CN109879946A - Suspension culture of Aquilaria sinensis AsWRKY44 transcription factor and its application - Google Patents

Abstract

The present invention discloses a kind of suspension culture of Aquilaria sinensis AsWRKY44 transcription factor and its application, is related to genetic engineering field, more particularly to one kind forms relevant suspension culture of Aquilaria sinensis AsWRKY44 transcription factor and its application to agalloch eaglewood.The transcription factor passes through in conjunction with the W-box in the promoter of suspension culture of Aquilaria sinensis sesquiterpene synthase ASS1, inhibit the transcriptional expression of sesquiterpene synthase gene under normal condition, under injury and injury signal induction, AsWRKY44 degradation, inhibiting effect releases, sesquiterpene synthase gene promoter transcriptional expression, synthesize agalloch eaglewood sequiterpene, to form agalloch eaglewood, the present invention does not only disclose the core element mechanism of wound induced agalloch eaglewood formation, and the also foundation for suspension culture of Aquilaria sinensis stability and high efficiency Edgeworthia chrysantha technology provides a kind of new theory and method.

Description

Suspension culture of Aquilaria sinensis AsWRKY44 transcription factor and its application

Technical field

The present invention relates to genetic engineering field more particularly to a kind of suspension culture of Aquilaria sinensis AsWRKY44 transcription factor and its applications.

Background technique

Agalloch eaglewood category suspension culture of Aquilaria sinensis (Aquilaria sinensis) is the distinctive rare or endangered species in China, is China's production Unique certified products plant origin of rare aromatics medicinal material agalloch eaglewood.Agalloch eaglewood is used as medicine to be passed in China's traditional Chinese medicine, Tibetanmedicine and India It is with a history of thousands of years in medicine of uniting.Also it gains the name due to it is abounded in history and exports agalloch eaglewood in Hong Kong.However, the whitewood of health Fragrant tree body cannot generate agalloch eaglewood, only when coming to harm could Edgeworthia chrysantha (Ng, 1997；Itoh,et al.,2002； Pojanagaroon and Kaewrak,2005； Persoon,2008).Studies have shown that sesquiterpenoids substance is agalloch eaglewood medicinal material Main ingredient and its essential oil main component (Hashimoto et al., 1985；Chen et al.,2011, Chen et al.,2012).Agalloch eaglewood sequiterpene in healthy suspension culture of Aquilaria sinensis tree almost without, be tree body come to harm induction after start Corresponding metabolic pathway synthesis, therefore, agalloch eaglewood can not be obtained on the suspension culture of Aquilaria sinensis tree of normal health.

Sesquiterpene synthase ASS is the key enzyme that FPP synthesis sequiterpene is catalyzed in sequiterpene biosynthesis pathway.Early period we A crucial sesquiterpene synthase Gene A SS1 is cloned from suspension culture of Aquilaria sinensis, purifying protein can be catalyzed in vitro by substrate of FPP Synthesize three kinds of agalloch eaglewood Sesquiterpene Polyesterss δ-guaiene (δ-guaiene), α-guaiene (α-guaiene) and beta-elemene (β-elemene), the gene are hardly expressed in the tree body of health and callus, but MeJA processing is remarkably improved its table Up to (Xu et al., 2013).Therefore, sesquiterpene synthase Gene A SS1 is typical expression profile, and in transcription water Flat there are important regulating and controllings, however, the transcription regulation mechanism about agalloch eaglewood sesquiterpene synthase gene has not been reported.

Transcriptional control is the interaction by promoter, the transcription factor being incorporated in promoter and rna plymerase ii Come what is completed, the behaviors such as the starting of genetic transcription is controlled, activates or inhibits.Transcription factor is divided into transcription according to its adjusting function Activation and Transcription inhibition.Currently, the positive regulation research in plant about transcription activator is more, such as Liao Yong emerald green public It is had found in " Study on Molecular Mechanism that JA signal pathway the participates in regulation agalloch eaglewood sequiterpene biosynthesis " doctoral thesis opened May MYC2 positive regulator subbase in conjunction with the G-BOX of sequiterpene and enzyme gene ASS1 promoter because, and with MYC2 positive regulator The JAZ gene of sub- interaction, and it is relatively weak to the research of Transcription inhibition, but Transcription inhibition is in terms of adjusting plant life, growth It has a very important role.

Therefore it provides a kind of repressor for the core element mechanism that agalloch eaglewood can be induced to be formed is also extremely important.

Summary of the invention

For many-sided regulation for realizing suspension culture of Aquilaria sinensis tree body Secondary metabolites and its regulation of resistance, the present invention is provided A kind of suspension culture of Aquilaria sinensis transcription factor AsWRKY44 gene and its coding albumen, transcription factor AsWRKY44 provided by the invention by with W-box in the promoter of suspension culture of Aquilaria sinensis sesquiterpene synthase ASS1 is combined, and as a regulating switch, controls sesquialter under different conditions The inhibition transcriptional expression or starting transcriptional expression of diterpene synthase gene, realize the regulation of agalloch eaglewood sequiterpene synthesis, provided by the invention Transcription factor does not only disclose the core element mechanism of wound induced agalloch eaglewood formation, is also suspension culture of Aquilaria sinensis stability and high efficiency Edgeworthia chrysantha technology It establishes and a kind of new theory and method is provided.

Technical purpose to realize the present invention, the present invention provide a kind of transcription factor AsWRKY44, heavy from Thymelaeceae Fragrant Pterostyrax suspension culture of Aquilaria sinensis (Aquilaria sinensis) is:

1) there is the amino acid sequence as shown in SEQ ID NO.1.

2) amino acid sequence shown in SEQ ID NO.1 by the substitution of one or several amino acid residues and/or is replaced It changes and/or adds and the protein with the same function as derived from SEQ ID NO.1.

The substitution of said one or several amino acid residues and/or missing or/or to be added to no more than 10 amino acid residual The substitution of base and/or missing or/or addition.

Wherein, amino acid sequence shown in SEQ ID NO.1 is made of 542 amino acid residues.

The cDNA molecule for encoding above-mentioned protein is also the scope of protection of the invention.

Above-mentioned cDNA molecule is any cDNA molecule as shown in i)-iii)；

I) there is the nucleotide sequence as shown in SEQ ID NO.2；

Ii) under strict conditions with 1) shown in DNA molecular hybridize can be with the nucleotide sequence of interaction；

Iii) and i) or ii) gene with 90% or more homology and the nucleotide sequence of encoding said proteins.

Wherein, the transcription factor AsWRKY44 can pass through artificial synthesized according to above-mentioned amino acid sequence, or according to upper It states nucleotide sequence and first synthesizes its encoding gene, then carry out biological expression and obtain.

Technical purpose to realize the present invention, the present invention also provides the expression cassettes of encoding transcription factors AsWRKY44.

Technical purpose to realize the present invention, the present invention also provides the recombinant expression of encoding transcription factors AsWRKY44 loads Body.

Wherein, the recombinant expression carrier is to be inserted into encoding gene between the multiple cloning sites of pET-28a carrier to obtain Recombinant expression carrier.

The primer pair for expanding any of the above-described encoding gene overall length or its any segment also belongs to protection model of the invention It encloses.

The primer pair for editing any of the above-described encoding gene overall length or its any segment also belongs to protection model of the invention It encloses.

Technical purpose to realize the present invention, the present invention also provides the transgenic cells of encoding transcription factors AsWRKY44 System.

Technical purpose to realize the present invention, the present invention also provides the recombinant bacteriums of encoding transcription factors AsWRKY44.

Above-mentioned albumen, above-mentioned cDNA analysis or above-mentioned expression cassette, recombinant expression carrier, transgenic cell line or recombinant bacterium exist Regulating and controlling the application in plant tissue in Gene Transcription in vitro is also the scope of protection of the invention.

Wherein, the plant is suspension culture of Aquilaria sinensis.

Wherein, described to be regulated to inhibit.

Wherein, the regulation is to inhibit the expression of sesquiterpene synthase Gene A SS1 under health status.

Above-mentioned albumen, above-mentioned cDNA molecule or above-mentioned recombinant vector, expression cassette, transgenic cell line or recombinant bacterium are regulating and controlling Application in plant in sesquiterpene synthase gene expression is also protection scope of the present invention.

Above-mentioned albumen, above-mentioned cDNA molecule or above-mentioned recombinant vector, expression cassette, transgenic cell line or recombinant bacterium are regulating and controlling The application of Secondary Metabolism of Plant and resistance is also protection scope of the present invention.

Above-mentioned albumen, above-mentioned cDNA molecule or above-mentioned recombinant vector, expression cassette, transgenic cell line or recombinant bacterium are regulating and controlling The application of agalloch eaglewood synthesis is also protection scope of the present invention.

Wherein, the plant is specially suspension culture of Aquilaria sinensis.

Wherein, the secondary metabolism is agalloch eaglewood sequiterpene.

Wherein, the resistance refers to the resilience to external injury.

It is prepared by above-mentioned albumen, above-mentioned cDNA molecule or above-mentioned recombinant vector, expression cassette, transgenic cell line or recombinant bacterium Application in genetically modified plants is also protection scope of the present invention.

Wherein, the genetically modified plants can directly synthesize the suspension culture of Aquilaria sinensis of agalloch eaglewood.

Wherein, the genetically modified plants can use gene editing technology and be prepared.Wherein, the genetically modified plants can To be prepared by knocking out transcription factor AsWRKY44 from suspension culture of Aquilaria sinensis genome.

The utility model has the advantages that

AsWRKY44 transcription factor provided by the invention can in conjunction with the key regulatory section W-box of ASS1 promoter, So that suspension culture of Aquilaria sinensis is inhibited the normal transcription of target gene sesquiterpene synthase gene under health status, under the conditions of injury or injury signal AsWRKY44 albumen is set gradually to degrade under induction, to release its inhibiting effect to target gene sesquiterpene synthase gene, target base Because sesquiterpene synthase Gene A SS1 is expressed, agalloch eaglewood sesquiterpenoids substance starts to synthesize, and ultimately forms rare traditional Chinese medicine agalloch eaglewood, The secondary metabolite of suspension culture of Aquilaria sinensis and the regulation of resistance are realized, provides a kind of practicable side for suspension culture of Aquilaria sinensis production field Method.

Detailed description of the invention

Fig. 1 is apoptotic nueleolus of the AsWRKY44 gene in protoplasts of Arabidopsis thaliana broken by ultrasonic；

Fig. 2 is the expression of results that pET-28a-AsWRKY44 is transformed into whole bacterial protein in e. coli bl21 (DE3)；

Fig. 3 is the polyacrylamide gel electrophoresis result of AsWRKY44 albumen after purification；

Fig. 4 is AsWRKY44 and the chromatin immune of ASS1 interaction is co-precipitated result；

Fig. 5 is AsWRKY44 and the chromatin immune of ASS1 interaction is co-precipitated result and counts column diagram；

Fig. 6 is that MeJA handles lower difference AsWRKY44 protein level testing result；

Fig. 7 is the real-time PCR testing result that MeJA handles lower difference ASS1 gene transcription level.

Specific embodiment

Experimental method used in following embodiments is conventional method unless otherwise specified.Institute in following embodiments Material, reagent etc., are commercially available unless otherwise specified, and structure as used in the following examples is such as without spy It does not mentionlet alone bright, is conventional structure, it will be appreciated by those skilled in the art that specifically described content is illustrative rather than limit below Property processed, should not be limited the scope of the invention with this.

The acquisition of 1 AsWRKY44 gene of embodiment

Using ASS1 promoter as bait, a positive colony is screened by conventional yeast one-hybrid, by being sequenced and comparing It is right, it is compared in suspension culture of Aquilaria sinensis genome and arrives AsWRKY44 sequence.Total serum IgE is extracted from suspension culture of Aquilaria sinensis callus, by its reverse transcription For cDNA.Using cDNA as template, using F1 and R1 as primer, carries out PCR amplification and produced to get the amplification of AsWRKY44 full length gene Object, wherein primers F 1 and R1 are as follows:

F1:ATGGCCTCCTCTTATAGCAGCTT；

R1:TCAACTCAAGAATGCCTCAAGGAAC。

It is sequenced after the PCR product gel-purified that amplification obtains is recycled.Sequencing result shows pcr amplification product sequence Column overall length is 1629bp, and nucleotide sequence can be encoded as shown in SEQ ID NO.2 with ammonia shown in SEQ ID NO.1 The protein of base acid residue sequence, wherein SEQ ID NO.1 is made of 321 amino acid residues.It is by the unnamed gene The albumen that the gene encodes is named as AsWRKY44 albumen by AsWRKY44 gene.

The positioning analysis of 2 AsWRKY44 gene of embodiment

1, apoptotic nueleolus of the AsWRKY44 gene in protoplasts of Arabidopsis thaliana broken by ultrasonic

It is chosen at the Arabidopsis leaf of the 3-4 weeks health and non-bolting that grow under 12h illumination/12h dark illumination condition, is used Blade is cut into the slice of about 1mm wide perpendicular to main lobe arteries and veins, is placed in mannitol solution.Slice is moved into enzyme from mannitol solution Liquid is solved, is protected from light, 23 DEG C of 50rpm shake slowly, digest 3h.Enzymolysis liquid is filtered with 200 mesh sieve.Collect filtrate, 4 DEG C of 100g centrifugations 1 Min abandons supernatant, and it is spare to collect protoplast.Protoplast is softly hanged with the W5 buffer being pre-chilled in equal volume, 4 DEG C of 100g from Heart 1min.Supernatant is abandoned, the W5 solution that protoplast is pre-chilled in equal volume with 1/2 softly hangs, and places 30min on ice.4℃ 100g It is centrifuged 1min, abandons supernatant, (each sample 200 μ l MMg) are resuspended with appropriate MMg buffer.Operate below 23 DEG C into Row.20 μ g plasmids are added in the protoplast that 200 μ l MMg are resuspended, add 220 μ l PEG/Ca2+ solution, with cutting off point The pipette tips at end softly mix.23 DEG C of avoid light place 30min.880 μ l W5 buffers are added, are gently mixed by inversion, 100g centrifugation 1min.Supernatant is abandoned, 100 μ l W5 buffers are added and have been hanged, 100g is centrifuged 1min, is repeated once.Supernatant is abandoned, 1ml is added W5 buffer, is gently mixed by inversion.It is placed in tissue culture plate, 23 DEG C, is protected from light culture 12-16 h.Fluorescent material is in Zeiss It is observed under LSM 510META type laser confocal microscope.When observing GFP fluorescence and Chloroplast auto-fluorescence simultaneously, 488nm is used Argon-ion laser excitation, the filtering of 545nm spectroscope, GFP fluorescence signal are detected with 505-530 nm, Chloroplast auto-fluorescence It is detected with 560nm, testing result is as shown in Figure 1, it is seen then that apoptotic nueleolus of the AsWRKY44 gene in protoplasts of Arabidopsis thaliana broken by ultrasonic Clearly.

The building of 3 prokaryotic expression carrier of embodiment

The present invention designs special primer according to AsWRKY44CDS full length sequence, expands by template of the single-stranded cDNA of suspension culture of Aquilaria sinensis AsWRKY44 constructs pET-28a-AsWRKY44 recombinant plasmid, through the verifying of Hind III and XhoI double digestion and sequence verification, really Surely the pET-28a-AsWRKY44 prokaryotic expression carrier obtained is correct.

Special primer is designed according to AsWRKY44CDS full length sequence, F2:ATGGCCTCCTCTTATAGCAGCTT, R2: ACTCAAGAATGCCTCAAGGAACA；And BamH1 restriction enzyme site is added in upstream :-

cccGGATCCXhoI restriction enzyme site is added in ATGGCCTCCTCTTATAGCAGCTT-, downstream :-

ccgCTCGAGACTCAAGAATGCCTCAAGGAACA-。

The single-stranded cDNA of suspension culture of Aquilaria sinensis obtained using embodiment 1 as template, with Premix PrimeStar HS (TAKARA, Japan it) is expanded, whole system is 50ul；Amplification program are as follows: 94 DEG C of initial denaturation 5min；Then 94 DEG C of 30s, 59 DEG C of 30s, 72 DEG C of 2min, 34 circulations；Last 72 DEG C of extensions 10min.Amplified production is recycled with plastic recovery kit (Tiangeng, China), It is connected in Blunt Simple carrier T (Quan Shijin, China), Transformed E .coli Trans1-T1 competence (Quan Shijin, China the sequencing of Radix Polygalae Biotechnology Co., Ltd) is won by Beijing three.Correct Blunt Simple-AsWRKY44 weight will be sequenced Group plasmid and pET-28a vector plasmid carry out double digestion with Hind III and XhoI respectively, after recycling endonuclease bamhi, are connected using T4 It connects 16 DEG C of enzyme (NEB, UK) connections overnight, connection product is transformed into E.coli Dh5 α competent cell (Tiangeng, China) Afterwards, it is uniformly coated on the LB solid medium containing 50ng/ μ l Kan, 12-16h is cultivated in 37 DEG C of inversions.Through bacterium solution PCR and The positive colony pET-28a-AsWRKY44 plasmid of digestion identification carries out sequencing identification.Sequencing result shows pET-28a- AsWRKY44 plasmid is the Hind that SEQ ID NO.2AsWRKY44 gene in sequence table is inserted into pET-28a expression vector The carrier obtained between III and XhoI double enzyme site, the successful expression in E.coli BL21 (DE3) competence.

The building of 4 recombinant bacterium of embodiment

The present invention is cultivated by E.coli BL21 (DE3) positive colony containing recombinant plasmid, induces pET- 28a-AsWRKY44 expressing fusion protein, and purify, destination protein is obtained, and the bacterium with the destination protein is recombinant bacterium.

E.coli BL21 (DE3) positive colony shake culture containing recombinant plasmid is stayed overnight, bacterium solution is with 1:100 ratio It is diluted in the fluid nutrient medium containing 50 ng/ μ l Kan, 37 DEG C of cultures to OD₆₀₀When about 0.4~0.6, IPTG is added extremely Final concentration of 0.5 mmolL^-1, continue to cultivate 4h and 6h, thalline were collected by centrifugation, is resuspended through 1x PBS (PH 7.4), boiling water boiling After boiling 5min makes albuminous degeneration, analyzed through 10%SDS-PAGE electrophoresis detection.Result is analyzed as shown in Fig. 2, swimming lane M is in figure The Protein Marker of 97.2KD, swimming lane 1 are that pET-28a zero load does not induce, swimming lane 2 is pET-28a zero load induction, swimming lane 3 It is not induced for pET-28a-AsWRKY44, swimming lane 4 is that pET-28a-AsWRKY44 induces 4h, and swimming lane 5 is pET-28a- AsWRKY44 is not induced, and swimming lane 6 is that the albumen that pET-28a-AsWRKY44 induces 6h. largely to induce crosses Ni column purification, such as Fig. 3 institute Show, is purified to the single band that size is 59KD, it is consistent with prediction molecular weight of albumen, illustrate that the band is the purpose correctly expressed Albumen thereby determines that the bacterium with the destination protein is recombinant bacterium.Swimming lane M is the Protein Marker of 97.2KD, swimming in figure Road 1 is eluent, swimming lane 2~8 is respectively that albumen wash-out the 1st~7 is managed.

The functional verification of AsWRKY44

One, the chromatin immune of AsWRKY44 and ASS1 interaction is co-precipitated experiment

1, chromatinic extraction

It takes the tender suspension culture of Aquilaria sinensis blade of 1.5g formaldehyde crosslinking 20 minutes in vacuum filling, 2.5mL, the sweet ammonia of 2M is then added Acid terminates crosslinking.Crosslinked material is poured on gauze, is first rinsed with tap water, then uses ddH₂O is rinsed, and then moves material Water is blotted on to blotting paper, crosslinked material is fully ground after liquid nitrogen flash freezer, with the 25ml Nuclei of pre-cooling Ground material is resuspended in isolation buffer, is placed on ice until it is melted completely.After the filtering of 200 mesh sieve, 4 DEG C of 12000rpm are centrifuged 20min；Supernatant is abandoned, precipitating is resuspended with the 2ml Nuclei lysis buffer of pre-cooling；It is incited somebody to action on ice Re-suspension liquid is dispensed into 1.5ml centrifuge tube by every 500 μ l portion.Ultrasonication is carried out on ice, and super 5s stops 10s, 200W ultrasound 10 Secondary, obtaining DNA segment is 250-1000bp.4 DEG C of 12000rpm are centrifuged 10min, collect supernatant and protease inhibitors is added, Every group of sample need to be packed as 3 pipes: 50 μ l input (4 DEG C save backup, whether suitable as positive control and detection ultrasound), 100 μ L sample, 100 μ l samples.

2, co-immunoprecipitation

It is separately added into 900 μ l Nuclei lysis buffer in 3 part of 100 μ l sample, and 50 μ l Protain are added A overturns at a slow speed 1h at 4 DEG C and carries out pre cleaning.4 DEG C of 4000rpm are centrifuged 2min, and supernatant is transferred in a new pipe.5 μ l are added Corresponding antibody (1-3 μ g), preimmune serum is as control, 4 DEG C of reverse overnight incubations.60 μ l Protein A are added, 4 DEG C incubate Educate 2 h.4 DEG C of 4000rpm are centrifuged 2min, precipitate pearl completely, abandon supernatant.It is washed at 4 DEG C.4 DEG C of 4000rpm are centrifuged 2min, Supernatant is abandoned, 250 μ l Elution buffer of Fresh are added in every pipe, room temperature overturns 30min, 4000rpm centrifugation 2min allows Protein A to precipitate, takes supernatant.450 μ l Nuclei lysis are added in previously stored 50 μ l input buffer。

3, solution crosslinking and digestible protein

Three manage while carrying out.20 μ l 5M NaCl, 65 DEG C of warm bath 4-6h are added or stay overnight.Of short duration centrifugation after warm bath, every pipe The 20 μ l 0.25M μ l 20mg/ml Proteinase K of EDTA, 20 μ l 1M Tris-HCl (pH 8.0), 2 are added, 45 DEG C incubate Educate 1.5h.

4, DNA is precipitated

275 μ l phenol are added, 264 μ l chloroforms, 11 μ l isoamyl alcohol are into sample, 4 DEG C of 12000rpm centrifugations 5 after concussion mixes min.About 500 μ l supernatants are transferred in a new pipe, 100% ethyl alcohol of 2.5 times of volumes, the 3M vinegar of 1/10 μ l volume is added The sour μ of sodium pH 5.2 and 4 l 20mg/ml glycogen at least places 1h for -20 DEG C after mixing completely.4 DEG C of 12000rpm centrifugations 15min removes supernatant, and 500 μ l, 70% ethyl alcohol is added into precipitating.4 DEG C of 12000rpm are centrifuged 5min, carefully remove supernatant, It is dry in room temperature, completely remove the ethyl alcohol in precipitating.Add 50 μ l ddH2O dissolving DNAs.

5, PCR is detected

With obtained DNA (input, sample and negative control) for template, primer is the critical section in ASS1 promoter The primer at the both ends (242bp): F:5 '-CTCATGTTTTTCAAGGATGCTGTC-3 ', R:5 '- AACTTTGCCACTTGCCATTCG-3 ' carries out PCR and real-time quantitative PCR reaction, carries out electrophoresis detection, detection to reaction product As a result as shown in figure 4, it is template, the PCR product of amplification that swimming lane ck, which is the DNA that preimmune serum obtains,；Swimming lane Input is gene Group DNA is template, the PCR product of amplification；Swimming lane AsWRKY44 is that the DNA that AsWRKY44 antibody precipitates is template, amplification PCR product, show that swimming lane AsWRKY44 band is bright in figure, size 242bp illustrates to be sunk with the antibody of AsWRKY44 It forms sediment to the 242bpDNA segment of ASS1 promoter, it was demonstrated that the body of AsWRKY44 and ASS1 promoter critical section 242bp segment Interior combination.

Fig. 5 is the figure drawn according to fluorescent quantitative PCR result relative value.Quantitative fluorescent PCR internal reference is suspension culture of Aquilaria sinensis GADPH base Cause, primer are the section of DNA sequence (control group) in promoter without W-box and the DNA fragmentation containing W-box.Expand Increase primer to be respectively as follows:

DNA fragmentation containing W-box: FI:forward:5 '-CTCATGTTTTTCAAGGATGCTGTC-3 ', reverse: 5′-CGAATGGCAAGTGGCAAAG-3′)；FII:forward:5′-GATGCGTATTTGTTCTTTCTTTTCG-3′, reverse:5′-TTGAATGGTATGAGAACCCGAAG-3′,FIII:forward: 5′- ACAGCCCACGTGGTCATACAAG-3′,reverse:5′-CAAGTTTGCTGTTTTGAGCGATG-3′, FIV:forward: 5′-AGCGCTTGCAGTCAACAGAT-3′,reverse:5′- CAAGTTTGCTGTTTTGAGCGATG-3′,FV:forward: 5′- ACAAAAGGTTTCTGGAAGATAATGG-3′,reverse:5′-CAAGTTTGCTGTTTT GAGCGATG-3′；

DNA fragmentation without W-box: (forward:5 '-CTTCGGGTTCTCA TACCATTCAA-3 '；reverse: 5′- TATGAACGACAAGTCTGGGCAA-3′)；Internal reference GADPH primer are as follows: forward:5 '- CTGGTATGGCATTCCGTGTA-3′and reverse:5′-AACCACATCCTCTTCGGTGTA-3′。

Every group of data are all the duplicate average value of independent biology three times.The results show that AsWRKY44 and ASS1 starts The combination activity highest of the first section on son, although other sections also contain W-box core recognition sequence, its combination degree It is not different with the negative control (FVI) without W-box identification sequence, illustrates the first section in AsWRKY44 and ASS1 promoter W-box combine.

Two, AsWRKY44 gene is the functional verification of Transcription inhibition

The present invention is being injured with the healthy suspension culture of Aquilaria sinensis callus of MeJA processing normal growth, observation suspension culture of Aquilaria sinensis callus Under the conditions of signal MeJA, the protein level of AsWRKY44, ASS1 gene transcription level, verifying AsWRKY44 gene be transcription suppression System and its regulatory mechanism.

1, MeJA handles lower AsWRKY44 protein level detection

The healthy suspension culture of Aquilaria sinensis callus of normal growth is moved into continued growth in the MS culture of the MeJA containing 100uM, Respectively in 0h, 6h, 12h, for 24 hours, 36h, 48h, 4d and 7d sampling, extraction total protein will according to Western blotting method Total protein carries out SDS-PAGE electrophoresis, and on 300mA constant current transferring film 1h to pvdf membrane, 1xTBST is washed film 3 times, and 10 min, is used every time 5% skim milk closes 4h, then dilutes 2000 times of 4 DEG C of incubations with anti-HIS label mouse monoclonal antibody (Quan Shijin, China) Concussion is overnight；Next day is washed film 3 times, each 10min with 1x TBST, after being incubated for 1h with rabbit anti-mouse igg antibody (1:5000), is used 1x TBST is washed film 3 times, each 10min, ECL colour developing, chemiluminescence imaging instrument (ImageQuant LAS 4000mini) imaging, And it saves.Testing result as shown in fig. 6, testing result illustrate MeJA processing after, AsWRKY44 protein level gradually decreases, 48h Band obviously dies down, and until 4d, 7d can't detect band completely, illustrates degradable.

2, MeJA handles the real-time PCR detection of lower difference ASS1 gene transcription level

The healthy suspension culture of Aquilaria sinensis callus of normal growth is moved into continued growth in the MS culture of the MeJA containing 100uM, Respectively in 0h, 6h, 12h, for 24 hours, 36h, 48h, 4d and 7d are sampled, and are extracted total serum IgE reverse transcription and are obtained cDNA template, with ASS1 Forward primer:5 '-AAGAAGATGAAGGAGATGATTGAGA-3 ' and reverse primer:5 '- TAGATACTCAAGCTATGCATCCAAC-3 ' is primer, using GADPH as internal reference, primer are as follows: forward:5 '- CTGGTATGGCATTCCGTGTA-3 ' and reverse:5 '-AACCACATCCTCTTCGGTGTA-3 ' carry out quantitative fluorescent PCR Detection, testing result is as shown in fig. 7, testing result shows after AsWRKY44 transcriptional level is handled by MeJA there is short time (6-12h) is slightly elevated, after maintain initial level always；And the expression of ASS1 significantly increases, from being initially nearly no detectable, 2h increases more than 100 times, is persistently increased to more than 800 times, as shown in Figure 7.As it can be seen that mechanism of the ASS1 gene by MeJA inducing expression Be: AsWRKY44 degrades under MeJA induction, relieves AsWRKY44 inhibiting effect in conjunction with ASS1, ASS1 is caused to express, and demonstrate,proves Clear AsWRKY44 is Transcription inhibition of ASS1.

To sum up, using the combination inhibiting mechanism of transcription factor AsWRKY44 and ASS1, adjustable radix aucklandiae plant is to injury Or the resistance of injury signal, also adjustable suspension culture of Aquilaria sinensis Secondary metabolites synthesis, can also be used for agalloch eaglewood sesquialter The synthesis application of terpene provides a kind of new theory method for suspension culture of Aquilaria sinensis stability and high efficiency Edgeworthia chrysantha technology, such as utilizes gene editing technology Suspension culture of Aquilaria sinensis genome is edited, by knocking out AsWRKY44 transcription factor, obtaining transcription factor AsWRKY44 cannot be expressed Transgenic plant, then can obtain a kind of natural shape without injuring or injury signal induction can synthesize agalloch eaglewood sequiterpene The suspension culture of Aquilaria sinensis plant of agalloch eaglewood can be synthesized under state.

Sequence table

<110>China Medical Sciences Academy Medical Plants Institute

<120>suspension culture of Aquilaria sinensis AsWRKY44 transcription factor and its application

<160> 2

<170> SIPOSequenceListing 1.0

<210> 1

<211> 542

<212> PRT

<213>artificial sequence (Artificial Sequence)

<400> 1

Met Ala Ser Ser Tyr Ser Ser Leu Asp Thr Ser Gly Asn Ser His Pro

1 5 10 15

Gln Ser Pro Phe Ser Phe Ser Ala His Pro Phe Met Asn Thr Ser Phe

20 25 30

Ser Asp Leu Leu Ala Ala Gly Asp Asp Asp Ser Ser Ala Ala Lys Pro

35 40 45

Ala Phe Arg Ser Ser Ser Arg Leu Ser Asp Arg Ile Ala Glu Arg Thr

50 55 60

Gly Ser Gly Val Pro Lys Phe Lys Ser Leu Pro Pro Pro Ser Leu Pro

65 70 75 80

Leu Ser Pro Pro Ser Val Ser Pro Ser Ser Tyr Phe Ala Ile Pro Pro

85 90 95

Gly Leu Ser Pro Ala Glu Leu Leu Asp Ser Pro Val Leu Leu Asn Ala

100 105 110

Gly Asn Ile Leu Pro Ser Pro Thr Thr Gly Ala Phe Pro Val Gln Ala

115 120 125

Phe Asn Trp Lys Gln Asn Ser Gly Asn Asp Gln Pro Asn Val Lys Gln

130 135 140

Glu Asp Lys Asn Phe Ser Asp Phe Ser Phe Gln Thr Ala Ser Ser Thr

145 150 155 160

Leu Phe Gln Ser Ser Thr Arg Gln Glu Gln Ala Trp His Val Gln Asp

165 170 175

Ser Thr Asn Gln Ser Lys Pro Glu Tyr Asp Gln Ile Gln Ser Gly Asn

180 185 190

Gly Phe Gln Ser Asp Tyr Ser Asn Tyr Ser Gln Gln Gln Gln Gln Ile

195 200 205

Arg Glu Asn Arg Arg Ser Asp Asp Gly Tyr Asn Trp Arg Lys Tyr Gly

210 215 220

Gln Lys Gln Val Lys Gly Ser Glu Asn Pro Arg Ser Tyr Tyr Lys Cys

225 230 235 240

Thr Phe Pro Ser Cys Pro Thr Lys Lys Lys Val Glu Arg Ser Leu Asp

245 250 255

Gly Gln Ile Thr Glu Ile Val Tyr Lys Gly Ser His Asn His Pro Lys

260 265 270

Pro Lys Ser Thr Arg Arg Ser Ser Ser Ser Ser Ser Thr Ser Ser Ala

275 280 285

Ser Ala Leu Val Pro Lys Ser Val Ala Val Val Ala Gly Asn Glu Thr

290 295 300

Pro Asp Arg Ser Leu Val Thr His Val Ser Gly Gln Met Asp Ser Val

305 310 315 320

Ala Thr Pro Glu Asn Ser Ser Ile Ser Asp Glu Leu Glu Gln Gly Ser

325 330 335

Gln Arg Thr Arg Ser Ala Gly Asp Glu Phe Asp Glu Asn Glu Pro Glu

340 345 350

Ala Lys Arg Leu Arg Leu Glu Ala Glu Asn Glu Gly Val Ile Ala Ala

355 360 365

Gly Ser Arg Thr Val Arg Glu Pro Arg Val Val Val Gln Thr Asn Ser

370 375 380

Asp Ile Asp Ile Leu Asp Asp Gly Tyr Arg Trp Arg Lys Tyr Gly Gln

385 390 395 400

Lys Val Val Lys Gly Asn Pro Asn Pro Arg Ser Tyr Tyr Lys Cys Thr

405 410 415

His Pro Gly Cys Pro Val Arg Lys His Val Glu Arg Ala Ser His Asp

420 425 430

Pro Arg Ala Val Ile Thr Thr Tyr Glu Gly Lys His Asn His Asp Val

435 440 445

Pro Ala Ala Arg Gly Ser Gly Asn His Ser Ala Asn Arg Pro Asn Asn

450 455 460

Asn Asn Asp Asn Asn Asn Gly Asp Asn Ala Gly Ala Leu Leu Lys Leu

465 470 475 480

Pro Pro Ser Thr Gln Ala Lys Ser Asn Pro Gly His Asn Leu Ser Ala

485 490 495

Met Glu Met Leu Gln Ser Pro Val Gly Phe Gly Phe Ser Met Ala Ser

500 505 510

Phe Met Glu Gln Ala Gln Gln Phe Ser Asn Ala Phe Ser Arg Thr Lys

515 520 525

Asp Glu Pro Arg Asp Asp Met Phe Leu Glu Ala Phe Leu Ser

530 535 540

<210> 2

<211> 1629

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 2

atggcctcct cttatagcag cttagacacc tccggcaact cccaccctca gtcccccttt 60

agcttctctg cccacccctt catgaacacc tccttctctg acctcctagc cgccggcgac 120

gacgatagtt ccgcggccaa gccagccttc cgcagcagca gccgcctctc cgatcgaata 180

gcagagagaa ctgggtcggg cgtgccgaag ttcaagtcgc ttcctcctcc ttccctccct 240

ctctctcctc cctctgtctc gccttcctct tacttcgcta tccctcctgg cctcagcccg 300

gctgagctcc tggattctcc tgttttgctc aacgccggca acattcttcc atcccccaca 360

acaggagctt ttccagttca ggcttttaac tggaagcaga attctggaaa tgatcagccg 420

aacgtcaagc aggaagacaa gaatttctcc gatttctctt ttcagacagc ttcgtcaact 480

ttgtttcaat cgtcaactag acaggaacaa gcttggcatg tccaggattc gacgaatcaa 540

tcgaaacccg agtacgatca gattcagagc ggcaacgggt tccaatcgga ttacagtaat 600

tacagccagc aacagcagca aattagagag aacagaagat cagacgacgg ctacaactgg 660

aggaagtacg ggcagaaaca ggttaaaggg agcgaaaacc caagaagtta ctacaagtgc 720

acgttcccaa gttgtcccac aaagaagaag gtcgagaggt ctttggatgg gcagataact 780

gagatcgttt acaagggcag ccataatcat cccaagccca agtccactag aagatcatcg 840

tcatcttcat caacttcttc tgcttctgct ttggtaccca aatcggttgc tgttgttgct 900

ggtaatgaaa ccccagatcg gtcattggtt acgcatgtaa gtgggcagat ggattcggtt 960

gctacgcctg aaaactcctc gatttcagat gagcttgagc agggttctca gaggaccaga 1020

tcagctggag atgagtttga tgaaaatgaa cctgaggcca agagattgag acttgaagca 1080

gaaaatgaag gtgtcatagc agctgggagc aggacggtaa gggaacctcg tgttgttgta 1140

caaacaaaca gtgacataga tattctggat gatggatata gatggaggaa gtatgggcag 1200

aaagtagtca aaggcaaccc caatccaagg agctactaca aatgcacaca tccgggatgt 1260

ccggtgagga agcatgtgga gcgagcctct catgatccaa gggcggtgat taccacctac 1320

gaaggcaagc acaaccacga tgtccccgca gctcgtggca gtggcaacca ttctgccaac 1380

cgacctaaca acaacaatga caacaataac ggcgacaatg ctggtgcatt gttgaaattg 1440

cccccatcca ctcaggccaa gagtaaccca ggtcacaatt taagtgcaat ggagatgctg 1500

cagagcccag taggatttgg gttttcgatg gcgtctttca tggaacaagc gcagcagttc 1560

agcaatgcgt tttcgaggac caaggatgag ccaagggatg acatgttcct tgaggcattc 1620

ttgagttga 1629

Claims (10)

1. a kind of albumen is transcription factor AsWRKY44:

I) there is the amino acid sequence as shown in SEQ ID NO.1；

Ii) amino acid sequence shown in SEQ ID NO.1 is passed through to the substitution and/or replacement of one or several amino acid residues And/or addition and the protein with the same function as derived from SEQ ID NO.1；

It the substitution of said one or several amino acid residues and/or missing or/or is added to no more than 10 amino acid residues Replace and/or lacks or/or add.

2. encoding the cDNA molecule of albumen described in claim 1.

3. cDNA molecule as claimed in claim 2, which is characterized in that it has such as nucleotides sequence any in i)-ii) Column:

I) there is the nucleotide sequence as shown in SEQ ID NO.2；

Ii) under strict conditions with 1) shown in DNA molecular hybridize and the nucleotide sequence of encoding said proteins；

Iii) and i) or ii) gene with 90% or more homology and the nucleotide sequence of encoding said proteins.

4. containing the recombinant expression carrier of cDNA molecule, expression cassette, recombinant bacterium described in Claims 2 or 3；

Or, amplification or editors' rights require the 2 or 3 DNA molecular overall lengths or the primer pair of its any segment.

5. recombinant expression carrier described in DNA molecular described in albumen, Claims 2 or 3 described in claim 1 or claim 4, table Up to the application of box or recombinant bacterium in regulation plant tissue in Gene Transcription in vitro.

6. recombinant expression carrier described in DNA molecular described in albumen, Claims 2 or 3 described in claim 1 or claim 4, table Up to the application of box or recombinant bacterium in regulation plant in sesquiterpene synthase gene expression.

7. application as claimed in claim 6, which is characterized in that the regulation be based on transcription factor AsWRKY44 by with it is white W-box in the promoter of radix aucklandiae sesquiterpene synthase ASS1 is combined, and inhibits the transcription table of sesquiterpene synthase gene under normal condition It reaches；Under injury and injury signal induction, AsWRKY44 degradation, inhibiting effect is released, sesquiterpene synthase gene promoter transcriptional expression.

8. recombinant expression carrier described in DNA molecular described in albumen, Claims 2 or 3 described in claim 1 or claim 4, table Up to the application of box or recombinant bacterium in regulation Secondary Metabolism of Plant.

9. recombinant expression carrier described in DNA molecular described in albumen, Claims 2 or 3 described in claim 1 or claim 4, table Up to the application of box or recombinant bacterium in regulation plant resistance to environment stress.

10. recombinant expression carrier described in DNA molecular described in albumen, Claims 2 or 3 described in claim 1 or claim 4, The application of expression cassette or recombinant bacterium in prepare transgenosis plant.