CN109879946B - Aquilaria sinensis AsWRKY44 transcription factor and application thereof - Google Patents

Abstract

The invention discloses an aquilaria sinensis AsWRKY44 transcription factor and application thereof, relates to the field of genetic engineering, and particularly relates to an aquilaria sinensis AsWRKY44 transcription factor related to agilawood formation and application thereof. The transcription factor is combined with W-box on a promoter of aquilaria sinensis sesquiterpene synthase ASS1, transcription expression of sesquiterpene synthase genes is inhibited under a normal state, AsWRKY44 is degraded under the induction of injury and injury signals, inhibition is relieved, the sesquiterpene synthase genes start transcription expression, and agilawood sesquiterpene is synthesized, so that agilawood is formed.

Description

Aquilaria sinensis AsWRKY44 transcription factor and application thereof

Technical Field

The invention relates to the field of genetic engineering, in particular to an aquilaria sinensis AsWRKY44 transcription factor and application thereof.

Background

Aquilaria sinensis (Aquilaria sinensis) belongs to Aquilaria sinensis, is a unique plant source for producing rare or endangered plant in China. The Chinese eaglewood has been used in traditional Chinese medicine, Tibetan medicine and Indian traditional medicine for thousands of years. Hong Kong was also named for its historical abundance and export of eaglewood. However, healthy Aquilaria sinensis tree does not produce Aquilaria sinensis, and only produces incense when damaged (Ng, 1997; Itoh, et al., 2002; Pojanagaroon and Kaewrak, 2005; Personon, 2008). Studies have shown that sesquiterpenes are the most important component of Chinese eaglewood herbs and the essential oil thereof (Hashimoto et al, 1985; Chen et al, 2011, Chen et al, 2012). The agilawood sesquiterpene is almost absent in the healthy aquilaria sinensis trees and is synthesized by starting corresponding metabolic pathways after the trees are induced by damage, so that agilawood cannot be obtained on the normal healthy aquilaria sinensis trees.

Sesquiterpene synthase ASS is a key enzyme in the sesquiterpene biosynthetic pathway that catalyzes the synthesis of sesquiterpenes by FPP. In the early period, we cloned a key sesquiterpene synthase gene ASS1 from aquilaria sinensis, the purified protein of the gene can catalyze and synthesize three agilawood sesquiterpene components of delta-guaifene (delta-guaifene), alpha-guaifene (alpha-guaifene) and beta-elemene (beta-elemene) by taking FPP as a substrate in vitro, the gene is hardly expressed in healthy trees and calli, but the expression of the gene can be obviously improved by MeJA treatment (Xu et al, 2013). Therefore, the sesquiterpene synthase gene ASS1 is a typical inducible expression gene and has important regulation at the transcription level, however, no report has been made on the transcription regulation mechanism of the agilawood sesquiterpene synthase gene.

Transcriptional regulation is accomplished by the interaction of a promoter, a transcription factor bound to the promoter, and RNA polymerase II, which controls the initiation, activation, or inhibition of gene transcription. Transcription factors are classified into transcription activators and transcription repressors according to their regulatory functions. Currently, many studies on the forward regulation of transcription activators in plants, for example, the "molecular mechanism research of jasmonic acid signal pathway involved in regulating biosynthesis of agilawood sesquiterpene" published by Yongyun, doctor paper finds MYC2 positive regulator gene possibly combined with G-BOX of sesquiterpene and enzyme gene ASS1 promoter and JAZ gene interacting with MYC2 positive regulator, and researches on transcription inhibition are relatively weak, but transcription inhibition plays an important role in regulating plant survival and growth.

Therefore, it is also very important to provide an inhibitor capable of inducing the core molecular mechanism of agilawood formation.

Disclosure of Invention

In order to realize regulation of a secondary metabolite of an aquilaria sinensis tree body plant and regulation of resistance of the secondary metabolite of the aquilaria sinensis tree body plant in many aspects, the invention provides an aquilaria sinensis transcription factor AsWRKY44 gene and a coding protein of the aquilaria sinensis transcription factor AsWRKY44 gene, the transcription factor AsWRKY44 provided by the invention is combined with a W-box on a promoter of an aquilaria sinensis sesquiterpene synthase ASS1 to be used as a regulation switch, and the inhibition transcription expression or the initiation transcription expression of a sesquiterpene synthase gene is controlled under different states to realize regulation of agilawood sesquiterpene synthesis.

In order to achieve the technical purpose of the invention, the invention provides a transcription factor AsWRKY44, which is derived from Aquilaria sinensis (Aquilaria sinensis) of Aquilaria of Thymelaeaceae, and comprises the following components:

1) has an amino acid sequence shown as SEQ ID NO. 1.

2) And (b) a protein derived from the amino acid sequence shown in the SEQ ID NO.1, which is obtained by substituting and/or replacing and/or adding one or more amino acid residues in the amino acid sequence shown in the SEQ ID NO.1 and has the same function.

The substitution and/or deletion or/and addition of one or more amino acid residues is the substitution and/or deletion or/and addition of no more than 10 amino acid residues.

Wherein the amino acid sequence shown in SEQ ID NO.1 consists of 542 amino acid residues.

cDNA molecules encoding the above proteins are also within the scope of the present invention.

The cDNA molecule is any one of the cDNA molecules shown in i) -iii);

i) has a nucleotide sequence shown as SEQ ID NO. 2;

ii) a nucleotide sequence which can interact with the DNA molecule shown in 1) by hybridization under strict conditions;

iii) a nucleotide sequence which has more than 90% homology with the gene of i) or ii) and encodes the protein.

The transcription factor AsWRKY44 can be obtained by artificial synthesis according to the amino acid sequence or by synthesizing the coding gene according to the nucleotide sequence and then carrying out biological expression.

To achieve the technical purpose of the invention, the invention also provides an expression cassette for encoding a transcription factor AsWRKY 44.

To achieve the technical purpose of the invention, the invention also provides a recombinant expression vector encoding the transcription factor AsWRKY 44.

Wherein the recombinant expression vector is obtained by inserting a coding gene between multiple cloning sites of a pET-28a vector.

The primer pair for amplifying the full length of any one of the coding genes or any fragment thereof also belongs to the protection scope of the invention.

Primer pairs for editing the full length of any one of the coding genes or any fragment thereof also belong to the protection scope of the invention.

To achieve the technical purpose of the invention, the invention also provides a transgenic cell line encoding the transcription factor AsWRKY 44.

In order to realize the technical purpose of the invention, the invention also provides a recombinant bacterium for coding a transcription factor AsWRKY 44.

The use of the above-mentioned proteins, the above-mentioned cDNA analysis or the above-mentioned expression cassettes, recombinant expression vectors, transgenic cell lines or recombinant bacteria for regulating the gene transcription activity in plant tissues is also within the scope of the present invention.

Wherein the plant is aquilaria sinensis.

Wherein the modulation is inhibition.

Wherein the regulation is the inhibition of the expression of the sesquiterpene synthase gene ASS1 in a healthy state.

The application of the protein, the cDNA molecule or the recombinant vector, the expression cassette, the transgenic cell line or the recombinant bacterium in the regulation and control of sesquiterpene synthase gene expression in plants is also within the protection scope of the invention.

The application of the protein, the cDNA molecule or the recombinant vector, the expression cassette, the transgenic cell line or the recombinant bacterium in regulating and controlling the secondary metabolism and resistance of plants is also within the protection scope of the invention.

The application of the protein, the cDNA molecule or the recombinant vector, the expression cassette, the transgenic cell line or the recombinant bacterium in regulating and controlling the synthesis of the agilawood is also within the protection scope of the invention.

Wherein the plant is radix Inulae.

Wherein the secondary metabolism is agilawood sesquiterpene.

Wherein, the resistance refers to the capability of resisting external injury.

The application of the protein, the cDNA molecule or the recombinant vector, the expression cassette, the transgenic cell line or the recombinant bacterium in preparing transgenic plants is also within the protection scope of the invention.

Wherein, the transgenic plant can directly synthesize aquilaria sinensis.

Wherein the transgenic plant can be prepared by using a gene editing technology. The transgenic plant can be prepared by knocking out a transcription factor AsWRKY44 from an aquilaria sinensis genome.

Has the advantages that:

the AsWRKY44 transcription factor provided by the invention can be combined with a key regulation section W-box of an ASS1 promoter, so that aquilaria sinensis can inhibit the normal transcription of a target gene sesquiterpene synthase gene in a healthy state, and the AsWRKY44 protein is gradually degraded under a harmful condition or induced by a harmful signal, thereby relieving the inhibition effect of the aquilaria sinensis on the target gene sesquiterpene synthase gene, expressing the target gene sesquiterpene synthase gene ASS1, starting the synthesis of an aquilaria sinensis sesquiterpene substance, finally forming a rare Chinese medicinal material aquilaria sinensis, realizing the regulation of secondary metabolites and resistance of the aquilaria sinensis, and providing a practical method for the field of aquilaria sinensis production.

Drawings

FIG. 1 shows the nuclear localization of the AsWRKY44 gene in Arabidopsis protoplasts;

FIG. 2 shows the expression result of whole bacterial protein of pET-28a-AsWRKY44 transformed into E.coli BL21(DE 3);

FIG. 3 shows the result of polyacrylamide gel electrophoresis of the purified AsWRKY44 protein;

FIG. 4 shows the result of chromatin co-immunoprecipitation by interaction of AsWRKY44 with ASS 1;

FIG. 5 is a bar graph of chromatin co-immunoprecipitation results of AsWRKY44 interacting with ASS 1;

FIG. 6 shows the results of detection of protein levels of AsWRKY44 at different points under MeJA treatment;

FIG. 7 shows real-time PCR detection results of the transcription levels of ASS1 genes at different points in MeJA treatment.

Detailed Description

The experimental procedures used in the following examples are all conventional procedures unless otherwise specified. The materials, reagents and the like used in the following examples are commercially available unless otherwise specified, and the structures used in the following examples are conventional unless otherwise specified, and it will be understood by those skilled in the art that the following descriptions are specifically intended to be illustrative and not limiting, and should not be construed as limiting the scope of the present invention.

Example 1 acquisition of AsWRKY44 Gene

A positive clone is screened by using an ASS1 promoter as a bait through conventional yeast single hybridization, and an AsWRKY44 sequence is aligned in an aquilaria sinensis genome through sequencing and alignment. Total RNA is extracted from the aquilaria sinensis callus and is reversely transcribed into cDNA. Carrying out PCR amplification by taking cDNA as a template and F1 and R1 as primers to obtain an amplification product of the AsWRKY44 gene full length, wherein the primers F1 and R1 are as follows:

F1:ATGGCCTCCTCTTATAGCAGCTT；

R1:TCAACTCAAGAATGCCTCAAGGAAC。

and (4) performing gel purification and recovery on the PCR product obtained by amplification, and then sequencing. The sequencing result shows that the total length of the PCR amplification product sequence is 1629bp, the nucleotide sequence of the PCR amplification product sequence is shown as SEQ ID NO.2, and the PCR amplification product sequence can encode protein with the amino acid residue sequence shown as SEQ ID NO.1, wherein the SEQ ID NO.1 consists of 321 amino acid residues. The gene is named as AsWRKY44 gene, and the protein coded by the gene is named as AsWRKY44 protein.

Example 2 positional analysis of AsWRKY44 Gene

1. Nuclear localization of AsWRKY44 gene in Arabidopsis protoplasts

Healthy and non-bolting Arabidopsis leaves growing under 12h light/12 h dark light for 3-4 weeks were selected, cut into thin strips of about 1mm width perpendicular to the main veins with a razor blade, and placed in mannitol solution. Transferring the thin strips from the mannitol solution into the enzymolysis solution, keeping out of the sun, slowly shaking at 23 ℃ and 50rpm, and carrying out enzymolysis for 3 h. Filtering the enzymolysis solution with 200 mesh sieve. Collecting the filtrate, centrifuging at 4 deg.C for 1min at 100g, discarding the supernatant, and collecting protoplast for use. Protoplasts were gently suspended in an equal volume of pre-cooled W5 buffer and centrifuged at 100g for 1min at 4 ℃. The supernatant was discarded, and the protoplasts were gently suspended in 1/2 volume of precooled W5 and allowed to stand on ice for 30 min. Centrifuge at 100g for 1min at 4 ℃ and discard the supernatant and resuspend it in the appropriate amount of MMg buffer (200. mu.l MMg for each sample). The following operations were all carried out at 23 ℃. Mu.g plasmid was added to 200. mu.l of the MMg resuspended protoplasts, and 220. mu.l of PEG/Ca2+ solution was added and gently mixed with a tip-cut tip. Standing at 23 deg.C in dark for 30 min. 880. mu. l W5 buffer was added, mixed by gentle inversion and centrifuged at 100g for 1 min. The supernatant was discarded, 100. mu. l W5 buffer was added to suspend it, and 100g was centrifuged for 1min and repeated once. The supernatant was discarded, 1ml of W5 buffer was added, and the mixture was gently inverted and mixed. Placing in a cell culture plate, and culturing at 23 deg.C in dark for 12-16 h. The fluorescent material was observed under a Zeiss LSM 510META laser confocal microscope. When GFP fluorescence and chloroplast autofluorescence are observed at the same time, 488nm Argon-ion laser is used for excitation, 545nm spectroscope is used for filtration, GFP fluorescence signals are detected by 505-530nm, chloroplast autofluorescence is detected by 560nm, and the detection result is shown in figure 1, so that the nucleus of the AsWRKY44 gene in the arabidopsis protoplast is clearly positioned.

EXAMPLE 3 construction of prokaryotic expression vectors

According to the invention, a specific primer is designed according to an AsWRKY44CDS full-length sequence, AsWRKY44 is amplified by taking aquilaria sinensis single-stranded cDNA as a template, pET-28a-AsWRKY44 recombinant plasmid is constructed, and the obtained pET-28a-AsWRKY44 prokaryotic expression vector is determined to be correct through Hind III and XhoI double enzyme digestion verification and sequencing verification.

Designing a specific primer according to the full-length sequence of the AsWRKY44CDS, wherein F2: ATGGCCTCCTCTTATAGCAGCTT, R2: ACTCAAGAATGCCTCAAGGAACA, respectively; and adding BamH1 enzyme cutting sites at upstream: -

cccGGATCCATGGCCTCCTCTTATAGCAGCTT-, adding XhoI enzyme cutting site at the downstream: -

ccgCTCGAGACTCAAGAATGCCTCAAGGAACA-。

Using the single-stranded cDNA of Aquilaria sinensis obtained in example 1 as a template, the amplification was performed with Premix PrimeStar HS (TAKARA, Japan) to obtain a final system of 50 ul; the amplification procedure was: pre-denaturation at 94 ℃ for 5 min; then, carrying out 34 cycles of 94 ℃ for 30s, 59 ℃ for 30s and 72 ℃ for 2 min; finally, extension is carried out for 10min at 72 ℃. The amplification product was recovered with a gel recovery kit (Tiangen, China), ligated to a Blunt Simple T vector (all-purpose gold, China), and transformed E.coli Trans1-T1 competence (all-purpose gold, China) was sequenced by Beijing Sanbo Polygala Biotech Co., Ltd. The Blunt Simple-AsWRKY44 recombinant plasmid and pET-28a vector plasmid which are correctly sequenced are subjected to double enzyme digestion by Hind III and XhoI respectively, after enzyme digestion fragments are recovered, T4 ligase (NEB, UK) is used for connecting at 16 ℃ overnight, a connecting product is transformed into E.coli Dh5 alpha competent cells (heaven root and China), and then the E.coli Dh5 alpha competent cells are uniformly coated on an LB solid culture medium containing 50 ng/. mu.l Kan and subjected to inversion culture at 37 ℃ for 12-16 h. Sequencing and identifying the positive clone pET-28a-AsWRKY44 plasmid through bacterial liquid PCR and enzyme digestion identification. Sequencing results show that the pET-28a-AsWRKY44 plasmid is a vector obtained by inserting the gene SEQ ID NO.2AsWRKY44 in a sequence table into Hind III and XhoI double enzyme cutting sites of a pET-28a expression vector, and successfully expresses in E.coli BL21(DE3) competence.

Example 4 construction of recombinant bacteria

The E.coli BL21(DE3) positive clone containing the recombinant plasmid is cultured, pET-28a-AsWRKY44 fusion protein expression is induced and purified to obtain the target protein, and the bacterium with the target protein is a recombinant bacterium.

E.coli BL21(DE3) positive clone containing recombinant plasmid was shake-cultured overnight, the bacterial liquid was diluted to 50 ng/. mu.l Kan in a ratio of 1:100, and cultured at 37 ℃ to OD₆₀₀When the concentration is about 0.4 to 0.6, IPTG is added to a final concentration of 0.5 mmol.L^-1Culturing for 4h and 6h, centrifuging, collecting thallus, resuspending with 1 × PBS (pH 7.4), boiling in boiling water for 5min to denature protein, and detecting by 10% SDS-PAGE electrophoresis. The analysis result is shown in FIG. 2, in which Lane M is 97.2KD protein molecular weight standard, Lane 1 is pET-28a no-load induced, Lane 2 is pET-28a no-load induced, Lane 3 is pET-28a-AsWRKY44 no-induced, Lane 4 is pET-28a-AsWRKY44 induced 4h, Lane 5 is pET-28a-AsWRKY44 no-induced, Lane 6 is pET-28a-AsWRKY44 induced 6h, the large amount of induced protein is purified by Ni column, as shown in FIG. 3, purified to a single band of 59KD in sizeIf the molecular weight of the protein is consistent with the predicted molecular weight of the protein, the band is indicated as the correctly expressed target protein, and therefore, the bacteria with the target protein are determined to be recombinant bacteria. In the figure, lane M is 97.2KD protein molecular weight standard, lane 1 is eluent, and lanes 2-8 are protein elution tubes 1-7 respectively.

Functional verification of AsWRKY44

First, chromatin co-immunoprecipitation experiment of interaction between AsWRKY44 and ASS1

1. Extraction of chromatin

1.5g of young, tender, Aquilaria sinensis leaves were cross-linked in formaldehyde for 20 minutes in a vacuum tank, and then 2.5mL of 2M glycine was added to terminate the cross-linking. Pouring the cross-linked material on gauze, washing with tap water, and then using ddH₂O washing, then transferring the material to absorbent paper to suck the water dry, liquid nitrogen quick freezing and then fully grinding the cross-linked material, using pre-cooled 25ml of nucleic isolation buffer to re-suspend the ground material, and placing on ice until it is completely dissolved. Filtering with 200 mesh sieve, and centrifuging at 4 deg.C and 12000rpm for 20 min; discarding the supernatant, and resuspending the pellet with pre-cooled 2ml of nucleic lysine buffer; the resuspension was aliquoted into 1.5ml centrifuge tubes per 500. mu.l aliquot on ice. Carrying out ultrasonic disruption on ice for 10 times of ultrasonic treatment at the power of 200W for 5s and 10s, and obtaining the DNA fragment of 250-1000 bp. Centrifuging at 12000rpm at 4 deg.C for 10min, collecting supernatant, adding protease inhibitor, and packaging each sample into 3 tubes: 50 μ l input (stored at 4 ℃ C. for future use as a positive control and to determine whether ultrasound is appropriate), 100 μ l sample.

2. Co-immunoprecipitation

To 3 100. mu.l samples, 900. mu.l of each of the nucleic lysine buffers was added, and 50. mu.l of Protain A was added and the pre-clearing was carried out by slow inversion at 4 ℃ for 1 h. The supernatant was transferred to a new tube by centrifugation at 4000rpm for 2min at 4 ℃. Mu.l of the corresponding antibody (1-3. mu.g) was added and the preimmune serum was used as a control and incubated overnight at 4 ℃ with inversion. Mu.l of Protein A was added and incubated at 4 ℃ for 2 h. The beads were pelleted completely by centrifugation at 4000rpm for 2min at 4 ℃ and the supernatant was discarded. Washing at 4 ℃. Centrifuging at 4000rpm for 2min at 4 ℃, discarding the supernatant, adding 250 μ l of freshly prepared precipitation buffer to each tube, reversing the temperature for 30min, centrifuging at 4000rpm for 2min, allowing Protein A to precipitate, and taking the supernatant. Mu.l of the nucleic acids buffer was added to 50. mu.l of the previously stored input.

3. De-crosslinking and digesting proteins

The three tubes are performed simultaneously. 20 μ l of 5M NaCl was added and incubated at 65 ℃ for 4-6h or overnight. After incubation, the cells were briefly centrifuged and 20. mu.l of 0.25M EDTA, 20. mu.l of 1M Tris-HCl (pH 8.0), 2. mu.l of 20mg/ml protease K were added to each tube and incubated at 45 ℃ for 1.5 h.

4. Precipitation of DNA

275. mu.l phenol, 264. mu.l chloroform, and 11. mu.l isoamyl alcohol were added to the sample, and after shaking and mixing, the mixture was centrifuged at 12000rpm at 4 ℃ for 5 min. Approximately 500. mu.l of the supernatant was transferred to a new tube, 2.5 volumes of 100% ethanol, 1/10. mu.l volumes of 3M sodium acetate pH 5.2 and 4. mu.l of 20mg/ml glycogen were added, and after thorough mixing, the tube was left at-20 ℃ for at least 1 h. Centrifugation was carried out at 12000rpm for 15min at 4 ℃ to remove the supernatant, and 500. mu.l of 70% ethanol was added to the precipitate. Centrifugation was carried out at 12000rpm at 4 ℃ for 5min, the supernatant was carefully removed, and the precipitate was dried at room temperature to completely remove ethanol. DNA was dissolved by adding 50. mu.l of ddH 2O.

5. PCR detection

Using the obtained DNA (input, sample and negative control) as template, primers were primers at both ends of the critical region (242bp) on the ASS1 promoter: 5'-CTCATGTTTTTCAAGGATGCTGTC-3' and 5'-AACTTTGCCACTTGCCATTCG-3', carrying out PCR and real-time quantitative PCR reaction, carrying out electrophoresis detection on reaction products, wherein the detection result is shown in figure 4, a Lane ck is DNA obtained from serum before immunization and is used as a template, and an amplified PCR product; lane Input is the PCR product amplified with genomic DNA as template; the Lane AsWRKY44 is DNA obtained by precipitation of an AsWRKY44 antibody and is used as a template, an amplified PCR product is shown in the figure, the Lane AsWRKY44 is bright and 242bp in size, which shows that the antibody of AsWRKY44 can be precipitated to a 242bp DNA fragment of an ASS1 promoter, and the in vivo combination of the AsWRKY44 and the 242bp fragment of the key segment of the ASS1 promoter is proved.

FIG. 5 is a graph showing relative values according to the results of quantitative fluorescence PCR. The internal reference of the fluorescent quantitative PCR is aquilaria sinensis GADPH gene, and the primers are a DNA sequence (a control group) without W-box on a promoter and a DNA fragment containing W-box respectively. The amplification primers are respectively:

w-box-containing DNA fragment: FI forward 5'-CTCATGTTTTTCAAGGATGCTGTC-3', reverse 5'-CGAATGGCAAGTGGCAAAG-3'); FII forward 5'-GATGCGTATTTGTTCTTTCTTTTCG-3', reverse 5'-TTGAATGGTATGAGAACCCGAAG-3', FIII forward 5'-ACAGCCCACGTGGTCATACAAG-3', reverse 5'-CAAGTTTGCTGTTTTGAGCGATG-3', FIV forward 5'-AGCGCTTGCAGTCAACAGAT-3', reverse 5'-CAAGTTTGCTGTTTTGAGCGATG-3', FV forward 5'-ACAAAAGGTTTCTGGAAGATAATGG-3', reverse 5'-CAAGTTTGCTGTTTT GAGCGATG-3';

DNA fragment without W-box: (forward: 5'-CTTCGGGTTCTCA TACCATTCAA-3'; reverse: 5'-TATGAACGACAAGTCTGGGCAA-3'); the internal reference GADPH primer is as follows: forward 5'-CTGGTATGGCATTCCGTGTA-3' and reverse 5'-AACCACATCCTCTTCGGTGTA-3'.

Each set of data is the average of three independent biological replicates. The results showed that AsWRKY44 had the highest binding activity to the first segment on the ASS1 promoter, and that the other segments, although containing the W-box core recognition sequence, did not bind to the same extent as the negative control (FVI) without the W-box recognition sequence, indicating that AsWRKY44 binds to the W-box of the first segment on the ASS1 promoter.

Functional verification of AsWRKY44 gene as transcription repressor

According to the invention, healthy aquilaria sinensis callus which normally grows is treated by MeJA, the protein level and the ASS1 gene transcription level of the AsWRKY44 of the aquilaria sinensis callus under the condition of an injury signal MeJA are observed, and the AsWRKY44 gene is verified to be a transcription repressor and a regulation mechanism thereof.

1. Detection of AsWRKY44 protein level under MeJA treatment

Transferring the healthy aquilaria sinensis callus which normally grows to MS culture containing 100uM MeJA to continue growing, sampling at 0h,6h,12h, 24h,36h,48h, 4d and 7d respectively, extracting total protein, carrying out SDS-PAGE electrophoresis on the total protein according to a Western blotting method, washing the membrane for 3 times with 300mA constant current for 1h to a PVDF membrane, washing the membrane for 10min each time, sealing with 5% skimmed milk for 4h, diluting with an anti-HIS-tagged mouse monoclonal antibody (all-type gold, China) for 2000 times, and incubating and shaking at 4 ℃ for overnight; the following day, membranes were washed 3 times with 1x TBST for 10min each, incubated with rabbit anti-mouse IgG antibody (1:5000) for 1h, washed 3 times with 1x TBST for 10min each, developed by ECL, imaged with a chemiluminescence imager (ImageQuantLAS 4000mini), and stored. The detection result is shown in fig. 6, and the detection result indicates that the protein level of AsWRKY44 is gradually reduced after MeJA treatment, the 48h band is obviously weakened, and the complete degradation is indicated when no band is detected at 4d and 7 d.

2. Real-time PCR detection of transcript levels of ASS1 genes at different points under MeJA treatment

Transferring the healthy aquilaria sinensis callus to MS culture containing 100uM MeJA for further growth, sampling at 0h,6h,12h, 24h,36h,48h, 4d and 7d respectively, extracting total RNA for reverse transcription to obtain a cDNA template, taking ASS1forward primer: 5'-AAGAAGATGAAGGAGATGATTGAGA-3' and reverse primer: 5'-TAGATACTCAAGCTATGCATCCAAC-3' as primers, taking GADPH as an internal reference, and taking the primers as follows: forward 5'-CTGGTATGGCATTCCGTGTA-3' and reverse 5'-AACCACATCCTCTTCGGTGTA-3', wherein the detection result is shown in FIG. 7, and shows that the transcription level of AsWRKY44 slightly rises for a short time (6-12h) after being treated by MeJA and is maintained at the initial level all the time; while expression of ASS1 was significantly elevated, almost undetectable from the beginning, with an increase of 100 times 2h, and continued up to 800 times, as shown in fig. 7. It can be seen that the mechanism of MeJA-induced expression of ASS1 gene is: AsWRKY44 is degraded under MeJA induction, the binding inhibition effect of AsWRKY44 and ASS1 is relieved, so that ASS1 is expressed, and the fact that AsWRKY44 is a transcription repressor of ASS1 is proved.

In conclusion, by applying a combined inhibition mechanism of transcription factors AsWRKY44 and ASS1, the resistance of an aquilaria sinensis plant to injury or injury signals can be adjusted, the synthesis of a secondary metabolite of the aquilaria sinensis plant can also be adjusted, and the transcription factors can also be used for the synthesis application of agilawood sesquiterpenes, so that a new theoretical method is provided for an aquilaria sinensis stable and efficient incense-forming technology, for example, an aquilaria sinensis genome is edited by using a gene editing technology, a transgenic plant which cannot be expressed by the transcription factors AsWRKY44 is obtained by knocking out the transcription factors AsWRKY44, sesquiterpene agilawood can be synthesized without induction of injury or injury signals, and the aquilaria sinensis plant capable of synthesizing agilawood in a natural state is.

Sequence listing

<110> institute of medicinal plants of academy of Chinese medical science

AsWRKY44 transcription factor of <120> aquilaria sinensis and application thereof

<160> 2

<170> SIPOSequenceListing 1.0

<210> 1

<211> 542

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 1

Met Ala Ser Ser Tyr Ser Ser Leu Asp Thr Ser Gly Asn Ser His Pro

1 5 10 15

Gln Ser Pro Phe Ser Phe Ser Ala His Pro Phe Met Asn Thr Ser Phe

20 25 30

Ser Asp Leu Leu Ala Ala Gly Asp Asp Asp Ser Ser Ala Ala Lys Pro

35 40 45

Ala Phe Arg Ser Ser Ser Arg Leu Ser Asp Arg Ile Ala Glu Arg Thr

50 55 60

Gly Ser Gly Val Pro Lys Phe Lys Ser Leu Pro Pro Pro Ser Leu Pro

65 70 75 80

Leu Ser Pro Pro Ser Val Ser Pro Ser Ser Tyr Phe Ala Ile Pro Pro

85 90 95

Gly Leu Ser Pro Ala Glu Leu Leu Asp Ser Pro Val Leu Leu Asn Ala

100 105 110

Gly Asn Ile Leu Pro Ser Pro Thr Thr Gly Ala Phe Pro Val Gln Ala

115 120 125

Phe Asn Trp Lys Gln Asn Ser Gly Asn Asp Gln Pro Asn Val Lys Gln

130 135 140

Glu Asp Lys Asn Phe Ser Asp Phe Ser Phe Gln Thr Ala Ser Ser Thr

145 150 155 160

Leu Phe Gln Ser Ser Thr Arg Gln Glu Gln Ala Trp His Val Gln Asp

165 170 175

Ser Thr Asn Gln Ser Lys Pro Glu Tyr Asp Gln Ile Gln Ser Gly Asn

180 185 190

Gly Phe Gln Ser Asp Tyr Ser Asn Tyr Ser Gln Gln Gln Gln Gln Ile

195 200 205

Arg Glu Asn Arg Arg Ser Asp Asp Gly Tyr Asn Trp Arg Lys Tyr Gly

210 215 220

Gln Lys Gln Val Lys Gly Ser Glu Asn Pro Arg Ser Tyr Tyr Lys Cys

225 230 235 240

Thr Phe Pro Ser Cys Pro Thr Lys Lys Lys Val Glu Arg Ser Leu Asp

245 250 255

Gly Gln Ile Thr Glu Ile Val Tyr Lys Gly Ser His Asn His Pro Lys

260 265 270

Pro Lys Ser Thr Arg Arg Ser Ser Ser Ser Ser Ser Thr Ser Ser Ala

275 280 285

Ser Ala Leu Val Pro Lys Ser Val Ala Val Val Ala Gly Asn Glu Thr

290 295 300

Pro Asp Arg Ser Leu Val Thr His Val Ser Gly Gln Met Asp Ser Val

305 310 315 320

Ala Thr Pro Glu Asn Ser Ser Ile Ser Asp Glu Leu Glu Gln Gly Ser

325 330 335

Gln Arg Thr Arg Ser Ala Gly Asp Glu Phe Asp Glu Asn Glu Pro Glu

340 345 350

Ala Lys Arg Leu Arg Leu Glu Ala Glu Asn Glu Gly Val Ile Ala Ala

355 360 365

Gly Ser Arg Thr Val Arg Glu Pro Arg Val Val Val Gln Thr Asn Ser

370 375 380

Asp Ile Asp Ile Leu Asp Asp Gly Tyr Arg Trp Arg Lys Tyr Gly Gln

385 390 395 400

Lys Val Val Lys Gly Asn Pro Asn Pro Arg Ser Tyr Tyr Lys Cys Thr

405 410 415

His Pro Gly Cys Pro Val Arg Lys His Val Glu Arg Ala Ser His Asp

420 425 430

Pro Arg Ala Val Ile Thr Thr Tyr Glu Gly Lys His Asn His Asp Val

435 440 445

Pro Ala Ala Arg Gly Ser Gly Asn His Ser Ala Asn Arg Pro Asn Asn

450 455 460

Asn Asn Asp Asn Asn Asn Gly Asp Asn Ala Gly Ala Leu Leu Lys Leu

465 470 475 480

Pro Pro Ser Thr Gln Ala Lys Ser Asn Pro Gly His Asn Leu Ser Ala

485 490 495

Met Glu Met Leu Gln Ser Pro Val Gly Phe Gly Phe Ser Met Ala Ser

500 505 510

Phe Met Glu Gln Ala Gln Gln Phe Ser Asn Ala Phe Ser Arg Thr Lys

515 520 525

Asp Glu Pro Arg Asp Asp Met Phe Leu Glu Ala Phe Leu Ser

530 535 540

<210> 2

<211> 1629

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

atggcctcct cttatagcag cttagacacc tccggcaact cccaccctca gtcccccttt 60

agcttctctg cccacccctt catgaacacc tccttctctg acctcctagc cgccggcgac 120

gacgatagtt ccgcggccaa gccagccttc cgcagcagca gccgcctctc cgatcgaata 180

gcagagagaa ctgggtcggg cgtgccgaag ttcaagtcgc ttcctcctcc ttccctccct 240

ctctctcctc cctctgtctc gccttcctct tacttcgcta tccctcctgg cctcagcccg 300

gctgagctcc tggattctcc tgttttgctc aacgccggca acattcttcc atcccccaca 360

acaggagctt ttccagttca ggcttttaac tggaagcaga attctggaaa tgatcagccg 420

aacgtcaagc aggaagacaa gaatttctcc gatttctctt ttcagacagc ttcgtcaact 480

ttgtttcaat cgtcaactag acaggaacaa gcttggcatg tccaggattc gacgaatcaa 540

tcgaaacccg agtacgatca gattcagagc ggcaacgggt tccaatcgga ttacagtaat 600

tacagccagc aacagcagca aattagagag aacagaagat cagacgacgg ctacaactgg 660

aggaagtacg ggcagaaaca ggttaaaggg agcgaaaacc caagaagtta ctacaagtgc 720

acgttcccaa gttgtcccac aaagaagaag gtcgagaggt ctttggatgg gcagataact 780

gagatcgttt acaagggcag ccataatcat cccaagccca agtccactag aagatcatcg 840

tcatcttcat caacttcttc tgcttctgct ttggtaccca aatcggttgc tgttgttgct 900

ggtaatgaaa ccccagatcg gtcattggtt acgcatgtaa gtgggcagat ggattcggtt 960

gctacgcctg aaaactcctc gatttcagat gagcttgagc agggttctca gaggaccaga 1020

tcagctggag atgagtttga tgaaaatgaa cctgaggcca agagattgag acttgaagca 1080

gaaaatgaag gtgtcatagc agctgggagc aggacggtaa gggaacctcg tgttgttgta 1140

caaacaaaca gtgacataga tattctggat gatggatata gatggaggaa gtatgggcag 1200

aaagtagtca aaggcaaccc caatccaagg agctactaca aatgcacaca tccgggatgt 1260

ccggtgagga agcatgtgga gcgagcctct catgatccaa gggcggtgat taccacctac 1320

gaaggcaagc acaaccacga tgtccccgca gctcgtggca gtggcaacca ttctgccaac 1380

cgacctaaca acaacaatga caacaataac ggcgacaatg ctggtgcatt gttgaaattg 1440

cccccatcca ctcaggccaa gagtaaccca ggtcacaatt taagtgcaat ggagatgctg 1500

cagagcccag taggatttgg gttttcgatg gcgtctttca tggaacaagc gcagcagttc 1560

agcaatgcgt tttcgaggac caaggatgag ccaagggatg acatgttcct tgaggcattc 1620

ttgagttga 1629

Claims (10)

1. A protein is a transcription factor AsWRKY44, which has an amino acid sequence shown as SEQ ID No. 1.

2. A cDNA molecule encoding the protein of claim 1.

3. cDNA molecule according to claim 2, characterized in that it has the nucleotide sequence as defined in any one of i) -ii):

i) has a nucleotide sequence shown as SEQ ID NO. 2;

ii) a nucleotide sequence which hybridizes with the DNA molecule shown in 1) and encodes the protein.

4. Recombinant expression vectors, recombinant bacteria comprising the cDNA molecule of claim 2 or 3;

or, amplifying or editing the pair of cDNA molecular primers of claim 2 or 3;

wherein the primer pair is as follows:

F1: ATGGCCTCCTCTTATAGCAGCTT；

R1: TCAACTCAAGAATGCCTCAAGGAAC。

5. use of the protein according to claim 1, the cDNA molecule according to claim 2 or 3, or the recombinant expression vector or recombinant bacterium according to claim 4 for regulating the gene transcription activity in aquilaria sinensis tissue.

6. Use of the protein according to claim 1, the cDNA molecule according to claim 2 or 3, or the recombinant expression vector or recombinant bacteria according to claim 4 for regulating the expression of sesquiterpene synthase genes in Aquilaria sinensis.

7. The use as claimed in claim 6 wherein the modulation is based on the transcription factor AsWRKY44 normally inhibiting the transcriptional expression of sesquiterpene synthase genes by binding to the W-box on the promoter of the aquilaria sinensis sesquiterpene synthase ASS 1; under the induction of injury and injury signals, AsWRKY44 is degraded, the inhibition is relieved, and sesquiterpene synthase genes start transcription expression.

8. Use of the protein of claim 1, the cDNA molecule of claim 2 or 3, or the recombinant expression vector or recombinant bacterium of claim 4 for regulating secondary metabolism of aquilaria sinensis.

9. Use of a protein according to claim 1, a cDNA molecule according to claim 2 or 3 or a recombinant expression vector or a recombinant bacterium according to claim 4 for modulating the resistance of aquilaria sinensis to injury or injury signals.

10. Use of a protein according to claim 1, a cDNA molecule according to claim 2 or 3 or a recombinant expression vector or a recombinant bacterium according to claim 4 for the preparation of transgenic plants.

Images