CN101704880A

CN101704880A - DREBs transcription factor GsDREBa of wild soybean and base sequence thereof

Info

Publication number: CN101704880A
Application number: CN200910073196A
Authority: CN
Inventors: 朱延明; 才华; 柏锡; 纪巍; 李勇; 季佐军
Original assignee: Northeast Agricultural University
Current assignee: Northeast Agricultural University
Priority date: 2009-11-12
Filing date: 2009-11-12
Publication date: 2010-05-12

Abstract

The invention provides a DREB transcription factor GsDREBa of a wild soybean and a base sequence thereof, relating to the DREB transcription factor GsDREBa and the base sequence thereof. The invention solves the problem that currently practical utilized DREB transcription factor is less. The DREB transcription factor GsDREBa of the wild soybean has abiological stress resistance and comprises one of the following amino acid sequences: 1. the sequence is expressed in SEQ ID NO: 1; and 2. one or more of amino acids are substituted and lost or overlapped in the amino acid sequence defined by the step 1. The DREB transcription factor GsDREBa of the wild soybean coded by the base sequence of the DREB transcription factor GsDREBa of the wild soybean has the abiological stress resistance. The invention can be used for plant abiological stress gene engineering.

Description

The DREB class transcription factor GsDREBa of wild soybean and its base sequence

Technical field

The present invention relates to a kind of DREB class transcription factor GsDREBa and its base sequence.

Background technology

Low temperature, arid and adverse environmental factor such as saline and alkaline have a strong impact on output and the quality of crop, are the significant problems of restriction China the Northeast and even national agriculture production.Low temperature resistant, the arid and the salt alkali ability that improve crop are one of major objectives of agriculture production.Under the abiotic stress condition, higher plant cell can be transferred intravital defence system energetically, from perceiving the signal conduction, pass the signal along to nuclear transcription factor at last, transcription factor acts on functional gene, start the expression of adverse circumstance response gene, cause the accumulation of synthetic new albumen, metabolic transformation and degeneration-resistant osmoregulation material etc., finally reach the purpose that improves plant stress tolerance.

For improving plant to abiotic stress resistance, people have carried out in a large number the researchs about plant resisting abiotic stress gene, and begin to turn to the research with the closely-related transcriptional modulatory gene of abiotic stress, as: protein kinase, transcription factor etc.These protein factors all belong to albumen more early stage in the abiotic stress signal transduction path, in signal transduction path, play important regulation, and can regulate a series of abiotic stress Expression of Related Genes, and not merely be a gene in action, but the collaborative response abiotic stress of a plurality of genes in certain approach in the initiating signal conduction.Therefore, transcription factor is playing important effect aspect the raising plant stress-resistance ability, and becomes the research focus gradually.DREB (Dehydration ResponsiveElement Binding protein) transcription factor is the present non-comparatively protein factor of focus of molecular biology research of coercing, but at present can be actual fewer for the DREB transcription factor of using, limited engineered popularization of abiotic stress and use.

Summary of the invention

The objective of the invention is at present can be actual in the fewer problem of using of DREB transcription factor in order to solve, and DREB class transcription factor GsDREBa and its base sequence of a kind of wild soybean are provided.

The DREB class transcription factor GsDREBa of wild soybean of the present invention has abiotic stress resistance, and has one of following amino acid sequences:

1. shown in the SEQ ID NO:1;

2. process replaces in the aminoacid sequence that 1. limits, one or several amino acid lacks or superpose.

The DREB class transcription factor GsDREBa of the wild soybean that the base sequence of the DREB class transcription factor GsDREBa of the above-mentioned wild soybean of the present invention is coded has abiotic stress resistance.

The DREB class transcription factor GsDREBa of wild soybean of the present invention is applicable to single, double cotyledon plant, and can use the plant expression vector of constitutive promoter and inducible promoter regulation and control, transformation mode plant tobacco and Arabidopis thaliana; The tangible resistance of reverse of institute's transfer-gen plant tool is for basic substance has been established in the engineered extensive popularization of abiotic stress.

The DREB class transcription factor GsDREBa of wild soybean of the present invention can combine with DRE element core sequence (CCGAC) specificity, and has the activity of activation, can activate the expression of reporter gene, and be positioned in the nucleus. experimental results show that this transcription factor is induced by multiple abiotic stress. the tobacco seedling of the DREB class transcription factor GsDREBa gene overexpression of wild soybean shows salt than the wild-type plant, the osmotic stress tolerance, the DREB class transcription factor GsDREBa involved in plant that wild soybean is described is to arid, low temperature, abiotic stress signal transduction paths such as salt marsh.

Description of drawings

Fig. 1 be in the embodiment four the GsDREBa transcription factor in yeast cell with DRE combination of elements specificity analysis figure as a result, Fig. 2 be in the embodiment four the GsDREBa transcription factor at external and the functional analysis of DRE combination of elements figure as a result, Fig. 3 be in the embodiment five the GsDREBa transcription factor at the intravital transcriptional activation experimental result picture of yeast, Fig. 4 is the carrier collection of illustrative plates of Subcellular Localization carrier pCEG in the embodiment six, Fig. 5 is the laser confocal microscope observation figure that the Subcellular Localization of DREB class transcription factor GsDREBa in vegetable cell of wild soybean in the embodiment six analyzed, Fig. 6 is the carrier collection of illustrative plates of the plant expression vector called after pBI121-GsDREBa of transformation of tobacco in the embodiment seven, Fig. 7 is that embodiment eight transfer GsDREBa genetic tobaccos are to high salt, the resistance of reverse growth experiment of osmotic stress is figure as a result, and Fig. 8 is the DREB class transcription factor GsDREBa transfer-gen plant of wild soybean in the embodiment nine GsDREBa expression of gene that RT-PCR detects under different stress conditions figure as a result.

Embodiment

Technical solution of the present invention is not limited to following cited embodiment, also comprises the arbitrary combination between each embodiment.

Embodiment one: the DREB class transcription factor GsDREBa of present embodiment wild soybean has abiotic stress resistance, and has one of following amino acid sequences:

1. shown in the SEQ ID NO:1;

2. present embodiment comprises with SEQ ID NO:1 aminoacid sequence having at least 80% homology, particularly has the aminoacid sequence of at least 95% homology.

The DREB class transcription factor GsDREBa of present embodiment wild soybean contains conservative AP2/EREBP structural domain sequence (ThrGlnAsnSerGlnCysAsnTyrArgGlyValArgGlnArgThrArgGlyLysTr pValGlyGluIleArgGluProAsnArgGlySerArgLeuTrpLeuGlyThrPheS erSerGlnProGluAlaAlaLeuAlaTyrAspGluAlaAlaArgAlaMetTyrGly ProCysAlaIleLeuAsnPhe).

Embodiment two: the DREB class transcription factor GsDREBa (shown in SEQ ID NO:1) of the wild soybean that the base sequence of the DREB class transcription factor GsDREBa of present embodiment wild soybean is coded has abiotic stress resistance.

The GsDREBa expression carrier that the present embodiment base sequence can be used for making up when using GsDREBa to make up plant expression vector, can add any enhancement type promotor or inducible promoter before its transcription initiation Nucleotide.For the ease of transgenic cell or plant being identified and screening, can process employed carrier, comprise adding plant screening mark gene and reporter gene.Spendable selective marker comprises the enzyme to antibiotics resistance, and microbiotic comprises gentamicin, kantlex, Totomycin etc.Can use the enzyme that produces the compound of discerning by colour-change (for example GUS) or luminous (for example GFP), or anti-chemical reagent (for example weedicide).In addition,, can not add any selectable marker gene, directly with adverse circumstance screening transformed plant from the security consideration of transgenic plant.

The expression vector of present embodiment can Ti-plasmids, Ri plasmid, plant viral vector, directly DNA conversion, microinjection, electricity be led by using, ordinary method such as agriculture bacillus mediated imports vegetable cell, and the plant transformed tissue cultivating become plant. by the plant transformed host both can be monocotyledonss such as paddy rice, corn, wheat, turfgrass, also can be dicotyledonss such as soybean, rape, clover, cucumber, tomato, willow.

Embodiment three: present embodiment obtains the DREB class transcription factor GsDREBa of wild soybean according to the following steps:

1, the clone of DREBP/AP2 conserved regions and analysis:

The wild soybean seedling is handled 1h in 0.2mol/L NaCl, get the quick-frozen in liquid nitrogen of its blade, is used for the extraction of RNA; Use Trizol Reagent to extract the total RNA of blade, operation is with reference to the operation instruction of Invitrogen company's T rizol reagent; The aminoacid sequence of multisequencing comparison Arabidopis thaliana DREB2A, DREB2B (AB007790, AB007791), tomato DREB2 (AF500012), corn DREB2 (AF450481), at the beta sheet district and the alpha-helix district design one cover degenerated primer of conservative relatively DREBP/AP2 structural domain, the degenerated primer sequence is as follows: GsAP2 (+): 5 '-GGH (A/T/C) AAATGGGTD (T/A/G) K (G/T) S (C/G) H (A/T/C) GA-3 ' and GsAP2 (-): 5 '-GGR (G/A) AAR (G/A) TTR (G/A) AGD (A/T/G) M (A/C) K (G/T) AGC-3 '.The wild soybean blade RNA that extracts utilizes the ThermoScript II Super Script II of Invitrogen company to carry out reverse transcription.Extend 50 ℃ of following reverse transcriptions, utilize above-mentioned degenerated primer to adopt the touchdown PCR amplification.Be that template is carried out second and taken turns conventional PCR with the result of first round pcr amplification again, to increase the efficient and the specificity of PCR reaction.The touchdown PCR response procedures is: 94 ℃ of pre-sex change 7min; 94 ℃ of sex change 30s, 56.6 ℃ of 40s that anneal, 72 ℃ of extension 0.5min, 30 circulations, 0.25 ℃ of each circulation landing, 72 ℃ of whole extension 10min.Second annealing temperature of taking turns PCR is 44 ℃, acquires the fragment of 189bp, and the fragment cloning that increases is checked order to pGEM-T vector.This segmental aminoacid sequence is carried out the Blastp homology analysis, 71 and this fragment homologous sequence are arranged in GenBank, similarity is 70%～80%, and these sequences all contain the AP2 structural domain.Clone's fragment has the conservative aminoacid sequence of AP2, and its conservative amino-acid residue is RgxRxRxWxKxxxExRx...xWxxT, is that prediction can combine with DNA by 3 parallel beta sheets and 1 protein structure domain that alpha-helix constitutes.

2, GsDREBa Cloning of Entire Gene and analysis

According to acquired wild soybean DREBP/AP2 functional domain design primer, with the technology of RACE segmental 3 ' end and the 5 ' end of conserved regions that increase respectively.In order to improve the specificity of reaction, carried out 3 altogether and taken turns nest-type PRC.The primer sequence of RACE is as follows: 3 ' RACE1 (+): 5 '-GAGGAGTTAGGCAGAGGACACG-3 ', 3 ' RACE1 (-): 5 '-GGCCACGCGTCGACTAGTAC-3 ', 3 ' RACE2 (+): 5 '-GCAGGCTTTGGTTGGGTAC-3 ', 3 ' RACE3 (+): 5 '-GCTGCTCTTGCCTATGATGAAG-3 ', 5 ' RACE1 (+): 5 '-GGCCACGCGTCGACTAGTACGGGDDGGGDDGGGDDG-3 ', 5 ' RACE 1 (-): 5 '-AAGGATAGCACAAGGACCATAC-3 ', 5 ' RACE2 (+): 5 '-GAGGAGTTAGGCAGAGGACACG-3 ', 5 ' RACE2 (-): 5 '-TGCTTCCTCTATTGGGCTCC-3 ', 5 ' RACE3 (-): 5 '-CGTGTCCTCTGCCTAACTCCTC-3 ', the 3 ' terminal sequence of acquisition 1162bp and the 5 ' terminal sequences of 482bp.3 ' the end, 5 ' end and the DREBP/AP2 structure domain DNA sequence that obtain are carried out sequence assembly, and Pin Jie sequence is 1622bp by analysis, has complete opening code-reading frame.According to the sequences Design amplification total length primer of splicing, primer sequence is as follows: GsDREBa all (+): 5 '-CACGGATCCAGTTTGATTGAGTACTGTGTG-3 ' and GsDREBa all (-): 5 '-GGCGAGCTCCTTGTATTAGTTGTATAGGGG-3 '.With genomic dna and cDNA is template, is to carry out pcr amplification under 55 ℃ in annealing temperature.The result shows, is the fragment that template all obtains 1360bp with genomic dna and cDNA, and this gene of initial analysis does not have intron.Full length fragment to amplification carries out sequential analysis, and this fragment comprises the opening code-reading frame of 1179bp, 392 amino acid of encoding.The two ends sequences Design primer of splicing adopts the RT-PCR method to carry out the full-length gene amplification, and the result has obtained the 1360bp full length cDNA sequence, and (initiator codon is positioned at the 48th～50bp), and this gene is named as GsDREBa shown in SEQ ID NO:2.Protein Conserve Domain programanalysis by NCBI, have in GsDREBa aminoacid sequence inside transcription factor distinctive with DNA bonded structural domain DREBP/AP2.N end have 6 amino acid (SRKRKS) nuclear localization sequence (nuclearlocalization signal, NLS).It below all is the constructional feature of typical DREB transcription factor.

Embodiment four: present embodiment is carried out the DREB class transcription factor GsDREBa of wild soybean and the binding characteristic analysis of DRE according to the following steps:

1, the GsDREBa transcription factor in yeast cell with DRE combination of elements specificity analysis

(1) structure of 4mer DRE and 4mer mutant DRE (mDRE) report carrier

With CCGAC is core sequence, carrying out 4 times repeats, between the core parts with ATGAGTATACTA at interval, synthetic 4mer DRE element sequences, and for the ease of being connected on the pHIS2 report carrier, adding Eco R I and Sac I restriction enzyme digestion recognition sequence respectively in upstream and downstream, is respectively GAATTC and GAGCTC.The synthetic sequence is:

DRE(+)：

5’- AATTCATACTACCGACATGAGTATACTACCGACATGAGTATACTACCGACATGAGTATACTACCGACATGAGT GAGCT-3’

DRE(-)：

5’- GTATGATGGCTGTACTCATATGATGGCTGTACTCATATGATGGCTGTACTCATATGATGGCTGTACTCA C-3’

Respectively get DRE (+) and DRE (-) that 20 μ l concentration are 1 μ g/ μ L, mixing 70 ℃ of annealing down, obtains the fragment of 80bp, and upstream and downstream is respectively the sticky end of Eco R I and Sac I.This mixture is connected with the pHIS2 report carrier that Sac I enzyme was cut with process Eco R I.Transformed into escherichia coli extracts the positive colony plasmid DNA, carries out enzyme and cuts evaluation, and check order to inserting segmental positive colony.Obtain containing the reorganization report carrier of the double chain DNA fragment of transcription factor DREB and DRE cis-acting elements bonded DNA core parts sequence, called after pHIS2-DRE through order-checking.

The structure that 4mer mutant DRE (mDRE) saves carrier is identical with the structure of pHIS2-DRE, and difference is that core sequence CCGAC is sported TTTTT, with the sudden change DRE report carrier called after pHIS2-mDRE that makes up.

(2) fusion has the structure of the GsDREBa bait carrier in AD activation structure territory

According to bait carrier pGADT7-Rec2 restriction enzyme mapping, introduce Sac I and EcoRV (flat terminal) restriction endonuclease recognition sequence by PCR respectively in GsDREBa gene C DS district upstream and downstream, utilizing Sac I and Sma I (flat terminal) to carry out enzyme pGADT7-Rec2 cuts, both are connected, transformed into escherichia coli, and carry out enzyme and cut evaluation, obtain to merge the GsDREBa bait carrier that AD activation structure territory is arranged, called after pGADT7-GsDREBa.In follow-up yeast body in conjunction with active proof test in, the Arabidopis thaliana DREB1A that uses known combined function is as positive control, therefore also needs to make up to merge the AtDREB1A bait carrier that AD activation structure territory is arranged.Using the same method makes up, called after pGADT7-AtDREB1A.

Report carrier pHIS2-DRE and pHIS2-mDRE transformed yeast Y187 (MATa with reorganization, ura3-52, his3-200, ade2-101, trp 1-901, leu2-3,112, ga14 Δ, ga180 Δ, met-, MRA3::GAL1MAS-GallTATA-LacZ MEL1), the yeast strain Y187/pHIS2-mDRE that obtains being integrated with the yeast strain Y187/pHIS2-DRE of pHIS2-DRE and be integrated with pHIS2-mDRE transforms recombination yeast Y187/pHIS2-DRE and Y187/pHIS2-mDRE to pGADT7-GsDREBa again, under 28 ℃, at 20mmol/L 3-AT and HIS ^-/ Leu ^-/ Trp ^-Cultivated 3～5 days on 3 substratum that lack.Recombination yeast Y187/pHIS2-DRE can grow, and colony diameter is greater than 2mm, and recombination yeast Y187/pHIS2-mDRE growth is suppressed, and colony diameter is all less than 1mm.The single bacterium colony of recombination yeast Y187/pHIS2-DRE and Y187/pHIS2-mDRE is carried out PCR identify, determine that pGADT7-GsDREBa has transformed to enter in the recombination microzyme.Picking PCR positive colony is at 30mmol/L 3-AT and HIS ^-/ Leu ^-/ Trp ^-Rule on 3 substratum that lack, cultivating 3～5 days. positive control AtDREB1A adopts to use the same method and carries out simultaneously. and recombination yeast Y187/pHIS2-DRE/pGADT7-GsDREBa can normal growth, contain denseer bacterium line, and recombination yeast Y187/pHIS2-mDRE/pGADT7-GsDREBa grows in the 3-AT of high density substratum fully and to suppress, the GsDREBa transcription factor is the same with Arabidopis thaliana DREB1A, can specific combination DRE element in the yeast body, thereby activate reporter gene HIS expression of gene, so can select to grow on the substratum at HIS-, opposite owing to can not combine with the mDRE of sudden change, can not activate reporter gene HIS expression of gene, thereby on HIS-selects substratum, grow and be suppressed, prove GsDREBa in the yeast body, have binding characteristic .GsDREBa transcription factor with DRE element core sequence (CCGAC) in yeast cell with DRE combination of elements specificity analysis result as shown in Figure 1.

2, the GsDREBa transcription factor is in external and DRE combination of elements functional analysis (EMSA experiment)

Utilize the DIG mark and the detection kit of Roche company to carry out the GsDREBa transcription factor in external and DRE combination of elements functional analysis experiment.Utilize the LiAC-PEG method to change plasmid pGADT7-GsDREBa over to yeast Y187, obtain positive yeast reorganization bacterium Y187/pGADT7-GsDREBa, adopt the granulated glass sphere crush method to extract recombination yeast.Because the complete CDS sequence of GsDREBa N end contains the HIS sequence label, according to ProBondTMPurification System (lot:1288003) protocol of Invitrogen company expressing protein is carried out purifying, be used for the EMSA experiment.Utilize artificial synthetic DRE of DIG mark and mDRE element sequences.The GsDREBa albumen of purifying and the element sequences of mark are carried out association reaction in binding buffer liquid, DNA and albumen composition are to carry out electrophoresis in 5% polyacrylamide in mass concentration, change by electricity afterwards mixture is transferred on the nylon membrane.Signal detection is carried out in explanation with reference to the DIG detection kit.The GsDREBa transcription factor in external and DRE combination of elements functional analysis result as shown in Figure 2.Because GsDREBa albumen combines with the DRE element, cause the DRE sequence electrophoresis band hysteresis (3 swimming lane) of mark; And DRE (mDRE) element of GsDREBa albumen and sudden change can not in conjunction with, therefore not have the band (4 swimming lane) of hysteresis; The swimming lane that contrast only contains underlined DRE and the mDRE element band (1,2 swimming lane) that all do not lag behind.This result proof external GsDREBa albumen can with the DRE combination of elements.

Embodiment five: the DREB class transcription factor GsDREBa that present embodiment is carried out wild soybean according to the following steps tests at the intravital transcriptional activation of yeast:

Yeast expression carrier pGBKT7 (Trp is cloned in GsDREBa total length CDS district ⁺) in, obtain recombinant yeast expression vector called after pGBKT7-GsDREBa, adopt a small amount of LiAc/PEG method with pGBKT7-GsDREBa then, pGBKT7 (negative control), pGBKT7-AtDREB1A and pGBKT7-GmDREB1 (positive control) be transformed yeast bacterial strain Y189 respectively, identifies through PCR to obtain positive transformant.Each positive transformant is rule on the SD/-Trp substratum.After turning out bacterium colony, adopt the filter paper photolithography to xerox on the Whatman filter paper recombinant yeast cell, filter paper is put into liquid nitrogen 15s, return to room temperature then and make lysis, then filter paper is soaked in 2.5mL Z-buffer/X-GAL solution, cultivate for 30 ℃ and observe blue hickie.Wherein, Z-buffer (pH7.0) main component is Na ₂HPO ₄7H ₂O16.1g/L, NaH ₂PO ₄H ₂O 5.50g/L, KCl 0.75g/L, MgSO ₄7H ₂O 0.246g/L.The main component of Z-buffer/X-GAL solution is 20mL Z-buffer, 0.054mL beta-mercaptoethanol, 67 μ L20mg/mL X-GAL stock solution.The GsDREBa transcription factor in the intravital transcriptional activation experimental result of yeast as shown in Figure 3, all yeast cell can both be on the SD/-Trp substratum normal growth, the yeast cell that contains pGBKT7-GsDREBa is the same with positive control pGBKT7-AtDREB1A, pGBKT7-GmDREB1, can produce locus coeruleus, negative control then can not produce locus coeruleus, illustrates that GsDREBa has transcripting activating characteristic in the yeast body.

Embodiment six: present embodiment is carried out the Subcellular Localization analysis of DREB class transcription factor GsDREBa in vegetable cell of wild soybean according to the following steps

Subcellular Localization carrier pCEG (the carrier collection of illustrative plates as shown in Figure 4) is cloned in GsDREBa total length CDS district, obtaining GsDREBa Subcellular Localization carrier pCEG-GsDREBa. adopts freeze-thaw method with pCEG-GsDREBa, pCEG (negative control) and pCEG-AtDREB1A (positive control) transform Agrobacterium EHA105 respectively, PCR identifies and obtains positive transformant. soak into tobacco leaf with the reorganization Agrobacterium, transition was cultivated after 3 days, with laser confocal microscope (SP5; Leica Germany) observes fluorescent signal (GFP is a green fluorescent protein) under the 488nm, and the result illustrates that GsDREBa albumen is positioned nucleus as shown in Figure 5, and is identical with positive control AtDREB1A location, and negative control pCEG does not then have positioning inclination.

Embodiment seven: present embodiment is carried out the structure and the agrobacterium mediation converted tobacco of the DREB class transcription factor GsDREBa cDNA plant expression vector of wild soybean according to the following steps

The structure of GsDREBa cDNA plant expression vector carries out according to a conventional method, and binary expression vector pBI121 contains the fragment of 35S promoter and translational enhancer TMV.The plant expression vector called after pBI121-GsDREBa (the carrier collection of illustrative plates as shown in Figure 6) that will be used for transformation of tobacco.The pBI121-GsDREBa plant expression vector is directly transformed Agrobacterium, and agrobacterium strains is LBA4404, and the plant acceptor of Agrobacterium-mediated Transformation is Longjiang 911 tobaccos.

1, genetic transformation tobacco

The substratum that genetic transformation is used is

M0: germination substratum, 1/8MS, pH5.8,0.8% agar.

M1: division culture medium (being used for pre-the cultivation and cultivation altogether), MS+1.0mg/L 6-BA+0.1mg/LNAA, pH5.8,0.75% agar.

M2: screening culture medium, M1+Km+ degerming agent.

M3: root media, 1/2MS, pH5.8,0.7% agar.

(1) preparation of acceptor material

Behind tobacco seed seed soaking 3～5h, be 70% alcohol surface sterilization 30s with volumetric concentration, 0.1% mercuric chloride sterilization 3min, aseptic water washing 5 times is inoculated in the M0 substratum.When treating that spire grows to 2～3cm, it is that the punch tool of 7mm is made the leaf dish that blade is taken off with diameter, and adaxial and its surface is seeded in downwards on the M1 substratum, cultivates in advance 2～3 days.Leaf dish incision can infect when just having begun to expand.

(2) agriculture bacillus mediated genetic transformation procedures and plant regeneration

1) preparation of Agrobacterium bacterium liquid is inoculated in Agrobacterium on the YEB solid medium of additional Km100mg/L, Sm50mg/L, Rif50mg/L, and 28 ℃ of dark cultivations are to growing single bacterium colony.Picking list bacterium colony is seeded in 5mL and contains in the corresponding antibiotic YEB liquid nutrient medium, in 28 ℃, and the 200r/min shaking culture.Treat that bacterium liquid grows to OD ₆₀₀, bacterium liquid is carried out re-activation in 1: 10 ratio at=0.4～0.6 o'clock.Work as OD ₆₀₀=0.4～0.6 o'clock, draw bacterium liquid and place aseptic centrifuge tube, the centrifugal 10min of 2000r/min abandons supernatant, and is resuspended, standby with isopyknic YEB liquid nutrient medium.

2) infect and get 2～3 days explant of pre-cultivation in aseptic triangular flask, add the good Agrobacterium bacterium liquid of an amount of activation, infect about 5min.

3) altogether the cultivation explant that will infect is seeded in M ₁On the substratum, 28 ℃ of dark cultivations were cultivated 3～4 days altogether, were as the criterion with the visible bacterium colony of naked eyes.

4) degerming and screening and culturing will be put into aseptic triangular flask through the explant of cultivating altogether, with aseptic water washing 3～4 times, then with the liquid plant substratum shaking culture 30min that adds degerming agent, blot surface-moisture with aseptic filter paper, transfer to again on the additional degerming screening culture medium of selecting to press, 26～28 ℃ of light are cultivated down, and per 10 days subcultures once.

5) subculture screening and culturing screening and culturing is after 2～3 weeks, and the transformant of explant will differentiate resistant buds, resistant buds is changed over to carry out succeeding transfer culture in the corresponding screening culture medium.

When 6) root culture is treated indefinite bud length to 3～4cm, with its cutting-out and insert M ₃Carry out root culture on the substratum, grow adventive root about two weeks.

7) after domestication is transplanted and to be waited to take root fully, seedling is taken out, careful flush away root substratum is planted in soil: in the flowerpot of fine sand=1: 2.

2, transgene tobacco molecular Biological Detection and screening

(1) PCR detects

Adopt CTAB conventional plant DNA extraction method to extract tobacco leaf DNA in a small amount, as template, carrying out PCR with gene specific primer antagonism plant detects, the PCR reaction conditions is as follows: 94 ℃ of pre-sex change 5min, 94 ℃ of sex change 40s, 55 ℃ of annealing 30s, 72 ℃ of extension 1min, totally 30 circulations, 72 ℃ are extended 10min, 4 ℃ of termination reactions.

Obtain 20 strain PCR positive plants after testing altogether, collect PCR positive plant T ₀For seed, be used for kantlex and screen.

(2) T ₀For seed Km screening experiment and T ₁Detect for plant PCR

With PCR male T ₀Seed for seed and contrast is inoculated on the germination substratum of 75mg/L, observe growing state after 14 days, contrast PCR positive plant and unconverted plant seed are in the difference of germination stage, to be transplanted to through the tobacco seedling that the kantlex screening survives and continue in the soil to cultivate, the performing PCR of going forward side by side detects, and the positive rate of PCR reaches 100%.Illustrate that it is more feasible utilizing the method for kantlex screening transgene tobacco progeny seed.

(3) Southern blot hybridization

Adopt CTAB conventional plant DNA extraction method to extract transgene tobacco T1 in a large number, be used to do Southern hybridization and detect for the total DNA of plant leaf.The method of Southern blot hybridization is with reference to " molecular cloning " (third edition).The final Southern that obtains is hybridized 5 strain systems of positive transgene tobacco.

(4)RT-PCR

Extract the RNA of transgene tobacco, carry out DNase I and handle, reverse transcription cDNA carries out RT-PCR with the pcr gene special primer and detects.Southern is hybridized 5 strains of positive transgene tobacco and is tied up to transcriptional level expression is all arranged as a result.

Embodiment eight: present embodiment is changeed GsDREBa genetic tobacco resistance of reverse according to the following steps and is identified

Collect the T that Southern is hybridized positive tobacco ₁For seed, utilize kantlex to T ₁Screen for seed, the seedling of screening survival and contrast are transplanted to respectively in the 1/2MS substratum that contains 150mM NaCl, 350mM N.F,USP MANNITOL and are cultivated.Under different coercing (high salt, osmotic stress), transfer-gen plant all contrasts well-grown (as shown in Figure 7).Under high salt condition, the increment of transfer-gen plant contrast is significantly improved; And under osmotic stress, the aerial growth amount of transgene tobacco is better than contrast.Above result shows that commentaries on classics GsDREBa genetic tobacco has the tolerance to high salt, infiltration adverse environmental factor.

Embodiment nine: present embodiment is carried out the expression characteristic analysis of DREB class transcription factor GsDREBa in adverse circumstance of wild soybean according to the following steps

1, the processing of wild soybean seedling

Wild soybean after 10 minutes, is used flushing with clean water with vitriol oil immersion.Be seeded in vermiculite afterwards: in the soil of turfy soil=1: 1, treat growth of seedling to have repeat leaf for 2 pairs 3 after, from soil, take out, and avoid not injuring root as far as possible.Seedling is placed in the 1/2MS liquid nutrient medium delays seedling, carry out the processing of following different condition after 3 days:

1) salt is handled: with 200mM NaCl solution-treated seedling, handle 0h, 0.5h, 1h, 3h, 6h respectively, get the underground and over-ground part of the seedling after the processing respectively, and fixing rapidly in liquid nitrogen, be placed on-80 ℃ and preserve stand-by or directly extract RNA.

2) simulating drought is handled: with 30% (W/V) PEG6000 solution-treated seedling, handle 0h, 0.5h, 1h, 3h, 6h respectively, get the underground and over-ground part of the seedling after the processing respectively, fixing rapidly in liquid nitrogen, be placed on-80 ℃ and preserve stand-by or directly extract RNA.

3) subzero treatment: place 4 ℃ of refrigerators to carry out subzero treatment seedling, handle 0h, 0.5h, 1h, 3h, 6h respectively, get the underground and over-ground part of the seedling after the processing respectively, fixing rapidly in liquid nitrogen, be placed on-80 ℃ and preserve stand-by or directly extract RNA.

2, the removal of the RNA of wild soybean seedling extraction and genomic dna

1) above-mentioned different methods each the about 100mg of wild soybean seedling material after handling that learns from else's experience, liquid nitrogen grinding is with plant RNAprep Plant Kit (TIANGEN, cat no:DP402) test kit and reference reagent box specification sheets extraction RNA.

2) the DNase I that adopts TaKaRa company removes the genomic dna among the RNA in 37 ℃ of reaction 20-30min.Reaction system is as follows: RNA 40 μ L, 10 * DNase I Buffer, 5 μ L, DNaseI 2 μ L, RNAase Inhibitor 0.5 μ L, RNAase-free ddH2O 2.5 μ L.

3) the phenol chloroform extracting of adding 50 μ L is once got supernatant, with isopyknic isopropanol precipitating RNA, washes precipitation 2 times with 70% ethanol, and RNA is dissolved in the aseptic RNAase-free ddH of 40 μ L ₂O.

4) concentration and the integrity degree by electrophoresis and UV spectrophotometer measuring RNA.

3, RT-PCR legally constituted authority one template DNA concentration

1) reverse transcription of mRNA

The RNA through the wild soybean seedling of different treatment that extracts with step 2 is a template, adopts the synthetic cDNA of ReverseTranscriptase M-MLV RNase H-(TaKaRa, cat no:D2639A) test kit reverse transcription.Get RNA 5 μ L, Oligo dT 1 μ L, 70 ℃ of sex change 10min place cooled on ice rapidly behind the mixing, add 5 * M-MLV Buffer, 2 μ L then, dNTP (10mM) 0.5 μ L, M-MLV ReverseTranscriptase 0.25 μ L, RNAase Inhibitor 0.25 μ L, RNAase-free ddH2O 1 μ L, 42 ℃ of 1h behind the mixing, 70 ℃ of 15min, 4 ℃ store for future use.

2) the content leveling of template cDNA

Go up the soybean actin gene design confidential reference items primer of login according to GenBank, the cDNA through the wild soybean seedling of different treatment that obtains with step 1) is a template, pcr amplification internal control gene (actin gene), and the row agarose gel electrophoresis of going forward side by side detects.According to the electrophoresis result of PCR product template cDNA is diluted then, adjust the consumption of template cDNA, the amount basically identical of the DNA band that amplifies until internal control gene makes the content basically identical of template cDNA in every microlitre solution.

4, GsDREBa gene expression analysis

Utilize the template cDNA of leveling, carry out sxemiquantitative RT-PCR.The DREB class transcription factor GsDREBa transfer-gen plant of the wild soybean GsDREBa expression of gene result that RT-PCR detects under different stress conditions as shown in Figure 8, the GsDREBa expression of gene is subjected to high salt, infiltration, the cryogenic influence as can be seen, but the expression characteristic in root and leaf is also inequality, infers that this gene participates in the abiotic stress signal transduction path with different mechanism with leaf at the root of wild soybean.

Sequence table

＜110〉Northeast Agricultural University

＜120〉the DREB class transcription factor GsDREBa of wild soybean and its base sequence

<160>18

<210>1

<211>392

<212>PRT

＜213〉wild soybean (Glycine Soja)

<400>1

Met?Gly?Ala?Tyr?Asp?Gln?Val?Ser?Leu?Lys?Pro?Leu?Asp?Ser?Ser?Arg

1 5 10 15

Lys?Arg?Lys?Ser?Arg?Ser?Arg?Gly?Asp?Gly?Ser?Lys?Ser?Val?Ala?Glu

20 25 30

Thr?Ile?Ala?Lys?Trp?Lys?Glu?Tyr?Asn?Glu?His?Leu?Tyr?Ser?Gly?Lys

35 40 45

Asp?Asp?Ser?Arg?Thr?Thr?Arg?Lys?Ala?Pro?Ala?Lys?Gly?Ser?Lys?Lys

50 55 60

Gly?Cys?Met?Lys?Gly?Lys?Gly?Gly?Pro?Gln?Asn?Ser?Gln?Cys?Asn?Tyr

65 70 75 80

Arg?Gly?Val?Arg?Gln?Arg?Thr?Trp?Gly?Lys?Trp?Val?Gly?Glu?Ile?Arg

85 90 95

Glu?Pro?Asn?Arg?Gly?Ser?Arg?Leu?Trp?Leu?Gly?Thr?Phe?Ser?Ser?Ala

100 105 110

Gln?Glu?Ala?Ala?Leu?Ala?Tyr?Asp?Glu?Ala?Ala?Arg?Ala?Met?Tyr?Gly

115 120 125

Pro?Cys?Ala?Arg?Leu?Asn?Phe?Pro?Glu?Ile?Thr?Asp?Tyr?Pro?Ser?Val

130 135 140

Lys?Glu?Ser?Leu?Lys?Asp?Ser?Ser?Met?Ala?Ala?Ser?Ser?Ser?Cys?Ser

145 150 155 160

Ser?Ala?Ala?Thr?Ala?Ala?Ser?Asp?Thr?Thr?Thr?Thr?Thr?Ser?Asn?Gln

165 170 175

Ser?Glu?Val?Cys?Ala?Val?Glu?Asp?Val?Ile?Glu?Lys?Pro?Ala?Asn?Val

180 185 190

Asn?Asp?Lys?Phe?Asn?Asp?Cys?His?Lys?Ala?Tyr?Val?Ser?Ala?Ser?Pro

195 200 205

Thr?Ser?Arg?Met?Lys?Gln?Glu?Pro?Arg?Asp?Glu?Ala?Val?Asp?His?Met

210 215 220

Asp?Thr?Gly?Ala?Gly?Glu?Ile?Gln?Asp?Val?Gly?Leu?Glu?Gly?Thr?His

225 230 235 240

Asp?Thr?Gly?Gln?Val?Ala?Glu?Asn?Val?Asn?Lys?Asp?Gln?Met?Asp?Leu

245 250 255

Ser?Trp?Ile?Asp?Gly?Leu?Asp?Phe?Ile?Asp?Asp?Tyr?Leu?Lys?Ser?Leu

260 265 270

Ser?Ala?Asp?Glu?Leu?Phe?Gln?Val?Asp?Glu?Leu?Leu?Gly?Leu?Ile?Asp

275 280 285

Asn?Asn?Pro?Ile?Asp?Asn?Ser?Val?Leu?Met?Gln?Gly?Leu?Asp?Phe?Gly

290 295 300

Gln?Met?Gly?Phe?Pro?Gly?Asp?Gly?Asn?Pro?Gln?Val?Asp?Asp?Thr?Pro

305 310 315 320

Ser?Ser?Phe?Ile?Tyr?Gln?Leu?Gln?Asn?Pro?Asp?Ala?Lys?Leu?Leu?Gly

325 330 335

Ser?Leu?Pro?His?Met?Glu?Gln?Thr?Pro?Ser?Gly?Val?Asp?Tyr?Gly?Leu

340 345 350

Asp?Phe?Leu?Lys?Thr?Val?Glu?Pro?Gly?Asp?Tyr?Asn?Gly?Gly?Gly?Glu

355 360 365

Glu?Pro?Pro?Phe?Leu?Asn?Leu?Asp?Asp?Asp?Leu?Asn?His?Asp?Ser?Asn

370 375 380

Gly?Met?Gln?Ala?Arg?Lys?Gly?Gly

385 390

<210>2

<211>1360

<212>DNA

＜213〉wild soybean (Glycine Soja)

<400>2

tttcattgag?tactgtgtgg?cgaagtttgt?gtcttggatt?ttgtggacat?gggtgcttat 60

gatcaagttt?ctcttaagcc?attggattct?tctagaaaga?ggaaaagtag?gagcagaggg?120

gatgggtcca?aatctgtggc?tgagactatt?gcaaagtgga?aggaatacaa?tgagcatctt?180

tattctggca?aagatgatag?tagaacaact?cgtaaggcgc?cggctaaagg?ttcgaagaaa?240

gggtgcatga?aagggaaggg?aggacctcaa?aattctcagt?gtaactacag?aggagttagg?300

cagaggacat?gggggaaatg?ggttggtgag?attagggaac?ccaatagagg?aagcaggctt?360

tggttgggta?ccttctcttc?tgcccaggaa?gctgctcttg?cctatgatga?agctgctaga?420

gctatgtatg?gtccttgtgc?acgcctcaat?tttcccgaaa?tcacagatta?tccttctgtt?480

aaggaatcgt?tgaaggactc?ttcgatggct?gcatcgtcgt?cttgttcttc?ggcagcaact?540

gcagcatctg?acactactac?tacaacatcg?aaccaatcgg?aggtttgtgc?tgttgaggat?600

gttatcgaga?aacctgcgaa?tgtgaatgat?aagtttaatg?attgtcataa?ggcttacgta?660

tctgcctcac?caactagtag?aatgaagcaa?gagcctaggg?atgaggctgt?ggaccacatg 720

gacacagggg?ctggggaaat?tcaagatgtc?ggactagaag?gaacacatga?tactgggcag 780

gttgcagaga?atgtaaataa?agatcagatg?gatttgtcat?ggattgatgg?ccttgacttt 840

attgacgatt?acttgaagag?cctttccgcg?gatgagttat?ttcaggtgga?cgaacttttg 900

gggcttatag?ataataaccc?aatcgataac?tctgtgttga?tgcaaggttt?ggattttgga 960

caaatgggtt?ttcctggaga?tggtaatcct?caggttgacg?atactccttc?aagctttatt 1020

tatcagttgc?aaaatccaga?tgccaagttg?ttaggaagtt?tgccccatat?ggagcagaca 1080

ccatcaggtg?ttgattatgg?attagatttc?ttgaaaacag?tggagccagg?ggactataat 1140

ggtggagggg?aagaaccacc?atttcttaat?ttggatgatg?atctaaacca?tgattcaaat 1200

ggcatgcaag?caaggaaggg?tggctagaga?aggctacgtg?tatctgcttc?attttcaact 1260

ggttctagcg?tctgctggta?atctgtctct?tgggctgttg?tccccttttt?agctatataa 1320

taggcgcata?agaggaatac?ccctatacaa?ctaatacaag 1360

<210>3

<211>63

<212>PRT

＜213〉wild soybean (Glycine Soja)

<220>

＜223〉the conservative AP2/EREBP structural domain sequence of the DREB class transcription factor GsDREBa of wild soybean.

<400>3

Thr?Gln?Asn?Ser?Gln?Cys?Asn?Tyr?Arg?Gly?Val?Arg?Gln?Arg?Thr?Arg

1 5 10 15

Gly?Lys?Trp?Val?Gly?Glu?Ile?Arg?Glu?Pro?Asn?Arg?Gly?Ser?Arg?Leu

20 25 30

Trp?Leu?Gly?Thr?Phe?Ser?Ser?Gln?Pro?Glu?Ala?Ala?Leu?Ala?Tyr?Asp

35 40 45

Glu?Ala?Ala?Arg?Ala?Met?Tyr?Gly?Pro?Cys?Ala?Ile?Leu?Asn?Phe

50 55 60

<210>4

<211>17

<212>DNA

＜213〉artificial sequence

<220>

<221>misc_feature

<222>(3，12，13，14，15)

＜223〉h=a or g or c, d=a or g or t, k=g or t, s=g or c

<220>

＜223〉conservative relatively DREBP/AP2 structural domain clone's degenerated primer GsAP2 (+).

<400>4

gghaaatggg?tdkshga 17

<210>5

<211>17

<212>DNA

＜213〉artificial sequence

<220>

<221>misc_feature

<222>(3，6，9，12，13，14)

＜223〉r=a or g, d=a or g or t, k=g or t, m=a or c

<220>

＜223〉conservative relatively DREBP/AP2 structural domain clone's degenerated primer GsAP2 (-).

<400>5

ggraarttra?gdmkagc?17

<210>6

<211>22

<212>DNA

＜213〉artificial sequence

<220>

＜223〉primer 3 of RACE ' RACE1 (+) sequence.

<400>6

gaggagttag?gcagaggaca?cg?22

<210>7

<211>20

<212>DNA

＜213〉artificial sequence

<220>

＜223〉primer 3 of RACE ' RACE1 (-) sequence.

<400>7

ggccacgcgt?cgactagtac?20

<210>8

<211>19

<212>DNA

＜213〉artificial sequence

<220>

＜223〉primer 3 of RACE ' RACE2 (+) sequence.

<400>8

gcaggctttg?gttgggtac 19

<210>9

<211>22

<212>DNA

＜213〉artificial sequence

<220>

＜223〉primer 3 of RACE ' RACE3 (+) sequence.

<400>9

gctgctcttg?cctatgatga?ag?22

<210>10

<211>36

<212>DNA

＜213〉artificial sequence

<220>

<221>misc_feature

<222>(24，25，29，30，34，35)

＜223〉d=a or g or t

<220>

＜223〉primer 5 of RACE ' RACE1 (+) sequence.

<400>10

ggccacgcgt?cgactagtac?gggddgggdd?gggddg?36

<210>11

<211>22

<212>DNA

＜213〉artificial sequence

<220>

＜223〉primer 5 of RACE ' RACE1 (-) sequence.

<400>11

aaggatagca?caaggaccat?ac?22

<210>12

<211>22

<212>DNA

＜213〉artificial sequence

<220>

＜223〉primer 5 of RACE ' RACE2 (+) sequence.

<400>12

gaggagttag?gcagaggaca?cg?22

<210>13

<211>20

<212>DNA

＜213〉artificial sequence

<220>

＜223〉primer 5 of RACE ' RACE2 (-) sequence.

<400>13

tgcttcctct?attgggctcc?20

<210>14

<211>22

<212>DNA

＜213〉artificial sequence

<220>

＜223〉primer 5 of RACE ' RACE3 (-) sequence.

<400>14

cgtgtcctct?gcctaactcc?tc?22

<210>15

<211>30

<212>DNA

＜213〉artificial sequence

<220>

＜223〉according to sequences Design amplification total length primer GsDREBa all (+) sequences of splicing.

<400>15

cacggatcca?gtttgattga?gtactgtgtg?30

<210>16

<211>30

<212>DNA

＜213〉artificial sequence

<220>

＜223〉according to sequences Design amplification total length primer GsDREBa all (-) sequences of splicing.

<400>16

ggcgagctcc?ttgtattagt?tgtatagggg?30

<210>17

<211>78

<212>DNA

＜213〉artificial sequence

<220>

＜223〉the GsDREBa transcription factor in yeast cell with DRE combination of elements specificity analysis with 4 multiple DRE units

The just sequence D RE (+) of part.

<400>17

aattcatact?accgacatga?gtatactacc?gacatgagta?tactaccgac?atgagtatac?60

taccgacatg?agtgagct?78

<210>18

<211>70

<212>DNA

＜213〉artificial sequence

<220>

The antisense sequences DRE (-) of part.

<400>18

gtatgatggc?tgtactcata?tgatggctgt?actcatatga?tggctgtact?catatgatgg?60

ctgtactcac?70

Claims

1. the DREB class transcription factor GsDREBa of wild soybean is characterized in that the DREB class transcription factor GsDREBa of wild soybean has abiotic stress resistance, and has one of following amino acid sequences:

①

MetGlyAlaTyrAspGlnValSerLeuLysProLeuAspSerSerArgLysArgLysSerArgSerArgGlyAspGlySerLysSerValAlaGluThrIleAlaLysTrpLysGluTyrAsnGluHisLeuTyrSerGlyLysAspAspSerArgThrThrArgLysAlaProAlaLysGlySerLysLysGlyCysMetLysGlyLysGlyGlyProGlnAsnSerGlnCysAsnTyrArgGlyValArgGlnArgThrTrpGlyLysTrpValGlyGluIleArgGluProAsnArgGlySerArgLeuTrpLeuGlyThrPheSerSerAlaGlnGluAlaAlaLeuAlaTyrAspGluAlaAlaArgAlaMetTyrGlyProCysAlaArgLeuAsnPheProGluIleThrAspTyrProSerValLysGluSerLeuLysAspSerSerMetAlaAlaSerSerSerCysSerSerAlaAlaThrAlaAlaSerAspThrThrThrThrThrSerAsnGlnSerGluValCysAlaValGluAspValIleGluLysProAlaAsnValAsnAspLysPheAsnAspCysHisLysAlaTyrValSerAlaSerProThrSerArgMetLysGlnGluProArgAspGluAlaValAspHisMetAspThrGlyAlaGlyGluIleGlnAspValGlyLeuGluGlyThrHisAspThrGlyGlnValAlaGluAsnValAsnLysAspGlnMetAspLeuSerTrpIleAspGlyLeuAspPheIleAspAspTyrLeuLysSerLeuSerAlaAspGluLeuPheGlnValAspGluLeuLeuGlyLeuIleAspAsnAsnProIleAspAsnSerValLeuMetGlnGlyLeuAspPheGlyGlnMetGlyPheProGlyAspGlyAsnProGlnValAspAspThrProSerSerPheIleTyrGlnLeuGlnAsnProAspAlaLysLeuLeuGlySerLeuProHisMetGluGlnThrProSerGlyValAspTyrGlyLeuAspPheLeuLysThrValGluProGlyAspTyrAsnGlyGlyGlyGluGluProProPheLeuAsnLeuAspAspAspLeuAsnHisAspSerAsnGlyMetGlnAlaArgLysGlyGly；

2. the base sequence of the DREB class transcription factor GsDREBa of wild soybean according to claim 1 is characterized in that the DREB class transcription factor GsDREBa of the wild soybean that the base sequence of DREB class transcription factor GsDREBa of wild soybean is coded has abiotic stress resistance.