CN112029747B

CN112029747B - Nitrosos tangutorum bobr NtSOS2 gene and expression protein and application thereof

Info

Publication number: CN112029747B
Application number: CN202010932635.0A
Authority: CN
Inventors: 成铁龙; 霍俊男; 朱礼明; 黎梦娟; 施季森; 陈金慧; 鲁路; 陈新颖
Original assignee: Nanjing Forestry University
Current assignee: Nanjing Forestry University
Priority date: 2020-09-07
Filing date: 2020-09-07
Publication date: 2021-12-14
Anticipated expiration: 2040-09-07
Also published as: CN112029747A

Abstract

The invention discloses a Nitraria tangutorum bobr NtSOS2 gene, and an expression protein and application thereof, belonging to the technical field of plant genetic engineering. The nucleotide sequence of the Nitrosos 2 gene provided by the invention is shown in SEQ ID NO.1, and the amino acid sequence of the expressed protein is shown in SEQ ID NO. 2. The invention uses the seedlings of Nitraria tangutorum bobr with salt tolerance as materials, and clones the gene coding region of the Nitraria tangutorum bobr salt tolerance key gene NtSOS2 according to the transcriptome and Blast homology comparison result. In NaCl simulated salt stress, the salt resistance of transgenic arabidopsis plants is found to be remarkably greater than that of wild arabidopsis, and the fact that the tangut Nitraria NtSOS2 gene can improve and enhance the salt resistance of plants is proved, so that important gene resources are provided for improving the stress resistance of plants.

Description

Nitrosos tangutorum bobr NtSOS2 gene and expression protein and application thereof

Technical Field

The invention belongs to the technical field of plant genetic engineering, and particularly relates to an NtSOS2 gene of Nitraria tangutorum bobr, and an expression protein and application thereof.

Background

Tangut white thorn (Nitraria tangutorum) belongs to the genus Nitraria of Zygophyllaceae, is mainly distributed on sandy land in northwest of Shanxi sweet, West of inner Mongolia, Qinghai and northeast of Xinjiang, is a typical drought-resistant, saline-alkali-resistant and sand-resistant plant, and can survive in severe environments such as desert saline-alkali and the like. In addition, the Nitraria tangutorum bobr fruits are rich in various flavone, alkaloid, vitamin and other components, and have various effects of body building, health care and the like. At present, the research on the tangut nitraria tangutorum bobr is mainly focused on the aspects of breeding, physiological and biochemical determination, fruit component analysis and the like, and lays a foundation for the development and utilization of the tangut nitraria tangutorum bobr and the research on stress-resistant response mechanisms.

The SOS family is an important plant salt stress response gene discovered by Zhu health and the like, and plays an important role in regulating ion balance and improving salt tolerance of plants. The SOS2 gene encodes a serine/threonine protein kinase, and the N end of the SOS2 protein has about 270 amino acids and forms a catalytic region of the kinase; the C end forms the regulation region of the gene, and the gene contains a very conservative FISL motif and has a self-inhibition function. Under normal conditions, the plant has low content in the plant body, and the plant can express in both roots and stems of the plant, but the expression of the plant in the roots is obviously promoted under salt stress. The function of SOS2 is mainly embodied and maintained in Na⁺And K⁺Balance and salt tolerance, its activity is influenced by Ca⁺Regulation and control of (1).

Disclosure of Invention

In view of the above problems in the prior art, the technical problem to be solved by the present invention is to provide a Nitrosos 2 gene from Nitraria tangutorum bobr. The invention also aims to solve the technical problem of providing the function of the Nitrosos 2 gene in saline-alkali resistance of plants.

In order to solve the technical problems, the technical scheme adopted by the invention is as follows:

the Nitrosos 2 gene has the nucleotide sequence shown in SEQ ID NO. 1.

The amino acid sequence of the expression protein of the Nitrosos 2 gene of Tangut white spine is shown in SEQ ID NO. 2.

The vector contains the Nitsos 2 gene of the Nitraria tangutorum bobr.

Furthermore, the vector containing the Nitsos 2 gene of Nitraria tangutorum bobr is a plant expression vector.

Further, the plant expression vector is pBI121-NtSOS 2.

A host cell containing the Nitsos 2 gene of Nitraria tangutorum bobr.

The application of the Nitrosos 2 gene in the Tangut white spine is in improving the salt tolerance of plants.

The application of the Nitrosos 2 gene in the Tangut white spine for improving the salt tolerance of plants comprises the following steps:

1) constructing a vector of the Nitsos 2 gene of the Nitraria tangutorum bobr;

2) transforming the constructed vectors of the Nitrosos 2 gene of the Tangut Nitraria tangutorum bobr into plants or plant cells;

3) and culturing and screening to obtain the transgenic plant with improved salt tolerance.

Further, in the application, the plant is arabidopsis thaliana.

Compared with the prior art, the invention has the beneficial effects that:

compared with the prior art, the coding region of the Tangut white spine salt-resistant related SOS2 gene is cloned by using the Tangut white spine seedling as a material and using the transcriptome and Blast homology comparison result, and the coding region is named as NtSOS2 gene according to homology. Under normal culture conditions, the Arabidopsis thaliana plant over-expressing the NtSOS2 gene has no obvious difference from wild type Arabidopsis thaliana. In NaCl simulated salt stress, the transgenic Arabidopsis plants have greater salt resistance than wild type Arabidopsis. Through a salt tolerance simulation experiment, the effect of the Nitraria tangutorum bobr NtSOS2 gene on improving the salt tolerance of plants is proved, and an important gene resource is provided for the stress tolerance improvement of the plants.

Drawings

FIG. 1 is an electrophoretogram of total RNA extraction from Nitraria tangutorum bobr;

FIG. 2 shows the cloning PCR result of the NtSOS2 target fragment from Nitraria tangutorum bobr;

FIG. 3 is a schematic representation of a Down Goutea cell localization vector;

FIG. 4 is a diagram of gene gun mediated transient expression of NtSOS2 gene in onion cells;

FIG. 5 is a diagram of an expression vector of the NtSOS2 gene;

FIG. 6 is the screening PCR electrophoretogram of transgenic T1 generation plant;

FIG. 7 is an observation of the transgenic Arabidopsis T2 salt treatment phenotype.

Detailed Description

The invention is further described with reference to specific examples.

Preparing materials: selecting full-grain Nitraria tangutorum bobr seeds, carrying out sand storage and vernalization at 4 ℃ for 8 weeks, cleaning the vernalized seeds, placing the cleaned seeds into a plastic germination box for germination, and taking off and fixing the young roots when the seeds grow young roots. The rest seeds are continuously germinated, and planted into a culture medium (the culture medium is river sand, peat soil and vermiculite is 5: 1: 0.5) after the seeds grow to the proper size, the size of the plastic flowerpot is 7 x 7cm, and 4 plants are planted in each pot. The culture conditions are as follows: the temperature is 25 ℃, the illumination is 16 h/the darkness is 8h, the relative humidity is 70 percent, and the seedlings grow for 3 months for standby.

Example 1: acquisition of Nitrosos tangutica Hayata NtSOS2 gene

1. Total RNA extraction from Nitraria tangutorum bobr

Taking a fresh Tangut white thorn plant, quickly placing the fresh Tangut white thorn plant into a mortar precooled by liquid nitrogen, adding a little liquid nitrogen, fully grinding, adding 2mL of lysate, continuously grinding to be powder, and homogenizing for 15 minutes at room temperature. Centrifuging at 12000rpm and 4 deg.C for 10min, and transferring the supernatant into a new centrifuge tube. Then 0.4mL of chloroform was added, the centrifuge tube was closed, shaken vigorously and incubated at room temperature for 3 minutes. Centrifuging at 12000rpm for 10min at 4 deg.C, and sucking supernatant into a new centrifuge tube for use. Adding 70% ethanol with one volume, reversing, mixing, transferring into adsorption column, and centrifuging. Centrifuging at 10,000rpm for 45 s, discarding the waste liquid, returning the adsorption column to the collection tube, adding 500 μ L deproteinized liquid RE, centrifuging at 12,000rpm for 45 s, and discarding the waste liquid. 700. mu.L of the rinsing solution RD was added, centrifuged at 10,000rpm for 15 seconds, and the waste solution was discarded. 700. mu.L of the rinsing solution RW was added, and centrifuged at 12,000rpm for 60 seconds, and the waste liquid was discarded. Placing the adsorption column RA back into an empty collection tube, centrifuging at 12,000rpm for 2min, repeating for 2 times, removing rinsing liquid as much as possible to prevent residual ethanol from inhibiting downstream reaction, taking out the adsorption column RA, placing into an RNase free centrifuge tube, adding 50RNase free water into the middle part of an adsorption membrane, placing into a constant temperature mixer, standing for 2min, centrifuging at 12,000rpm for 1min, re-sucking the centrifuged solution into the adsorption column, and repeating the above operation. The obtained solution is total RNA, a small amount of the total RNA is taken for concentration detection and gel electrophoresis, the result is shown in figure 1, and an RNA strip is clearly visible and has no obvious degradation. By combining the detection result of the Nanodrop, the RNA sample can be considered to have no obvious degradation and no pollution of DNA protein and the like and can be used for the next experiment. And placing the qualified sample in an ultra-low temperature refrigerator for later use.

2. Synthesis of cDNA

Using the extracted RNA sample as a template and utilizing Novozan

III 1st Strand cDNA Synthesis Kit Synthesis, the specific operation steps are as follows:

preparing a mixed solution in an RNase-free centrifuge tube, wherein Total RNA2 mu L and RNase-free ddH₂O to 8. mu.L. Heating at 65 deg.C for 5min, rapidly cooling on ice, and standing on ice for 2 min. The above mixture was added to the cDNA synthesis reaction solution (10 XT Mix 2. mu.L, HiScript III Enzyme Mix 2. mu.L, Random hexamers 1. mu.L, RNase-free ddH)₂O5 μ L), gently flicked and mixed using a pipette gun (PCR reaction program: 5min at 25 ℃; 50 ℃ for 45 min; 85 ℃ and 5min), storing the cDNA obtained by the reaction at-80 ℃ for later use

3. Cloning of the target Gene

Comparing the existing transcriptome data with NCBI Blast, designing a primer by utilizing Oligo7, cloning to obtain NtSOS2, cutting a PCR product, recovering a target strip (figure 2), connecting the PCR product with pMD19-T, transferring the product into escherichia coli, and determining that the ORF of the NtSOS2 gene is complete through sequencing analysis. The NtSOS2 gene CDS of Nitraria tangutorum bobr is 1332bp, the specific sequence is shown as SEQ ID NO.1, and the expressed protein sequence is shown as SEQ ID NO.2 and comprises 443 amino acids.

The NtSOS2 fragment cloning primers are as follows:

NtSOS2-F：5′-TGAGGAACCATGAAGAAGAAGACGAAGAG-3′

NtSOS2-R：5′-ATAACGCAGGAGGATCAGCAGGTCATTGT-3′

the PCR procedure was: pre-denaturation at 94 ℃ for 2min for one cycle, denaturation at 98 ℃ for 10S, annealing at 61 ℃ for 30S, and extension at 68 ℃ for 3.5min for 35 cycles in total, complete extension at 68 ℃ and + infinity at 4 ℃. The reaction system was (50 μ L): 2 XKOD Buffer, 25. mu.L, cDNA 1. mu.L, NtSOS 2-F1.5. mu.L, NtSOS 2-R1.5. mu.L, ddH₂O 10μL，KOD(FX)1μL。

Example 2: subcellular localization of Nitsos 2 gene in Nitraria tangutorum bobr

Construction of subcellular localization expression vector 2 × 35S: NtSOS2, which was transferred into onion endothelial cells by a gene gun-mediated method, and the expression pattern of the gene in the onion endothelial cells was observed using a fluorescence microscope.

1. Construction of the vector:

the Escherichia coli used in the present invention was DH 5. alpha. (Tiangen), and the expression vector was PJIT-166.

Homologous recombination segments were added upstream and downstream of the NtSOS2 gene fragment by PCR. PCR chain reaction was carried out using primers with terminal homologous sequences using PMD-19T as a template, which was determined to contain the cloned fragment of the NtSOS2 gene correctly, PCR system: 2 × Phanta Max Buffer 25 μ L, dNTP 1 μ L, NtSOS 2-166-F2 μ L, NtSOS 2-166-R2 μ L, PMD-19T 1 μ L containing NtSOS2, DNA Polymerase 1 μ L, ddH₂O18. mu.L. And (3) PCR reaction conditions: 30s at 95 ℃; 35 cycles of 95 ℃ for 15s, 60 ℃ for 15s, 72 ℃ for 3min for 30 s; 5min at 72 ℃; infinity at 4 ℃.

Primers with terminal homologous sequences are shown below:

NtSOS2-166-F：

5′-CTCCTCGCCCTTGCTCACCATGGATCCGCAGGTCATTGTTCTGATCAGACTGG-3′，

NtSOS2-166-R：

5′-CATGGCGTGCAGGTCGACTCTAGAATGAAGAAGAAGACGAAGAGGGTTGG-3′。

and cutting the PCR product under ultraviolet light to recover the gel for later use.

PJIT-166 was digested with XbaI and BamHI restriction enzymes. The enzyme digestion reaction system is (50 mu L): PJIT166 plasmid 3. mu.L, 10 XCutSmart Buffer 5. mu.L, BamH I1. mu.L, XbaI 1. mu.L, ddH₂O40. mu.L. Reaction conditions are as follows: the enzyme was digested at 37 ℃ for 1h, and after completion of the digestion, the product was separated by electrophoresis on a 1% agarose gel. Recovering and purifying the digested product with gel recovery kit, dissolving in 30. mu.L ddH₂And (4) in O.

Connecting the gel cutting recovery product with the enzyme cutting product, wherein the specific reaction system is as follows (20 mu L): gibson Mix 10. mu.L, PJIT-166 purified product 4. mu.L, NtSOS 21. mu.L, ddH₂O5. mu.L. Reaction conditions are as follows: the ligation product was stored in a refrigerator at 4 ℃ for 1h at 50 ℃.

Transforming the connecting product into escherichia coli DH5 alpha competent cells, selecting a single colony, inoculating the single colony into an LB liquid culture medium, and performing shake culture at 37 ℃ overnight; and (3) carrying out PCR (polymerase chain reaction) on the bacterial liquid by using the full-length primer to screen positive clones and detect whether mutation or deletion occurs in the construction process of the vector by sequencing. The construction of the expression vector is shown in FIG. 3.

2. Gene gun mediated onion inner epidermis:

the constructed transient expression vector is introduced into the epidermal cells of the fresh onions by using a gene gun mediated method, dark culture is carried out for 24 hours, and the expression of the transient expression vector on the epidermal cells of the onions is observed by using a fluorescence microscope. The specific operation is as follows:

1) fresh onion inner epidermis was cut with a sharp blade to prepare a 1cm × 1cm piece, which was gently peeled off with a forceps and applied to 1/2MS medium and cultured at 23 ℃ for several hours.

2) Placing 50 μ L of gold powder suspension in sterilized 1.5mL centrifuge tube, placing 5 μ g of PJIT-NtSOS2-GFP on one side of the tube cover, and placing 50 μ L of CaCl₂(2.5M) and 20. mu.L spermidine (0.1M) were applied to the other side of the centrifuge tube cover, covered and rapidly vortexed for 10min and allowed to stand for 1 min.

3) The mixture is instantaneously separated for 5s, the supernatant is discarded, 150 mu L of absolute ethyl alcohol is added again, the mixture is vortexed for 5min, the supernatant is discarded, 80 mu L of absolute ethyl alcohol is added, the liquid is resuspended, and the mixture is placed on ice for standby.

4) And (3) putting 10 mu L of gold bomb on the carrying membrane, drying the gold bomb, putting the gold bomb on a metal cover, compacting the gold bomb by using a mold, putting the prepared onion skin in the center of the gene bombardment chamber after the breakable membrane, the termination screen and the like are installed as required, and closing the chamber door.

5) And (3) opening a gene gun power supply, an air valve and the like to guide the gold bomb into the onion epidermal cells to complete the mediated transformation process.

The expression of the protein on onion epidermal cells was observed by a fluorescence microscope, and as a result, NtSOS2 was mainly expressed in cytoplasm and nucleus as shown in FIG. 4.

Example 3: functional verification of Nitrosos tangutorum bobr NtSOS2 gene

Constructing an overexpression vector of Nitroson tangutorum bobr NtSOS2, transferring the overexpression vector into an agrobacterium strain, transforming an arabidopsis inflorescence by an agrobacterium-mediated method to obtain a positive transgenic plant of an overexpression NtSOS2 gene, observing a phenotype, and inferring the function of NtSOS 2.

1. Construction of vectors

The escherichia coli strain used in the invention is e.coli DH5 α; the expression vector was pBI121 (purchased from Biovector Co. LTD). The specific process is as follows:

(1) homologous sequences are respectively added at the upstream and downstream of the NtSOS2 gene by PCR, and the PCR system is as follows: 2 × Phanta Max Buffer 25 μ L, dNTP 1 μ L, NtSOS 2-121-F2 μ L, NtSOS 2-121-R2 μ L, PMD-19T 1 μ L containing NtSOS2, DNA Polymerase 1 μ L, ddH₂O18. mu.L. And (3) PCR reaction conditions: 30s at 95 ℃; 35 cycles of 95 ℃ for 15s, 60 ℃ for 15s, 72 ℃ for 3min for 30 s; 5min at 72 ℃; infinity at 4 ℃.

The primers are respectively as follows:

NtS2-121-F：

5′-

TTTGGAGAGAACACGGGGGACTCTAGAATGAAGAAGAAGACGAAGAGGGTTG-3′，

NtS2-121-R：

5′-

CATAAGGGACTGACCACCCGGGGATCCGCAGGTCATTGTTCTGATCAGACTG-3′。

after the PCR product is separated by 1% agarose gel electrophoresis, the PCR product is recovered and purified by a Tiangen gel recovery kit.

(2) PBI121 was digested with SmaI and XbaI endonucleases.

Enzyme-cleaved reaction system (20. mu.L): 10 × cut buffer 5 μ L, SmaI 1 μ L, XbaI 1 μ L, PBI1212 μ L, with ddH₂O make up to 50. mu.L.

Water bath at 37 ℃ and enzyme digestion for 2 h. The separation was performed by electrophoresis on a 1% agarose gel. Recovering and purifying the digested product with a Tiangen gel purification recovery kit, dissolving in 20. mu.L ddH₂And (4) in O.

(3) DNA recombination reaction

Adding each reagent and fragment in turn according to a homologous recombination connecting system, wherein the reaction system comprises the following steps: 10 XGibson Assembly master buffer 5. mu.L, digested expression vector 2. mu.L, homologous fragment PCR product 1. mu.L added, and water make up to 20. mu.L.

(4) Transforming the connecting product into escherichia coli DH5 alpha competent cells, selecting a single colony, inoculating the single colony into an LB liquid culture medium, and performing shake culture at 37 ℃ overnight; and (3) performing PCR (polymerase chain reaction) on the bacterial liquid by using the primers to screen positive clones and detect whether mutation or deletion occurs in the construction process of the vector by sequencing. The expression vector was constructed as shown in FIG. 5.

2. Transformation of Agrobacterium

(1) The agrobacterium strain used was EHA105 (exclusively, china). The constructed pBI121-NtSOS2 expression vector is transferred into agrobacterium by adopting a liquid nitrogen freeze-thaw method.

The specific operation is as follows:

1) the agrobacterium tumefaciens stored at the temperature of minus 80 ℃ is taken to be in a sensitive state at room temperature or palm for a moment until part of the agrobacterium tumefaciens is melted, and the agrobacterium tumefaciens is inserted into ice when the agrobacterium tumefaciens is in an ice-water mixed state.

2) Every 100 μ L competence add 0.01-1 μ g plasmid DNA (transformation efficiency is higher, best make preliminary experiment confirm add plasmid amount before using for the first time), dial the tube bottom and mix well with hand, stand 5 minutes, liquid nitrogen 5 minutes, 37 deg.C water bath 5 minutes, ice bath 5 minutes sequentially.

3) Adding 700 mu L of LB or YEB liquid culture medium without antibiotics, and carrying out shake culture at 28 ℃ for 2-3 hours.

4) And (3) centrifuging at 6000rpm for one minute to collect bacteria, reserving about 100 mu L of supernatant, slightly blowing and beating the heavy suspension bacteria block, coating the heavy suspension bacteria block on an LB or YEB plate containing corresponding antibiotics, and inversely placing the plate in an incubator at 28 ℃ for culturing for 48 hours.

5) Detecting positive clone by PCR, and storing at 4 ℃ for later use.

(2) Healthy arabidopsis thaliana to be planted is grown to flower. The positive clone agrobacterium detected by PCR is shaken to OD₆₀₀At 0.8, the Arabidopsis floral organs were immersed and transformed. The specific process is as follows:

1) centrifuging the bacterial liquid at 5000rpm for 5min, collecting thalli, and suspending with 5% sucrose solution;

2) before soaking, Silwet L-77 is added, the concentration is 0.05% (500 mu L/L), and foam is shaken out;

3) soaking the overground part of the arabidopsis in the agrobacterium suspension solution for 15-30 sec, and gently shaking the overground part of the arabidopsis;

4) laying the soaked arabidopsis thaliana in a tray, covering the tray with a preservative film for moisture preservation, and sealing the tray with tinfoil paper for 24 hours in a dark place;

5) the tinfoil paper is uncovered, cultured under normal conditions, and watering is stopped when the seeds are mature.

(3) Harvesting dried seeds, screening T1 generation seeds, screening culture medium: 1/2MS + kanamycin 100 mg/L. The result of PCR positive detection of the transgenic plants with the resistance screening result is shown in FIG. 6.

After collecting T1 generation Arabidopsis seeds, the seeds are further screened to obtain T2 generation plants. Then, after collecting T2 generation Arabidopsis thaliana plants, the seeds are continuously screened to obtain homozygous screened T3 generation homozygous lines.

3. Salt resistance experiment of transgenic arabidopsis thaliana with NtSOS2 generation T2

After the T2 positive plants are screened by an antibiotic culture medium and are identified correctly by PCR, salt resistance experiments are carried out on wild type arabidopsis thaliana and transgenic arabidopsis thaliana after the plants grow to be suitable for size, the results are shown in fig. 7, it can be found that under the stress of 200mm NaCl salt solution, the wilting and whitening degree of non-transgenic arabidopsis thaliana leaves is higher along with the time lapse, the phenomenon is shown as stronger water loss, and the wilting and water loss of the arabidopsis thaliana plants over-expressing NtSOS2 is relatively less compared with that of the wild type arabidopsis thaliana, so that NtSOS2 can enhance the salt tolerance of the arabidopsis thaliana plants.

Sequence listing

<110> Nanjing university of forestry

<120> Nitrosos tangutica Hayata nakai NtSOS2 gene, and expression protein and application thereof

<130> 100

<160> 8

<170> SIPOSequenceListing 1.0

<210> 1

<211> 1332

<212> DNA

<213> Nitraria tangutorum

<400> 1

atgaagaaga agacgaagag ggttgggaag tatgaggttg gacgaaccat tggtgaagga 60

acctttgcca aggttaagtt tgcacgaaat acaaatacag gagagagtgt agccatgaaa 120

attatggata aaagtacagt tcttaagcac agaatggttg atcagattag aagagaaata 180

tctattatga agattgtcag gcatcccaat atagtcaggc tgcatgaggt tttggcaagt 240

cggacaagga tatatattat acttgagttt gtcactggtg gagaactctt cgataaaatt 300

gttcaccaag gaagactccc tgaaaatgat tctaggcgat actttcaaca gcttatagat 360

gcagtttctc attgccacag taagggcgtg taccacagag acctaaagcc tgaaaatctt 420

cttcttgata cttacggaaa tttgaaggta tcagactttg ggctaagtgc attacctcag 480

caaggggttg accttctgca caccacttgt gggaccccaa attatgttgc acctgaggtg 540

ctcggcaacc agggttatga tggtgctgct gctgatgtgt ggtcatgtgg cgtgattctg 600

tatgttttaa tggctgggta tcttccattt gacgagactg acctcccaac tttgtacaga 660

aagataaatg ctgcagaatt ttgttgtcca ttttggtttt ctgctggcgc aaagtcattg 720

atacagaaga tacttgatcc gaatcccaaa actcgtattc ggattgatga aattaaaaag 780

caccaatggt ttcgcaagaa ttatatacct gttcgacaca aggtagaaga agaagtgagt 840

ttggatgaca ttcgtgcagt ttttgatgat attgaggacc aatttgtagc tgagcagtcg 900

ggaaggaaag agggaggtcc attgataatg aatgcttttg agatgataac cctatcccag 960

gggttgaatc tagcaggatt gtttgacagg caacaggatt ttgttaaacg gcaaactcgt 1020

tttgtttccc gcaagccggc aaatgttata atttctgcta ttgaagctgt tgcagaatcg 1080

atgaatctga aggtccatac tcgaaatttt aagacaagac ttgaaggaac atcttcaaat 1140

aaggctggac catttgctgt agtcctcgag gtttttgaag ttgcaccatc tctttacatg 1200

gttgatgtgc ggaaagctgc tggagacact cttgaatatc acaagttcta caagaacttc 1260

tgtgcaaaat tagaacacat catctggaaa ccagcagagg gttccagtct gatcagaaca 1320

atgacctgct ga 1332

<210> 2

<211> 443

<212> PRT

<213> Nitraria tangutorum

<400> 2

Met Lys Lys Lys Thr Lys Arg Val Gly Lys Tyr Glu Val Gly Arg Thr

1 5 10 15

Ile Gly Glu Gly Thr Phe Ala Lys Val Lys Phe Ala Arg Asn Thr Asn

20 25 30

Thr Gly Glu Ser Val Ala Met Lys Ile Met Asp Lys Ser Thr Val Leu

35 40 45

Lys His Arg Met Val Asp Gln Ile Arg Arg Glu Ile Ser Ile Met Lys

50 55 60

Ile Val Arg His Pro Asn Ile Val Arg Leu His Glu Val Leu Ala Ser

65 70 75 80

Arg Thr Arg Ile Tyr Ile Ile Leu Glu Phe Val Thr Gly Gly Glu Leu

85 90 95

Phe Asp Lys Ile Val His Gln Gly Arg Leu Pro Glu Asn Asp Ser Arg

100 105 110

Arg Tyr Phe Gln Gln Leu Ile Asp Ala Val Ser His Cys His Ser Lys

115 120 125

Gly Val Tyr His Arg Asp Leu Lys Pro Glu Asn Leu Leu Leu Asp Thr

130 135 140

Tyr Gly Asn Leu Lys Val Ser Asp Phe Gly Leu Ser Ala Leu Pro Gln

145 150 155 160

Gln Gly Val Asp Leu Leu His Thr Thr Cys Gly Thr Pro Asn Tyr Val

165 170 175

Ala Pro Glu Val Leu Gly Asn Gln Gly Tyr Asp Gly Ala Ala Ala Asp

180 185 190

Val Trp Ser Cys Gly Val Ile Leu Tyr Val Leu Met Ala Gly Tyr Leu

195 200 205

Pro Phe Asp Glu Thr Asp Leu Pro Thr Leu Tyr Arg Lys Ile Asn Ala

210 215 220

Ala Glu Phe Cys Cys Pro Phe Trp Phe Ser Ala Gly Ala Lys Ser Leu

225 230 235 240

Ile Gln Lys Ile Leu Asp Pro Asn Pro Lys Thr Arg Ile Arg Ile Asp

245 250 255

Glu Ile Lys Lys His Gln Trp Phe Arg Lys Asn Tyr Ile Pro Val Arg

260 265 270

His Lys Val Glu Glu Glu Val Ser Leu Asp Asp Ile Arg Ala Val Phe

275 280 285

Asp Asp Ile Glu Asp Gln Phe Val Ala Glu Gln Ser Gly Arg Lys Glu

290 295 300

Gly Gly Pro Leu Ile Met Asn Ala Phe Glu Met Ile Thr Leu Ser Gln

305 310 315 320

Gly Leu Asn Leu Ala Gly Leu Phe Asp Arg Gln Gln Asp Phe Val Lys

325 330 335

Arg Gln Thr Arg Phe Val Ser Arg Lys Pro Ala Asn Val Ile Ile Ser

340 345 350

Ala Ile Glu Ala Val Ala Glu Ser Met Asn Leu Lys Val His Thr Arg

355 360 365

Asn Phe Lys Thr Arg Leu Glu Gly Thr Ser Ser Asn Lys Ala Gly Pro

370 375 380

Phe Ala Val Val Leu Glu Val Phe Glu Val Ala Pro Ser Leu Tyr Met

385 390 395 400

Val Asp Val Arg Lys Ala Ala Gly Asp Thr Leu Glu Tyr His Lys Phe

405 410 415

Tyr Lys Asn Phe Cys Ala Lys Leu Glu His Ile Ile Trp Lys Pro Ala

420 425 430

Glu Gly Ser Ser Leu Ile Arg Thr Met Thr Cys

435 440

<210> 3

<211> 29

<212> DNA

<213> NtSOS2-F(Artificial)

<400> 3

tgaggaacca tgaagaagaa gacgaagag 29

<210> 4

<211> 29

<212> DNA

<213> NtSOS2-R(Artificial)

<400> 4

ataacgcagg aggatcagca ggtcattgt 29

<210> 5

<211> 53

<212> DNA

<213> NtSOS2-166-F(Artificial)

<400> 5

ctcctcgccc ttgctcacca tggatccgca ggtcattgtt ctgatcagac tgg 53

<210> 6

<211> 50

<212> DNA

<213> NtSOS2-166-R(Artificial)

<400> 6

catggcgtgc aggtcgactc tagaatgaag aagaagacga agagggttgg 50

<210> 7

<211> 52

<212> DNA

<213> NtS2-121-F(Artificial)

<400> 7

tttggagaga acacggggga ctctagaatg aagaagaaga cgaagagggt tg 52

<210> 8

<211> 52

<212> DNA

<213> NtS2-121-R(Artificial)

<400> 8

cataagggac tgaccacccg gggatccgca ggtcattgtt ctgatcagac tg 52

Claims

1. Tanggute white thornNtSOS2GeneThe nucleotide sequence is shown in SEQ ID NO. 1.

2. The Nitraria tangutorum bobr of claim 1NtSOS2The amino acid sequence of the gene expression protein is shown in SEQ ID NO. 2.

3. Comprises the Nitraria tangutorum bobr of claim 1NtSOS2A vector for the gene.

4. The Tangut white thorn-containing food according to claim 3NtSOS2The gene vector is characterized in that the vector is a plant expression vector.

5. The Tangut white thorn-containing food according to claim 4NtSOS2The gene vector is characterized in that the plant expression vector is pBI121-NtSOS 2.

6. Comprises the Nitraria tangutorum bobr of claim 1NtSOS2Host bacteria of the gene.

7. The Nitraria tangutorum bobr of claim 1NtSOS2The application of the gene in improving the salt tolerance of arabidopsis thaliana.

8. The tangut white thorn of claim 7NtSOS2The application of the gene in improving the salt tolerance of arabidopsis thaliana is characterized by comprising the following steps:

1) constructing Tanggute white thornNtSOS2A vector for the gene;

2) the constructed Tanggute white thornNtSOS2Transforming the gene vector into arabidopsis thaliana or arabidopsis thaliana cells;

3) and culturing and screening to obtain the transgenic arabidopsis with improved salt tolerance.