To-generation seeds;
[0015] (4) after sterilizing, inoculating the To-generation seeds into an MS solid screening medium containing 50 mg/L hygromycin, and incubating in a light incubator at an illumination time of 16 h/d; after growing to a stage of 4 to 6 rosettes, transferring the seedlings into nutrient soil to continue culturing, and harvesting T1-generation seeds; where only seeds containing the plant expression vector can grow in the MS solid screening medium containing 50 mg/L hygromycin, such that positive plants can be selected; and
[0016] (5) repeating step (4) to obtain transgenic plants with stable inheritance and progenies thereof.
[0017] Compared with the prior art, the present disclosure has the following advantages: in the proanthocyanidin transport-related GST protein gene in a brown cotton fiber and the use thereof, an analysis on an encoding sequence of the gene and genetic transformation of Arabidopsis thaliana are conducted. It is found that the gene is capable of controlling formation of fiber pigments to improve plant colors. This mechanism provides a reference for genetic improvement of brown cotton fiber color traits by genetic engineering, and provides a new way for cultivating new brown cotton cultivars with stable fiber pigments.
BRIEF DESCRIPTION OF THE DRAWINGS
[0018] FIG. I shows a construction map of a pCambial301a-GhTTI19 vector;
[0019] FIG. 2 shows results of PCR verification of Arabidopsis thaliana positive seedlings;
[0020] FIG. 3 shows results of histochemical staining of Ti-generation plants of
GhTT19-transgenic Arabidopsis thaliana,
[0021] FIG. 4 shows a bar graph of a relative expression level of (GA7719 in each tissue of Arabidopsis thaliana, where: r: root of transgenic Arabidopsis thaliana; s: stem of transgenic Arabidopsis thaliana; |: leaf of transgenic Arabidopsis thaliana; t: testa of transgenic Arabidopsis thaliana, and w: testa of wild-type Arabidopsis thaliana; and
[0022] FIG. 5 shows a bar graph for detection of a proanthocyanidin content in testa of
Arabidopsis thaliana.
DETAILED DESCRIPTION OF THE EMBODIMENTS
[0023] Example 1
[0024] 1. Materials
[0025] The methods in the following example were conventional methods unless otherwise specified; primers were synthesized by Sangon Biotech (Shanghai) Co., Ltd.; sequencing was conducted by Sangon Biotech (Shanghai) Co, Ltd.; PMD-18T, restriction enzymes BamHI and Xbal, Ts ligase, RNAprep Pure Plant Kit, FastQuant RT
Kit were purchased from TIANGEN. DNA gel recovery kit, plasmid extraction kit and
X-Gluc were purchased from Sangon Biotech (Shanghai) Co., Ltd. The methods were all conducted according to instructions.
[0026] 2. Methods
[0027] 2.1. Cloning of GATT19 and construction of eukaryotic expression vector
[0028] 2.1.1. Cloning of (747719 gene
[0029] A total RNA from brown cotton leaves was extracted, and reverse-transcribed into cDNA; specific amplification primers GhTT19-F and GhTT19-R were designed, and PCR amplification was conducted with the cDNA as a template; PCR products were recovered, and ligated to a PMD-18T vector.
[0030] The specific amplification primers GhTT19-F and GhTT19-R were:
[0031] SEQ ID NO: 3: GhTT19-F: ATGGTAGTGAAAGTGTATGG
[0032] SEQ ID NO: 4: GhTT19-R: TCAATAATTAGCGAGCTTCA
[0033] The specific reaction steps included: 1 ug (2 ul) of the total RNA was added with 2 pL of a 5xgDNA Buffer, 2 uL of a 10xFast RT Buffer, 1 pL of an RT Enzyme
Mix, 2 uL of an FQ-RT Primer Mix, and 11 uL of RNase-Free ddH:0, mixed well, incubated at 42°C for 15 min, and then at 95°C for 3 min, followed standing on ice for 5 min to obtain a corresponding reverse transcription product cDNA. PCR amplification was conducted with the primers GhTT19F and GhTT19R using the cDNA as a template.
A reaction program included: at 94°C for 5 min; at 94°C for 45 sec, at 54°C for 45 sec, and at 72°C for 1 min, conducting 35 cycles; and at 72°C for 10 min. A PCR product was detected by 1% agarose gel electrophoresis; a target fragment was recovered, ligated to the vector PMD-18T, and transformed into £. coli DH5o competent cells. The positive clones were identified, and sequencing was conducted by Sangon Biotech (Shanghai) Co., Ltd.
[0034] After sequencing, sequence alignment was conducted using DNAMAN software to ensure that the obtained sequence was the target sequence. The results show that the obtained gene 1s 645 bp; a nucleotide sequence of the gene and an amino acid sequence of an encoded protein by the gene are shown in SEQ ID NO: 1 and SEQ ID
NO: 2, respectively.
[0035] 2.1.2. Construction of plant expression vector
[0036] The primers GhTT19-BamHI-F and GhTT19-Xbal-R with BamHI and Xbal restriction sites were designed according to a sequence of the target gene GA7719, an
ORF of the Gh7719 gene was amplified with the cDNA as a template; after a PCR product was detected by 1% agarose gel electrophoresis, a target fragment was recovered and ligated to the vector PMD-18T to obtain a PMD-18T-GhTT19 plasmid.
[0037] The primers GhTT19-BamHI-F and GhTT19-Xbal-R with BamHI and Xbal restriction sites were:
[0038] SEQ ID NO: 5: GhTT19-BamHI-F: ATGGTAGTGAAAGTGTATGG
[0039] SEQ ID NO: 6: GhTT19-Xbal-R: TCAATAATTAGCGAGCTTCA
[0040] As shown in FIG. 1, the PMD-18T-GhTT19 plasmid and the plant expression vector pCambial30la plasmid were double-digested with the restriction enzymes
BamHI and Xba 1, respectively. A digested product was subjected to 1% agarose gel 5 electrophoresis to recover a target fragment GhTT19 and a plant expression vector pCambial3014. The two target fragments after digestion were ligated by the Ty ligase, and transformed into £. coli DH5o competent cells. A recombinant plasmid was verified by enzyme digestion and then sequencing to obtain a plant expression vector pCambial301a-GhTTI19.
[0041] 2.1.3. Construction of host cells
[0042] The constructed plant expression vector pCambial301a-GhTT19 was electro-transformed into Agrobacterium LBA4404 competent cells, and positive strains were screened by kanamycin and streptomycin to obtain host cells.
[0043] Meanwhile, an empty vector pCambial30la without (47719 gene was transformed into the Agrobacterium LBA4404 competent cells according to a same method as above, and positive strains were screened by the kanamycin and streptomycin to obtain control cells.
[0044] 2.2 Genetic transformation, screening and identification of Arabidopsis thaliana
[0045] 2.2.1. Preparation of an infection solution: after being activated, the host cells were resuspended in a buffer to obtain an infection solution; where the buffer was a 1/2MS liquid medium containing 5% sucrose and 0.02% Silwet L-77 by mass percentage, and the infection solution had an OD value of 0.8.
[0046] 2.2.2. all fruit pods and opened flowers were cut off from pre-transformed
Arabidopsis thaliana seedlings, only flower buds were left; all the flower buds were immersed upside down in the infection solution obtained in step 2.2.1 for 45 sec, cultured in the dark for 1 d, and culturing was continued in a light incubator at an illumination time of 16 h/d.
[0047] 2.2.3. Step 2.2.2 was repeated every 1 week until seeds were mature, to obtain 1,200 To-generation seeds in total.
[0048] 2.2.4. after being sterilized, the 1,200 To-generation seeds were inoculated into an MS solid screening medium containing 50 mg/L hygromycin, with 200 seeds in each medium, and incubated in a light incubator at an illumination time of 16 h/d. The results are shown in Table 1, most of the plants yellow and stop growing, and only 6 plants have developed true leaves, which are positive transgenic plants, indicating a transformation rate of 0.50%.
[0049] Table 1 Screening of Arabidopsis thaliana resistant plants
[0050] "No. Inoculation number (seeds) Resistant plant (plants) 1 20 2 2 200 0 3 200 1 4 200 1 200 2 6 200 0
Total 1200 6 5 [0051] After growing to a stage of 2 to 3 true leaves, one of the 6 seedlings was selected for PCR detection. Specifically: a small part of the leaves were taken, and a
DNA of the leaves was extracted using a EasyPure Plant Genomic DNA Kit, and the primers shown in SEQ ID NO: 3 and SEQ ID NO: 4 of the target gene were used for detection during PCR identification. A reaction system was 25 pL, including: 2 pL of the DNA, 2.5 uL of an Easytaq buffer, 2.0 uL of dNTPs, 1.5 pL for each of the upstream and downstream primers, 0.25 pL of Easytaq, and water as a balance. A reaction program included: at 94°C for 5 min; at 94°C for 30 sec, at 55°C for 30 sec, and at 72°C for 45 sec, conducting 30 cycles; and at 72°C for 10 min.
[0052] The results are shown in FIG. 2. A product with an expected size of 645 bp was amplified in positive transgenic Arabidopsis thaliana.
[0053] After growing to a stage of 4 to 6 rosettes, the 6 positive plants were transferred into nutrient soil to continue culturing and harvest T1-generation seeds.
[0054] 2.2.5. Step 2.2.4 was repeated on the Ti-generation seeds for rescreening to obtain positive Arabidopsis thaliana plants with stable inheritance.
[0055] 2.3 GUS staining of transgenic Arabidopsis thaliana plants
[0056] The seedlings of T2-generation plants of positive Arabidopsis thaliana plants were subjected to GUS staining according to a GUS staining kit, to observe tissue expression of (7477719. Specific steps were as follows:
[0057] (1) Pretreatment: an Arabidopsis thaliana material was placed in a 1.5 mL centrifuge tube, pre-cooled 90% acetone was added to completely cover the material,
and treatment was conducted at room temperature for 20 min to 30 min.
[0058] (2) Dyeing: the material was rinsed with distilled water, put in a 1.5 mL centrifuge tube, an appropriate amount of a prepared GUS staining solution was added to completely cover the material, and the material was wrapped in tin foil and allowed to stand at 37°C overnight.
[0059] (3) Elution: the material was eluted with 95% ethanol, and shaken gently with a shaker.
[0060] (4) Observation: the material was observed with naked eyes or a microscope, and blue parts on a white background were GUS expression sites.
[0061] The results show that: all parts of the Arabidopsis thaliana cells transformed with the empty vector pCambia1301a have no blue part, while the roots, stems and leaves of the Arabidopsis thaliana seedlings transformed with the pCambial301a-GhTT19 show blue, indicating that the (777719 is expressed in all parts of the transgenic Arabidopsis thaliana. The results of GUS staining are shown in FIG. 3.
It can be seen from the figure that blue appears in the roots, stems and leaves of
Arabidopsis thaliana, indicating that the Gh7T19 is expressed in all parts of the transgenic Arabidopsis thaliana.
[0062] 2.4. Phenotypic observation, qRT-PCR analysis and proanthocyanidin content detection of GATT [9-transgenic Arabidopsis thaliana
[0063] 2.4.1. Phenotypic observation
[0064] The seeds of GhITI9-transgenic Arabidopsis thaliana positive plants and wild-type Arabidopsis thaliana plants were stained by a DMACA staining method separately. The results show that the testa of GATTI9-transgenic Arabidopsis thaliana positive plants is stained darker than that of the wild-type Arabidopsis thaliana plants, indicating that genetic modification of the G4771/9 can appropriately increase the proanthocyanidin content in the testa of Arabidopsis thaliana.
[0065] 2.4.2. qRT-PCR analysis
[0066] RNA was extracted separately from the testa of GATT19-transgenic Arabidopsis thaliana Tr-generation plants and plant tissues and organs thereof, and the testa of wild-type Arabidopsis thaliana, and qRT-PCR analysis was conducted. The results are shown in FIG. 4. The results show that in the transgenic Arabidopsis thaliana, the expression level of (zA77/9 is higher in the testa; and the expression level of GAT779 in the testa of transgenic Arabidopsis thaliana 1s higher than that in the wild-type
Arabidopsis thaliana.
[0067] 2.4.3. Proanthocyanidin content detection in testa
[0068] The testa of the GATT19-transgenic Arabidopsis thaliana Ti-generation seeds and the wild-type Arabidopsis thaliana seeds were selected, and proanthocyanidins (PAs) were extracted from the testa of Arabidopsis thaliana according to a method provided by Ikegami et al. (Ikegami A, Akagi T, Potter D, et al. Molecular identification of I-Cys peroxiredoxin and anthocyanidin/flavonol 3-O-galactosyltransferase from proanthocyanidin-rich young fruits of persimmon (Diospyros kaki Thunb.) [J]. Planta, 2009, 230 (4): 841-855.) to obtain a PAs extract, by a n-butanol-hydrochloric acid method, 400 uL of the PAs extract was added with 1.5 mL of n-butanol (containing 5% hydrochloric acid), boiling was conducted in water bath for 20 min, an absorbance at 550 nm was measured, followed by comparing a standard curve to obtain PA contents in the testa of the GAT7/9-transgenic Arabidopsis thaliana Ta-generation seeds and the wild-type Arabidopsis thaliana seeds. The results are shown in FIG. 4. It can be seen that a total PA content in the testa of the GhTTI9-transgenic Arabidopsis thaliana is 1.32 times that of the wild-type Arabidopsis thaliana. These results suggest that the
GhTT19 plays a role in the transport or accumulation of proanthocyanidins.
[0069] The above example is a detailed implementation manner and specific operation process of the present disclosure, which is implemented on the premise of the technical solution of the present disclosure. However, the protection scope of the present disclosure is not limited to the above-mentioned example.
SEQUENCE LISTING
<110> Anhui Agricultural University <120> PROANTHOCYANIDIN TRANSPORT-RELATED GST PROTEIN GENE IN
BROWN COTTON FIBER AND USE THEREOF
<130> HKIP20220400210 <160> 6 <170> PatentIn version 3.5 <210> 1 <211> 645 <212> DNA <213> Artificial Sequence <220> <223> Nucleotide sequence of GhTT19 <400> 1 atggtagtga aagtgtatgg tccaatcaag gcagcttgcc ctcaaagggt attggcatgc 60 cttcttgaga aagaggttga atttcagatc gtcgacgtcg atctcgaagc cggcgatcat 120 aaaaaacccg atttcctcct ccgtcaaccg tttggacaag tcccagctat agaggatggc 180 gacttcaaac tttttgagtc tagggcaatc ataaggtact atgcagccaa atatgaaaag 240 caaggtacaa acctacttgg aaactcattg gaagaacgag caatggtgga tcaatggcta 300 gaagtagaag cccacaactt caacgatttg gcctacactt tggtgtttca actgttgatc 360 ctcccacgaa tgggcaagca gggtgatacg gccttagtgc tcagctgcca acaaaagctg 420 gaaaaagtgt tggacatcta cgagcaacgc ttgtccacca ccgcctatct tgctggagat 480 tcattcacct tggccgacct tagccatcta cccgctcttc gatacttggt cgacgatgtt 540 gggatgtggc acatggtgtc tcaacggaag catgtaaatg catggcggga gaccatttct 600 aaccgagctg cttggaagaa actcatgaag ctcgctaatt attga 645 <210> 2 <211> 214 <212> PRT <213> Artificial Sequence <220> <223> Amino acid sequence of GhTT19 <400> 2
Met Val Val Lys Val Tyr Gly Pro Ile Lys Ala Ala Cys Pro Gln Arg 1 5 10 15
Val Leu Ala Cys Leu Leu Glu Lys Glu Val Glu Phe Gln Ile Val Asp 20 25 30
Val Asp Leu Glu Ala Gly Asp His Lys Lys Pro Asp Phe Leu Leu Arg
Gln Pro Phe Gly Gln Val Pro Ala Ile Glu Asp Gly Asp Phe Lys Leu 50 55 60
Phe Glu Ser Arg Ala Ile Ile Arg Tyr Tyr Ala Ala Lys Tyr Glu Lys 65 70 75 80
Gln Gly Thr Asn Leu Leu Gly Asn Ser Leu Glu Glu Arg Ala Met Val 85 90 95
Asp Gin Trp Leu Glu Val Glu Ala His Asn Phe Asn Asp Leu Ala Tyr 100 105 110
Thr Leu Val Phe Gln Leu Leu Ile Leu Pro Arg Met Gly Lys Gln Gly 115 120 125
Asp Thr Ala Leu Val Leu Ser Cys Gln Gln Lys Leu Glu Lys Val Leu 130 135 140
Asp Ile Tyr Glu Gln Arg Leu Ser Thr Thr Ala Tyr Leu Ala Gly Asp 145 150 155 160
Ser Phe Thr Leu Ala Asp Leu Ser His Leu Pro Ala Leu Arg Tyr Leu 165 170 175
Val Asp Asp Val Gly Met Trp His Met Val Ser Gln Arg Lys His Val 180 185 190
Asn Ala Trp Arg Glu Thr Ile Ser Asn Arg Ala Ala Trp Lys Lys Leu 195 200 205
Met Lys Leu Ala Asn Tyr 210 <210> 3 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Primer GhTT19-F <400> 3 atggtagtga aagtgtatgg 20 <210> 4 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Primer GhTT19-R <400> 4 tcaataatta gcgagcttca 20 <210> 5 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Primer GhTT19-BamHI-F <400> 5 atggtagtga aagtgtatgg 20
<210> 6 <211> 20 <212> DNA <213> Artificial Sequence
<220> <223> Primer GhTT19-Xbal-R <400> 6 tcaataatta gcgagcttca 20
SEQUENCE LISTING
<110> Anhui Agricultural University <120> PROANTHOCYANIDIN TRANSPORT-RELATED GST PROTEIN GENE IN BROWN
COTTON FIBER AND USE THEREOF
<130> HKJIP20220400210 <160> 6 <170> PatentIn version 3.5 <210> 1 <211> 645 <212> DNA <213> Artificial Sequence <220> <223> Nucleotide sequence of GhTT19 <400> 1 atggtagtga aagtgtatgg tccaatcaag gcagcttgcc ctcaaagggt attggcatgc 60 cttcttgaga aagaggttga atttcagatc gtcgacgtcg atctcgaagc cggcgatcat 120 aaaaaacccg atttcctcct ccgtcaaccg tttggacaag tcccagctat agaggatggc 180 gacttcaaac tttttgagtc tagggcaatc ataaggtact atgcagccaa atatgaaaag 240 caaggtacaa acctacttgg aaactcattg gaagaacgag caatggtgga tcaatggcta 300 gaagtagaag cccacaactt caacgatttg gcctacactt tggtgtttca actgttgatc 360 ctcccacgaa tgggcaagca gggtgatacg gccttagtgc tcagctgcca acaaaagctg 420 gaaaaagtgt tggacatcta cgagcaacgc ttgtccacca ccgcctatct tgctggagat 480 tcattcacct tggccgacct tagccatcta cccgctcttc gatacttggt cgacgatgtt 540 gegatgtggc acatggtgtc tcaacggaag catgtaaatg catggcggga gaccatttct 600 aaccgagctg cttggaagaa actcatgaag ctcgctaatt attga 645 <210> 2 <211> 214 <212> PRT <213> Artificial Sequence <220> <223> Amino acid sequence of GhTT19 <400> 2
Met Val Val Lys Val Tyr Gly Pro Ile Lys Ala Ala Cys Pro Gln Arg 1 5 10 15
Val Leu Ala Cys Leu Leu Glu Lys Glu Val Glu Phe Gln Ile Val Asp
Val Asp Leu Glu Ala Gly Asp His Lys Lys Pro Asp Phe Leu Leu Arg
Gln Pro Phe Gly Gln Val Pro Ala Ile Glu Asp Gly Asp Phe Lys Leu 60
Phe Glu Ser Arg Ala Ile Ile Arg Tyr Tyr Ala Ala Lys Tyr Glu Lys 65 70 75 80
Gln Gly Thr Asn Leu Leu Gly Asn Ser Leu Glu Glu Arg Ala Met Val 85 90 95
Asp Gln Trp Leu Glu Val Glu Ala His Asn Phe Asn Asp Leu Ala Tyr 100 105 110
Thr Leu Val Phe Gln Leu Leu Ile Leu Pro Arg Met Gly Lys Gln Gly 115 120 125
Asp Thr Ala Leu Val Leu Ser Cys Gln Gln Lys Leu Glu Lys Val Leu 130 135 140
Asp Ile Tyr Glu Gln Arg Leu Ser Thr Thr Ala Tyr Leu Ala Gly Asp 145 150 155 160
Ser Phe Thr Leu Ala Asp Leu Ser His Leu Pro Ala Leu Arg Tyr Leu 165 170 175
Val Asp Asp Val Gly Met Trp His Met Val Ser Gln Arg Lys His Val 180 185 190
Asn Ala Trp Arg Glu Thr Ile Ser Asn Arg Ala Ala Trp Lys Lys Leu 195 200 205
Met Lys Leu Ala Asn Tyr
<2105 3 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Primer GhTT19-F <400> 3 atggtagtga aagtgtatgg 20 <2105 4 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Primer GhTT19-R <400> 4 tcaataatta gcgagcttca 20 <216> 5 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Primer GhTT19-BamHI-F <400> 5 atggtagtga aagtgtatgg 20 <210> 6 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Primer GhTT19-XbaI-R <400> 6 tcaataatta gcgagcttca 20

Claims (6)

Conclusies l. Gebruik van een gen van aan proanthocyanidinetransport gerelateerd GST-eiwit in een bruinkatoenvezel bij het kweken van een bruinkatoencultivar, waarbij het gen een nucleotidesequentie heeft die in SEQ ID NR: 1 getoond is.Conclusions l. Use of a proanthocyanidin transport related GST protein gene in a brown cotton fiber in breeding a brown cotton cultivar, wherein the gene has a nucleotide sequence shown in SEQ ID NO: 1. 2. Aan proanthocyanidinetransport gerelateerd GST-eiwit in een bruinkatoenvezel, met een aminozuursequentie die in SEQ ID NR: 2 getoond is.2. Proanthocyanidin transport related GST protein in a brown cotton fiber, having an amino acid sequence shown in SEQ ID NO: 2. 3. Plantexpressievector, die het gen van aan proanthocyanidinetransport gerelateerd GST-eiwit in een bruinkatoenvezel volgens conclusie 1 omvat.A plant expression vector comprising the gene of proanthocyanidin transport related GST protein in a brown cotton fiber according to claim 1. 4. Plantexpressievector volgens conclusie 3, waarbij de plantexpressievector een pCambia1301a-vector is die het gen omvat.The plant expression vector of claim 3, wherein the plant expression vector is a pCambia1301a vector comprising the gene. 5. Genetisch bewerkte gastheercel, waarbij de gastheercel de plantexpressievector volgens conclusies 3 en 4 omvat, of waarbij een genoom van de gastheercel samengegaan is met het exogene gen voor aan proanthocyanidinetransport gerelateerd GST-eiwit in een bruinkatoenvezel volgens conclusie 1.A genetically edited host cell, wherein the host cell comprises the plant expression vector according to claims 3 and 4, or wherein a genome of the host cell is associated with the exogenous gene for proanthocyanidin transport-related GST protein in a brown cotton fiber according to claim 1. 6. Gastheercel volgens conclusie 5, waarbij de gastheercel een Agrohacterium-cel is die de plantexpressievector volgens conclusies 4 en 5 omvat of samengegaan is met het exogene gen volgens conclusie 1.The host cell of claim 5, wherein the host cell is an Agrohacterium cell comprising the plant expression vector of claims 4 and 5 or associated with the exogenous gene of claim 1.
NL2031934A 2022-05-19 2022-05-19 Proanthocyanidin transport-related gst protein gene in brown cotton fiber and use thereof NL2031934B1 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
NL2031934A NL2031934B1 (en) 2022-05-19 2022-05-19 Proanthocyanidin transport-related gst protein gene in brown cotton fiber and use thereof

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
NL2031934A NL2031934B1 (en) 2022-05-19 2022-05-19 Proanthocyanidin transport-related gst protein gene in brown cotton fiber and use thereof

Publications (1)

Publication Number Publication Date
NL2031934B1 true NL2031934B1 (en) 2023-11-27

Family

ID=88924263

Family Applications (1)

Application Number Title Priority Date Filing Date
NL2031934A NL2031934B1 (en) 2022-05-19 2022-05-19 Proanthocyanidin transport-related gst protein gene in brown cotton fiber and use thereof

Country Status (1)

Country Link
NL (1) NL2031934B1 (en)

Similar Documents

Publication Publication Date Title
CN110819607B (en) Application of CsLYK gene and coding protein thereof in improving citrus canker resistance
CN108864267B (en) Sweet potato carotenoid synthesis and salt-tolerant drought-resistant related protein IbARF5 as well as encoding gene and application thereof
CN107267526B (en) Radix Notoginseng myb transcription factor gene PnMYB2 and its application
CN114703226B (en) Application of rice OsUBC27 gene or protein coded by same in improving rice yield
CN114014917B (en) FvbHLH36 protein, and encoding gene and application thereof
CN112899288B (en) Wild rose RmNHX2 gene and application thereof in improving salt tolerance of plants
CN106834314B (en) Millet stress resistance gene SiR L K35, encoding protein and application
CN113444731B (en) MYB transcription inhibitory factor LrETC1 related to synthesis of lycium ruthenicum anthocyanin and application thereof
CN108948169B (en) Protein and gene for promoting synthesis of cotton fiber green pigment, and coding sequence and application thereof
CN106754999A (en) A kind of related GST GFPs of Cotton Fiber of Natural Brown Cotton OPC transhipment and its application
CN111778226B (en) Plasma membrane H related to alkali stress resistance of rice+-ATPase proteins and uses thereof
CN110819634B (en) Clone of lilium tenuifolium gene LpNAC6 and application thereof
CN111690665A (en) Gene PpAHSP 21 separated from Chinese pear and having black spot resisting function and application thereof
CN108823220B (en) Cloning and application of waxy synthesis related gene MdCER1 in apple
CN113789312B (en) Eggplant E3 ubiquitin ligase gene SmDDA1b and application thereof in extracting Gao Qing blight resistance
NL2031934B1 (en) Proanthocyanidin transport-related gst protein gene in brown cotton fiber and use thereof
CN114657186B (en) Phyllostachys pubescens leaf shape regulating gene PheLBD29 and application thereof
US20120110697A1 (en) Method of constructing novel higher plant and method of promoting the growth of higher plant
CN112029747B (en) Nitrosos tangutorum bobr NtSOS2 gene and expression protein and application thereof
CN114507674A (en) Application of tea tree circadian rhythm gene LUX in improving cold resistance of plants
CN110760522B (en) AK209 gene and its coded protein and application in resisting stress and increasing yield
CN104152465B (en) Lilium regale cytochrome b5 gene LrCyt-b5 and application thereof
CN108484742B (en) Du pear cold-resistant transcription factor PbrMYB5 and application thereof
CN113564182B (en) Application of iris japonica SVP-like gene and method for obtaining iris japonica gene silencing or plant knockout
CN117209581B (en) Application of GAI protein of herba lophatheri in plant dwarfing