EP0416032A4 - Agrichemical screens - Google Patents

Abstract

The present invention discloses a method for identifying plant gene regulatory elements that respond to stimuli and affect transcription of structural genes operatively linked thereto. The invention further discloses a screening assay useful for identifying substances that can be used exogenously to activate plant trait-specific gene regulatory elements (e.g., promoters), thus causing expression of native or chimeric structural genes that are operatively linked thereto. Still further the invention discloses plant defense gene regulatory sequences (e.g., plant defense gene promoters, elicitor-regulated activator domains, upstream silencer domains and the like) that can be ''turned on'', induced or otherwise activated or deactivated by exogenous elicitors.

Description

AGRICHEMICAL SCREENS FIELD OF THE INVENTION The present invention relates generally to methods and compositions for analyzing agrichemicals. More particularly, the invention relates to a novel screening method for identifying agriche ical compounds that may be useful for inducing transcription of trait- specific plant genes. In addition, the invention relates to a method for identifying trait-specific nucleic acid sequences from plants that respond to agrichemicals by regulating gene transcription. Finally, the invention relates to regulatory elements that control selective induction of plant defense genes. BACKGROUND OF THE INVENTION Agricultural chemicals, or agrichemicals, form the basis of a multi-billion dollar component of the chemical industry. Agrichemicals are used as pesticides, herbicides and plant growth regulators. Typically, a chemical company screens hundreds of thousands of chemical compounds to identify one or a few with desirable attributes or activities. These screening methodologies are labor intensive, time consuming and very costly.

The screening methodologies in use at the present time include everything from whole plant assays to in vitro tests on mammalian cells. For example, whole plant assays are typically used to test chemicals for herbicidal activity. Flats of seedling plants are sprayed with different compounds and monitored for the effect(ε) of the chemical. Pesticidal activities are identified by examining the effec (s) of the application of different compounds on, e.g., a specific insect pest. In cases where pesticidal activity upon a known enzymatic pathway is hypothesized to cause a desired e ect, in vitro assays in heterologous systems are developed.

Assays for plant growth regulators can be even more time consuming and complex. For example, to^* identify a plant growth regulator capable of delaying senescence in soybeans, using presently available technology, it is necessary to grow soybean plants to maturity, a process requiring three to four months, and then to expose different sets of plants to the effects of different chemicals. This is a time consuming and costly process.

The chemical industry has in recent years turned to biotechnology to unravel the chemical mysteries of plants. Biotechnology, in turn, has yielded new insights into processes whereby plants can be induced to exhibit desirable responses to exogenous stimuli. As discussed herein, plants can be induced to exhibit plant defense responses when treated with specific compounds. As also discussed herein, the genetic regulatory elements controlling these responses can be cloned and fused to reporter genes. Such constructs then can be transferred to whole plants or plant cells which, in turn, can be used to develop assays for agrichemicals capable of inducing transcription from these genetic regulatory elements.

The development of such assays can readily be extended to a wide variety of desirable traits and responses once the genetic regulatory elements controlling those traits or responses are identified. Methodologies for identifying such elements are described herein. Traits or responses amenable to such methodologies include the majority of those which alter a plant's life processes or its structure to improve quality, increase yields, or facilitate harvesting. Examples of such life processes include rooting and plant propagation, germination and dormancy, flowering, gamete production, abscission, fruit set and development, plant and organ size, production of axillary buds, self-pruning, formation of shape, tillering, resistance to and control of insects and diseases, overcoming environmental stress, uptake of minerals, plant composition, metabolic effects including ripening and yield increases, modification of sexual expression, senescence, dessication, protection against herbicide damage, and increase of herbicide absorption and translocation. Any and all of these processes that are mediated by changes in gene transcription are amenable to definition and can be used in the agrichemical screening assays that are disclosed and described herein. Once in place, these screening assays will provide a tremendous time and cost savings to the agrichemical industry. The initial selection of promising agrichemicals, for further testing in standard seedling screens, will be shortened from months to days. The actual numbers of seedling screens will be greatly reduced. The assays will permit thousands of potential agrichemicals to be screened for new base compounds in a very short time because the labor and plant growth time involved is significantly less than with standard assays. In conjunction with this, significant savings on capital expenditures for new laboratories and greenhouses, as well as associated operating expenses, will be realized.

As alluded to above, the key to analyzing the effect an agrichemical has on molecular events associated with a specific trait, such as growth or stress defense, is the ability to identify and isolate genetic material (i.e., the nucleic acids) associated with the trait, and then place the isolated genetic material in a strictly controlled environment where its response to the agrichemical can be directly and unambiguously measured. The present invention provides a means for identifying and isolating genetic materials associated with traits of interest. The invention further provides a means of using the identified and isolated genetic materials to evaluate agrichemicals¹ effects on the genetic materials, and by extrapolation, the trait of interest.

The present invention is based on several discoveries regarding plant regulatory elements which are associated with genes encoding protein products that influence plants in trait-specific manners. The first discovery is that DNA sequences responsible for transcription of trait-specific genes can be identified by the combined means of biochemical and molecular analytical techniques. Once identified, these regulatory elements can be isolated from the plant genome and characterized. A second discovery is that the isolated plant gene regulatory elements can be used to evaluate the effect a specific agrichemical has on the isolated regulatory element, and by extrapolation, the effect the agrichemical has on the trait-specific gene and the trait itself.

The present invention is further based on recent discoveries regarding activation of plant defense genes. The first such discovery is that the reduced form of glutathione (GSH) , a small, water-soluble, non- toxic cellular metabolite, stimulates transcription of certain defense genes, including those that encode cell wall hydroxyproline-rich glycoproteins and the phenylpropanoid biosynthetic enzymes phenylalanine ammonia-lyase (PAL) and chalcone synthase (CHS) . It has been found that transcriptional activation of these genes leads to marked transient accumulation of the corresponding transcripts, contributing to a massive change in the overall pattern of protein synthesis which closely resembles the change observed in response to fungal elicitor. In addition, it has been discovered that specific nucleotide sequences immediately upstream of the defense gene coding regions are able to confer regulation by substances such as glutathione and fungal elicitor. These specific promoter regions, which can be "turned on" by fungal elicitors and simple chemical substances like GSH, are extremely useful for engineer¬ ing transgenic plants that have enhanced resistance to pathogens and environmental stresses. BRIEF DESCRIPTION OF THE DRAWINGS

The following is a brief description of the drawings. More detailed descriptions are found in the two Experimental Sections of this specification. The drawings comprise eleven Figures, of which: Experimental Section I Drawings

Figure 1 is a photograph illustrating accumulation of plant defense gene transcripts in response to GSH.

Figure 2 (A and B) shows two graphs that illustrate the kinetics for induction of (A) PAL and CHS transcripts and (B) PAL enzyme activity in response to GSH.

Figure 3 is a photograph illustrating dose response for induction of plant defense gene transcripts by GSH.

Figure 4 is a photograph illustrating the effect of GSH on the transcription of plant defense genes.

Figure 5 (A, B, C and D) is a photograph illustrating the effect of GSH on the pattern of protein synthesis in plants.

Figure 6 is a graph illustrating the induction of PAL activity by GSSG.

Experimental Section II Drawings Figure 7 (A and B) is composed of two drawings: (A) Shows the structure of the CHS-CAT-NOS construct and deletion mutants. (B) Shows the nucleotide sequence of the CHS 15 promoter and CAT fu¬ sion junction.

Figure 8 (A, B, C, and D) is a photograph that illustrates expression of the chimeric CHS-CAT-NOS gene electroporated into protoplasts derived from suspension cultured cells of soybean.

Figure 9 is a photograph that illustrates the correlation between the accumulation of CAT transcripts and CAT activity in electroporated protoplasts containing the CHS-CAT-NOS gene.

Figure 10 is a graph illustrating glutathione induction of CHS-CAT-NOS relative to basal levels of expression as a function of the amount of the chimeric construct electroporated.

Figure 11 shows thin layer chromatography analysis and a graph which illustrate the effect of 5* deletions on glutathione regulation of the CHS-CAT-NOS gene electroporated into soybean protoplasts. DEFINITIONS

In the present specification and claims, reference will be made to phrases and terms of art which are expressly defined for use herein as follows:

As used herein, Greek letters alpha, beta, gamma, etc., are sometimes written as a, b, and g, respectively. Most of the time the Greek letters are written as α, β , η, etc.

As used herein, glutathione refers to ₇-L- glutamy1-L-cysteiny1-glycine. As used herein, peptide analogs of glutathione are substances having the formula ₇-L-glutamyl-L- cysteinyl-X where X is an amino acid other than glycine.

As used herein, homoglutathione refers to η- L-glutamyl-L-cysteinyl-^-alanine. As used herein, GSH refers to the reduced form of glutathione. As used herein, GSSG refers to the oxidized form of glutathione.

As used herein, PAL refers to phenylalanine ammonia-lyase. PAL catalyzes the conversion of the amino acid L-phenylalanine to ir<z«s-cinnamic acid and

NH₄ ⁺. This is the first reaction in the synthesis of a wide range of plant natural products based on the phenylpropane skeleton, including lignins, flavonoidε, isoflavonoid, coumarins and hydroxycinnamic acid esters. As used herein, CHS refers to chalcone synthase. CHS catalyzes the condensation of 4- cou aroyl-CoA with three acetate units from malonyl-CoA to yield naringenin chalcone. This reaction is the first step in a branch of phenylpropanoid metabolism specific for the synthesis of isoflavonoid phytoalexin antibiotics in legumes, and flavonoid pigments which are ubiquitous in higher plants (Dixon, et al., 1983; and Hahlbrock, el al., 1979).

As used herein, 4CL refers to 4-coumarate:CoA ligase. 4CL synthesizes the thiol esters that are central intermediates in the synthesis of many phenylpropanoid compounds in higher plants (Douglas, et al., 1987) .

As used herein, HRGP refers to hydroxyproline-rich glycoproteins.

As used herein, exogenously controlled plant regulatory elements refer to nucleic acid sequences that affect transcription of functionally linked structural genes in response to exogenous stimuli. Examples of exogenously controlled plant regulatory sequences include plant defense gene promoters, elicitor-regulated activator domains, upstream silencer domains, etc.

As used herein, elicitor substances are com¬ pounds that can "turn on", induce or otherwise activate exogenously-controlled plant regulatory elements such as the stress-regulated promoters for the plant genes that encode the phenylpropanoid biosynthetic enzymes phenylalanine ammonia-lyase (PAL) , chalcone synthase

(CHS), and 4-coumarate:CoA ligase (4CL) , plus promoters for the plant genes that encode the cell wall hydroxyproline-rich glycoproteins. Elicitor substances of the invention include, but are not limited to, the reduced form of glutathione; the reduced form of homoglutathione and the reduced form of other peptide analogs of glutathione; glycan elicitors such as hexa( -D-glucopyranosyl)-D-glucitols (Sharp, et al., 1984); lipid elicitors such as arachidonic acid and eicosapentaenoic acid, glycoprotein elicitors, fungal elicitors, and abiotic elicitors such as mercuric chloride HGC1₂. As used herein, fungal elicitor refers to the high molecular weight material heat-released from mycelial cell walls of the bean fungal pathogen Col- letotrich m lindemulhianum (Lawton, et al., 1983) .

As used herein, marker or reporter genes refer to genes that encode easily assayable protein products. Examples of marker or reporter genes are CAT, GUS, β- galactosidase, and the firefly luciferase gene. In the methods of the present invention marker or reporter genes are functionally linked to plant gene regulatory elements that respond to exogenous stimuli by modulating transcription of genes (such as the CAT, GUS, β- galactosidase or luciferase reporter genes) functionally linked thereto.

As used herein, CAT refers to chloramphenicol acetyltransferase.

As used herein, NOS refers to nopaline synthase.

As used herein, GUS refers to beta glucuronidas . As used herein, lacZ refers to β- galactosidase. As used herein, native gene means a gene that exists in nature.

As used herein, chimeric gene means a gene that has been constructed or engineered through the efforts of human beings. As used herein, CGC means a chimeric gene cassette. The phrases "promoter(s)/reporter gene(s)/terminator", "chimeric defense gene promoter(s)/reporter gene(s)/3 'terminator", "promoter(s)/structural gene(s) capable of being expressed in plant material/terminator", and the like, refer to chimeric gene cassettes of the invention and are used interchangeably with the phrase "chimeric gene cassette".

As used herein, transcription refers to syn- thesis of RNA from a DNA template.

As used herein, promoter refers to a region of DNA involved in binding of RNA polymerase and other factors that initiate or modulate transcription.

As used herein, transcription start site refers to the position on DNA corresponding to the first base incorporated into RNA. In the DNA sequences shown in the Figures, the transcription start site is designated as +1.

As used herein, the TATA box refers to a con- served A-T rich septamer found about 25 base pairs upstream of the transcription start site of each eukaryotic RNA polymerase II transcription unit; the TATA box is believed to be involved in positioning the RNA polymerase enzyme for correct initiation of transcription.

As used herein, terminator or 3' terminator refers to a sequence of DNA, represented at the 3' end of a gene or transcript, that causes the RNA polymerase to terminate transcription. Examples of terminators include the 3' flanking region of the nopaline synthase (NOS) gene and the 3' flanking region of the octopine synthase (OCS) gene.

As used herein, "mho" refers to a standard unit of conductivity. As used herein, IVT means in vitro translation.

As used herein, suitable plant material means and expressly includes, plant protoplasts, plant cells, plant callus, plant tissues, developing plantlets, immature whole plants and mature whole plants. As used herein, a plant protoplast is a single plant cell that does not have a plant cell wall.

As used herein, plant callus refers to an undiffentiated mass of plant cells.

Use of the phrase "substantial sequence homology" in the present specification and claims means that DNA, RNA, or amino acid sequences which have slight and non-consequential sequence variation(s) from the actual sequences disclosed and claimed herein are considered to be equivalent to the sequences of the present invention, and as such are within the scope of the appended claims. In this regard, "slight and non- consequential sequence variation(s) (i.e.. the sequences that have substantial sequence homology with the DNA, RNA, or proteins disclosed herein) will be functionally equivalent to the sequences disclosed and claimed in the present invention. Functionally equivalent sequences will function in substantially the same manner to produce substantially the same compositions as the nucleic acid and amino acid compositions disclosed and claimed herein.

Use of the phrase "substantially pure" in the present specification and claims, as a modifier of DNA, RNA, polypeptides or proteins, means that the DNA, RNA, polypeptides or proteins so designated have been separated from their in vivo cellular environments through the efforts of human beings; as a result of this separation, the substantially pure DNAs, RNAs, polypeptides and proteins are useful in ways that the non-separated, impure DNAs, RNAs, polypeptides or proteins are not. As used herein, operatively linked and functionally linked are equivalent terms that are used interchangeably. Both terms mean that the linked DNA sequences (e.g., the promoter(s) , the reporter gene(s) , and the terminator sequence(s) ) are operational or functional, i.e., work for their intended purposes.

Stated another way, operatively or functionally linked means that after the respective DNA segments are joined, upon appropriate activation of the promoter, the reporter gene will be expressed. As used herein, terminator sequences refer to DNA sequences that "instruct" the RNA polymerase (i.e., the enzyme that catalyzes the synthesis of RNA from a DNA template in the process known as transcription) to stop transcribing the DNA. Terminator sequences useful in the methods of the present invention include, but are not limited to, the 3' flanking region of the NOS gene and the 3' flanking region of the OCS gene.

As used herein, stop codons refer to DNA sequences that, when transcribed into RNA stop translation of the RNA into proteins.

As used herein, plant material engineered with human effort refers to plant material created by scientists who use the techniques of modern genetic engineering rather than traditional plant breeding techniques to generate new strains; engineered plant material does not exist "in nature", and therefore is not a product of nature.

As used herein, elicitor-regulated activator domain and upstream silencer domain refer to two nucleotide sequence regions on exogenously-controlled plant promoters.

As used herein, an elicitor-regulated activator domain refers to a first nucleotide sequence region on exogenously-controlled plant promoters such as promoters from the stress-regulated plant genes PAL,

CHS, 4CL, and the plant genes that encode the cell wall hydroxyproline-rich glycoproteins. As defined by function, these elicitor-regulated activator domains or regions confer on the promoter the property of being activated when protoplasts, plant cells, or plants that carry the promoter are treated with exogenous elicitors that affect transcription, e.g., reduced glutathione, reduced homoglutathione, reduced peptide analogs of glutathione, fungal elicitor preparations, etc. In the CHS promoter, the activator region extends from nucleotides -29 to -173; this region has substantial sequence homology to analogous activator regions in the promoters of co-ordinately regulated genes such as PAL and 4CL.

As used herein, the upstream silencer domain refers to a second nucleotide sequence region on exogenously-controlled plant promoters such as promoters from the stress-regulated plant genes PAL, CHS, 4CL, and the plant genes that encode the cell wall hydroxyproline-rich glycoproteins. As defined by function, this silencer domain represses the activity of these promoters to the extent that, when the domain is removed and activity is analyzed by functional assays, elicitor induced expression (mediated by the remaining portions of the promoter) is enhanced several fold. The silencer domain is known to contain binding site(s) for a repressor factor. In the CHS promoter, the silencer domain or region extends from nucleotides -173 to -326; this region has substantial sequence homology to analogous silencer regions in the promoters of co- ordinately regulated genes such as PAL and 4CL.

The amino acids which make up the various amino acid sequences appearing herein may be identified according to the following three-letter or one-letter abbreviations:

3 Letter 1 Letter Amino Acid Abbreviation Abbreviation

L-Alanine Ala A

L L--AArrggiinniinnee A Arrgg R

L-Asparagine Asn N

L-Aspartic Acid Asp D

L-Cysteine Cys C

L-Glutamine Gin Q

L L--GGlluuttaammiicc AAcciidd G Glluu E

L-Histidine His H

L-Isoleucine He I

L-Leucine Leu L

L-Lysine Lys K

L L--MMeetthhiioonniinnee M Meett M

L-Phenylalanine Phe F

L-Proline Pro P

L-Serine Ser S

L-Threonine Thr T

L L--TTrryyppttoopphhaann T Trrpp W

L-Tyrosine Tyr Y

L-Valine Val V

The nucleotides which comprise the various nucleotide sequences appearing herein have their usual single-letter designations (A, G, T, C or U) used routinely in the art.

INVENTION SUMMARY

The present invention discloses a method for identifying plant gene regulatory elements that respond to stimuli and affect transcription of structural genes operatively linked thereto. The invention further discloses a screening assay useful for identifying substances that can be used exogenously to activate or deactivate plant trait-specific gene regulatory elements

(e.g.. promoters) , thus causing increased or decreased expression or repression, respectively, of native or chimeric structural genes that are operatively linked thereto. Still further the invention discloses plant gene regulatory sequences (e.g., plant defense gene promoters, elicitor-regulated activator domains, upstream silencer domains and the like) that can be

"turned on", induced or otherwise activated, or "turned off" or otherwise deactivated, by exogenous elicitors. In the methods of the present invention, the plant gene regulatory elements are first identified and isolated, and then functionally linked to at least one reporter or marker gene whose expression can be monitored. When such regulatory element(s)/reporter gene(s) constructs or cassettes are transformed into a cell and the cell is exposed to specific agrichemical(s) , the effect the agrichemical(s) has on the plant regulatory element of interest can be determined by monitoring, for expression of the reporter gene(s) .

DESCRIPTION OF THE INVENTION In one aspect, the present invention comprises a method for identifying and isolating plant gene regulatory elements functionally linked to structural genes encoding protein products associated with a specific trait. The method is a combination of biochemical and molecular techniques that make possible the identification of cDNAs associated with a specific trait of interest. The cDNAs are then used as probes to isolate the corresponding gene regulatory element(s) from genomic DNA. Briefly, this method of the invention is comprised essentially of the following steps. First, RNAs are collected from two types of plant tissue: (1)

"type 1" plant tissues known to exhibit the trait of interest and, (2) "type 2" plant tissues that do not exhibit the trait. Each RNA pool is then translated in vitro and the translation products are examined in one- dimensional and two-dimensional electrophoretic gels. The data obtained from these comparative analyses are used to identify protein product(s) encoded by structural genes whose transcription is regulated in the desired trait-specific fashion. Once a candidate gene product is identified as being expressed (or repressed) under the desired trait-specific conditions, a cDNA library is constructed from RNA isolated from the appropriate tissue. The cDNA library is then separately screened in a "plus-minus" fashion using RNA from a time when gene expression is "on" ("plus") and a time when gene expression is "off" ("minus") . To identify cDNAs that are expressed under the desired trait-specific conditions, clones that hybridize to the "plus" RNA but not the "minus" RNA are selected. These "plus" or "minus" clones are then further characterized, to identify the ones that encode a protein having the characteristics of the candidate protein identified from the 1-D and 2-D electrophoretic gel analyses. The chosen cDNA is then used as a probe to screen a genomic library of plant DNA to identify the gene regulatory element(s) (e.g., the promoter, elicitor-regulated activator domain, the upstream silencer domain, etc.) associated with the gene corresponding to the cDNA. Once identified and isolated, such gene regulatory element(s) can be further characterized by restriction analysis and sequencing. These regulatory elements are referred to herein as trait-specific plant gene regulatory elements. In another aspect of the invention, trait- specific promoters and other plant gene regulatory elements are operatively linked to at least one reporter or marker gene and at least one transcription terminator. The chimeric regulatory elemen (s)/reporter gene(s) construct, or cassette, thus produced is transformed into cells which are then used to screen agrichemicals for their transcriptional effect on the trait-specific plant gene regulatory elements. The transformed cells are preferably plant cells that can be propagated in cell culture or as whole plants. The transformed cell preparation is contacted with an agrichemical and the reporter or marker gene product(s) is assayed, either directly (e.g., luciferase) or indirectly (e.g., CAT) . Expression of the reporter gene(s) is an indication that the agrichemical induced transcription of the trait-specific plant gene regulatory element(s) and thus would likely induce transcription of the same regulatory element(s) if applied to a native plant. Thus, the agrichemical is considered a good candidate for influencing the trait of interest.

In another aspect, the present invention comprises substantially pure plant defense gene promoters that direct stress-regulated expression of target genes when chimeric gene fusions are introduced into plant cells. Such promoters include, but are not limited to, promoters for the plant genes that encode the phenylpropanoid biosynthetic enzymes phenylalanine ammonia-lyase (PAL) , chalcone synthase (CHS) , and 4- coumarate:CoA ligase (4CL) , plus promoters for the plant genes that encode the cell wall hydroxyproline-rich glycoproteins.

In another aspect, the present invention comprises substantially pure functional domains of stress-regulated plant promoters, which domains include, but are not limited to, functional domains from promoters for the plant genes that encode the phenylpropanoid biosynthetic enzymes phenylalanine am onia-lyase (PAL) , chalcone synthase (CHS) , and 4- coumarate:CoA ligase (4CL) , plus promoters for the plant genes that encode the cell wall hydroxyproline-rich glycoproteins. Such substantially pure functional domains include: (1) an elicitor-regulated activator, located in the CHS promoter between the TATA box and nucleotide position - 173; and (2) an upstream silencer, located in the CHS promoter between nucleotides found at positions -173 and -326. (Nucleotide positions refer to those shown in Figure 7. ) There is substantial sequence homology between elements within these functional domains within the CHS promoter and the promoters for the co-ordinately regulated genes PAL and 4CL; in addition, the substantially homologous domains in the

PAL and 4CL promoters are organized in similar relative dispositions as those in the CHS promoter. For example, the PAL and CHS promoters have approximately 70% homology in the silencer region, while the CHS and 4CL promoters have 70% homology on 68 base pairs just upstream of the TATA box (the activator domain) , and PAL and 4CL have more than 60% homology in this same region. See Edwards, et al., (1985) and Cramer, et al., (1989).

In another aspect, the present invention comprises two substantially pure sequences shown in

Figure 7 as nucleotide sequences (-242 to -194) and (-74 to -52) in the 5' flanking region of the CHS promoter. The two sequence elements are:

(1): (-242)ACCAATTATTGGTTACTAAATTTAACAGTGAATGAATGAATGAGTTATA(-194)

(2):

(-74)CACGTGATACTCACCTACCCTAC(-52) .

In another aspect, the present invention com¬ prises chimeric plasmids selected from the group con- sisting of pCHCl and pCHC2. In another aspect, the present invention com¬ prises a chimeric gene cassette (CGC) comprising: (a) a promoter selected from the group consisting of promoters for the plant genes that encode the phenylpropanoid biosynthetic enzymes phenylalanine ammonia-lyase (PAL) , chalcone synthase (CHS), and 4-coumarate:CoA ligase (4CL) , plus promoters for the plant genes that encode the cell wall hydroxyproline-rich glycoproteins, wherein the promoter is operatively linked to: (b) at least one reporter gene, and (c) at least transcription termination sequence. In this aspect of the invention, useful reporter genes include, but are not limited to, CAT, GUS, lacZ and firefly luciferase; useful terminator sequences include, but are not limited to, the 3' flanking region of the NOS gene and the 3' flanking region of the OCS gene.

Several straightforward techniques are now available for inserting new genetic material into plants. As a result, the chimeric gene cassettes of the present invention will be extremely useful to those wishing to engineer transgenic plant strains that have enhanced defense capabilities. For example, modified versions of the natural gene vector system of Agrobacterϊum t mefaciens have been used successfully to create a number of^" engineered dicotyledonous plants, including tobacco, potato, carrot, flax, eggplant, tomato, chili pepper, sunflower and rapeseed (cabbage) . Such methods can be used by those skilled in the art of plant genetic engineering, without undue experimentation, to create new plant strains that contain, as part of their genetic makeup, the chimeric gene cassettes of the present invention. Alternatively, those skilled in the art can use methods such as the leaf disk transformation procedure disclosed in Horsch, et al., (1985) to create transgenic plants, or the method of Rhodes, et ah, that was used recently to transform the monocotyledonous plant, maize (Rhodes, et al., (1988)). (The leaf disk transformation procedure has been used successfully to engineer soybean protoplasts and transgenic tobacco plants that contain the chimeric gene cassettes of the present invention.)

In another aspect, the present invention com¬ prises use of exogenous elicitor substances to activate plant defense genes. Exogenous elicitor substances useful for this purpose include, but are not limited to, the reduced form of glutathione; the reduced form of homoglutathione, and the reduced form of other peptide analogs of glutathione; glycan elicitors such as hexa(0- D-glucopyranosyl)-D-glucitols, lipid elicitors such as arachidonic acid, glycoprotein elicitors, fungal elicitors, and abiotic elicitors such as mercuric chloride HGC1₂. Plant defense genes that can be induced by exogenous substances include, but are not limited to, plant defense genes that encode the phenylpropanoid biosynthetic enzymes phenylalanine ammonia-lyase (PAL) , chalcone synthase (CHS), and 4-coumarate:CoA ligase

(4CL) , plus the plant genes that encode the cell wall hydroxyproline-rich glycoproteins.

In yet another aspect, the present invention comprises a screening assay for identifying substances capable of inducing transcription of stress-regulated plant defense genes. According to the method: a chimeric gene cassette (CGC) is introduced into plant material from a suitable plant (P) . Also according to the method, the CGC is comprised of: (a) at leaset one stress-regulated defense gene promoter (which is selected from the group consisting of promoters for the genes that encode the phenylpropanoid biosynthetic enzymes phenylalanine ammonia-lyase (PAL) , chalcone synthase (CHS) and 4-coumarate:CoA ligase (4CL) , plus promoters for the plant genes that encode the cell wall hydroxyproline-rich glycoproteins) , that is operatively linked to: (b) at least one reporter gene, such as CAT, lacZ, firefly luciferase or GUS; and (c) at least one transcription termination sequence such as the 3' flanking region of the NOS or OCS gene. The plant material, which contains the CGC, is then grown or cultured in the presence of substances that may be capable of inducing or otherwise activating transcription of a stress-regulated plant defense gene.

The cultured plant material is monitored for induction (i-e. , the presence) of the reporter gene sequences.

Those substances that are capable of inducing expression of the reporter gene sequences are considered candidates for exogenously inducing expression of plant defense genes. Such substances are useful for exogenously inducing plant defense genes and chimeric transgenes that are operatively linked to a responsive promoter, as well as pre-activating a plant's own defense mechanisms.

In a preferred form of the method of the invention, the plant material will consist of whole transgenic plants, the promoter(s) will be CHS and/or PAL, the reporter gene(s) will be CAT, lacZ, GUS or firefly luciferase, and the terminator sequence will be the 3' flanking region of the NOS or OCS genes.

Various other aspects of the present invention are further explained and exemplified in the three experimental sections that follow. Experimental Section I relates to the discovery that the reduced form of glutathione (GSH) , when supplied to suspension cultured cells of bean (Phaseolus vulgaris L.) at concentrations in the range 0.01 mM to 1.0 mM, stimulates transcription of defense genes including those that encode the phenylpropanoid biosynthetic enzymes phenylalanine ammonia-lyase (PAL) , chalcone synthase (CHS) , involved in lignin (PAL) and phytoalexin (PAL, CHS) production, plus those that encode the cell wall hydroxyproline-rich glycoproteins. Transcriptional activation of these genes leads to marked accumulation of the corresponding transcripts, contributing to a massive change in the overall pattern of protein synthesis, which change closely resembles that previously observed in response to fungal elicitor. GSH causes a marked increase in extractable PAL activity, whereas the oxidized form of glutathione, the separate constituent amino acids of glutathione (glutamate, cysteine and glycine) , and strong SH reducing reagents such as cysteine, ascorbic acid and mercaptoethanol are inactive.

While the effects of exogenous GSH on the activation of defense genes and accumulation of the corresponding transcripts qualitatively resemble those previously observed following treatment with fungal elicitor, a particularly striking feature of the present invention is the massive quantitative effect of GSH. For example, induction of PAL and CHS transcripts is several fold greater and also more prolonged than with optimal concentrations of fungal elicitor. Moreover, PAL enzyme activities of about 200 μkat/kg protein ob¬ tained following GSH treatment are the highest that have been observed in cell suspension cultures or other in¬ duction systems (Lawton, et al., 1983).

As shown in Experimental Section I, the effects of GSH are specific both in terms of the selective effects on gene activation, transcript accumulation and protein synthesis. Moreover, the lack of effect by the oxidized form of glutathione, a mixture of glutamate, glycine and cysteine (the constituent amino acid monomers that make up glutathione) , or other SH reagents (such as ascorbate, cysteine or dithiothreitol) is notable. In vivo, GSH is found at concentrations in the range of 0.05 to 1.5 mM (Bielawski, et al., 1986; Rennenberg 1982; Smith, 1975; and Smith, et al., 1985) and hence the effects on defense genes occur at physiological concentrations of GSH. Experimental Section II relates to efforts to investigate the mechanisms underlying activation of plant defenses against microbial attack. As part of that effort, studies were carried out on elicitor regulation of a chimeric gene comprising the 5'-flanking region of a defense gene encoding the phytoalexin biosynthetic enzyme chalcone synthase fused to a bac¬ terial chloramphenicol acetyltransferase gene. Glutathione or fungal elicitor caused a rapid, marked but transient expression of the chimeric gene electroporated into soybean protoplasts. The response closely resembled that of endogenous chalcone synthase genes in suspension cultured cells.

In addition, the data presented in Experimental Section II show that the 429 bp nucleotide sequence immediately upstream of the CHS coding region is sufficient to confer regulation by elicitor substances such as glutathione or fungal elicitor. Moreover, functional analysis of 5' deletions suggests that promoter activity is determined by: (1) an elicitor-regulated activator located between the TATA box and nucleotide position -173, and (2) an upstream silencer between -173 and -326. These c/s-acting elements function in the transduction of the elicitation signal to initiate elaboration of an inducible defense response.

The responses of the chimeric CHS-CAT-NOS gene electroporated into protoplasts closely resemble that of endogenous chromosomal CHS genes in elicitor-treated cell suspension cultures with respect to the kinetics of induction and the relative potency of glutathione and fungal elicitor as inducers. Hence the whole plants system described herein provides a convenient functional assay for identifying exogenous substances that can be used to induce expression of plant defense genes, or pre-activate the plant's own defense mechanisms. In addition, the system will be useful for analyzing ex¬ acting nucleotide sequences involved in elicitor regulation of defense genes.

Experimental Section III illustrates the methods of the present invention by disclosing protocols for (1) identifying trait-specific nucleic acid sequences that are likely to respond to agrichemicals by regulating gene transcription, and then for (2) identifying agrichemical compounds that may be useful for inducing transcription of these trait-specific nucleic acid sequences. In the illustrated example, the test plant is tomato, and the test traits are enhancement or delay of fruit ripening or development. Without further elaboration, it is believed that one of ordinary skill in the art can, using the preceding description, and the following Experimental Sections, utilize the present invention to its fullest extent. The material disclosed in the experimental sections, unless otherwise indicated, is disclosed for illustrative purposes and therefore should not be construed as limiting the scope of the appended claimsin any way.

EXPERIMENTAL SECTION I GLUTATHIONE CAUSES A MASSIVE AND SELECTIVE INDUCTION OF PLANT DEFENSE GENES

Introduction Glutathione (ηf-L-glutamyl-L-cysteinyl-glycine) is a low molecular weight thiol implicated in a wide range of metabolic processes (Meister, et al., 1983). Functions proposed for glutathione in higher plants in¬ clude: storage and transport of reduced sulfur; protein reductant; destruction of H₂0₂ in chloroplasts and detoxification of xenobiotics including certain her¬ bicides and pesticides (Edwards, et al, 1986; and Ren- nenberg, 1982) . This example shows that treatment of suspension-cultured cells of bean (Phaseolus vulgaris L.) with GSH (the reduced form of glutathione) causes a massive and selective induction of the transcription of defense genes encoding enzymes of phytoalexin and lignin biosynthesis, as well as stimulation of genes encoding cell wall HRGPs. The effects of GSH on the pattern of gene expression and protein synthesis closely resemble the response to fungal elicitor. Experimental Section I Materials and Methods Fungal Cultures and Elicitor Preparation

The source, maintenance and growth of cultures of Colleiotrichum lindem thianum were as described (Bailey, et al., 1971) . Elicitor, at a final concentration of 60 μg glucose equivalents/ml, was the high molecular weight fraction released by heat treatment of isolated mycelial cell walls (Lawton, et al., 1983).

Plant Material French Bean (Phaseolus vulgaris L. cv Canadian Wonder) cell cultures were grown as previously described (Lawton, et al.. 1983), except the cultures were maintained in total darkness. Experiments were conducted with seven to ten day old cell cultures, in which the growth medium- exhibited a conductivity between 2.5 and 2.8 mho. This represents the period of maximum responsiveness to elicitor during the cell culture cycle (Edwards, et al., 1985) .

Enzyme Extraction and Assay Extraction and assay of PAL were as previously described (Lawton, et al., 1983). One unit of enzyme activity (1 kat) is defined as the amount of enzyme re¬ quired for the formation of 1 mol of product in 1 sec under the assay conditions.

Extraction of RNA Total cellular RNA was isolated from samples homogenized directly in a phenol/O.l M Tris-HCl emul- sion, (pH 9.0), and purified as previously described

(Lawton, et al., 1983) . RNA was assayed spectrophotometrically at 260 nm. The yield of RNA was 150 to 250 μg/g fresh weight of tissue and the A₂₆₀/A₂₈₀ ratio varied between 1.8 and 2.1.

In vitro Translation and Two-Dimensional Electrophoresis Total RNA was translated in vitro in the presence of [³⁵S]methionine (Amersham) using a message-dependent rabbit reticulocyte lysate (Lawton, et al., 1983). Translation products were fractionated by two- dimensional gel electrophoresis (Garrels, 1979) with a pH range of 3.5 to 10 for isoelectric focusing in the first dimension, followed 10% gel SDS-PAGE electrophoresis. Radio-labeled polypeptides were visualized by fluorography (Bonner, et al., 1974).

RNA Blot Hybridization Total RNA was denatured by glyoxal and frac¬ tionated by electrophoresis in a 1.2% agarose gel in 10 mM phosphate buffer (pH 7.0) (McMaster, et al., 1977).

Nitrocellulose blots (Thomas, 1980) were hybridized with [³²P]-labeled cDNA sequences prepared by nick translation of the inserts of pPAL5 (Edwards, et al., 1985), pCHS5 (Ryder, et al, 1984), pHyp2.13 and pHyp4.1 (Corbin, et al., 1987). Following autoradiography, specific transcripts were quantitated by scanning densitometry. Several autoradiograms, exposed for different periods, were obtained for each blot to enable quantitation of each sample in the linear range of film response.

Nuclear Run-Off Transcription Isolation of nuclei and analysis of transcripts completed in vitro in the presence of [α-^S2P]UTP was as previously described (Lawton, et al., 1987) . Immobilized sequences were PAL, cDNA pPAL5 (Edwards, et al, 1985); CHS, cDNA CHSl (Ryder, et al, 1984); HRGP, equal amounts of cDNAs Hyp2.13 and Hyp4.1 (Corbin, et al., 1987).

HI is a cDNA clone containing sequences from a constitutively transcribed gene that is unaffected by elicitor treatment. Changes in the rate of transcription of PAL, CHS and HRGP genes were measured by reference to the rate of HI transcription.

Results

Transcript Accumulation

PAL catalyzes the first reaction in the biosynthesis from L-phenylalanine of phenylpropanoid natural products including lignin and phytoalexins. CHS catalyzes the first reaction of a branch pathway of phenylpropanoid biosynthesis specific to the formation of flavonoid pigments and isoflavonoid phytoalexins. GSH caused a massive but transient, co-ordinate accumulation of PAL and CHS transcripts from low basal levels in suspension-cultured bean cells (Figs. 1 and 2) . Maximum accumulation of these transcripts was observed about 6 h after addition of GSH, following which there is a decline to relatively low levels. GSH also caused the accumulation of HRGP transcripts Hyp4.1 and Hyp2.13, which had previously been shown to be induced by fungal elicitor (Fig. 1) . As in elicitor treated cells, accumulation of these HRGP transcripts was less rapid but more prolonged than for PAL and CHS. GSH concentrations in the range 10 - 100 μM caused accumulation of PAL, CHS, Hyp2.13 and Hyp4.1 transcripts to levels comparable to, or greater than, those observed with optimal concentrations of fungal elicitor (Fig. 3) . Transcriptional Activation

Marked accumulation of defense gene transcripts from low basal levels suggested that GSH was stimulating transcription of these genes. The effects of GSH on PAL, CHS and HRGP gene transcription were monitored by analysis of transcripts completed in vitro by nuclei isolated from cells at various times after GSH treatment. Isolation of nuclei and characterization of the run-off transcription assay have been described previously (Lawton, 1987) . cDNA clone HI contains sequences complementary to an abundant transcript which is unaffected by elicitor treatment. Compared with the constitutive transcription of the HI gene as an internal control, GSH caused a marked stimulation in the transcription of PAL, CHS, and HRGP genes (Fig. 4).

Pattern of Protein Synthesis The impact on the overall pattern of protein synthesis was examined by two-dimensional gel electrophoretic analysis of the polypeptide products synthesized in vitro by translation of total cellular RNA (Fig. 5) . By this criterion, GSH caused a major change in the pattern of protein synthesis compared to that in untreated control cells. Thus, GSH markedly stimulated the synthesis of a large number of polypeptides including sets of PAL and CHS isopolypeptides (Fig. 5) . The effects of GSH on the pattern of protein synthesis closely resembled that observed following treatment of equivalent cells with fungal elicitor. However, in addition, GSH markedly stimulated the synthesis of four polypeptides whose levels of expression were little affected by fungal elicitor (Fig. 5) . Simultaneous addition of GSH and fungal elicitor altered the pattern of protein synthesis in a similar manner to GSH alone. Enzyme Activity and Product Accumulation

GSH treatment caused a marked and prolonged increase in the level of extractable PAL activity (Fig- 2) . The phase of most rapid increase in enzyme activity occurred between 3 and 8 h after GSH addition and hence was closely correlated with the timing of maximum accumulation of PAL transcripts. Likewise, the dose response for induction of PAL enzyme activity after 8 h resembled that for accumulation of PAL transcripts, with marked effects at concentrations of GSH as low as 10 μM (Table 1) . GSH stimulation of PAL enzyme activity lead to increased flux through the pathway and appreciable accumulation of the phytoalexin end-product phaseolin (data not shown) . GSH treatment also caused significant browning of the cells, which is characteristic of the accumulation of phenolic material.

Specificity of GSH

Induction of extractable PAL enzyme activity was used as a parameter to monitor the specificity of the effects of GSH. GSSG at a concentration of 1 mM caused only a weak stimulation of PAL activity and at concentrations of 0.1 mM or lower, the oxidized form of glutathione had no significant effect (Fig. 6) . Moreover, treatment of cells with ascorbate, cysteine or a mixture of glutamate, glycine and cysteine did not increase extractable PAL activity (Table 2) . Dithiothreitol likewise did not induce PAL activity (data not shown) .

Discussion The data presented in this example demonstrate that exogenous GSH causes marked changes in the pattern of gene expression and protein synthesis in suspension cultured bean cells, including specific activation of defense genes and accumulation of the corresponding transcripts. While these effects qualitatively resemble those previously observed following treatment with fungal elicitor, a particularly striking feature is the massive quantitative effect of GSH. Thus, induction of PAL and CHS transcripts is several fold greater and also more prolonged than with optimal concentrations of fungal elicitor. Moreover, PAL enzyme activities of about 200 μkat/kg protein obtained following GSH treatment are the highest we have observed in cell suspension cultures or other induction systems (Lawton, et al., 1983) . The effects of GSH are specific both in terms of the selective effects on gene activation, transcript accumulation and protein synthesis, and also the lack of effect of other reducing agents, constituent amino acids or the oxidized form of glutathione. In vivo , GSH is found at concentrations in the range of 0.05 to 1.5 mM

(Bielawski, et al., 1986; Rennenberg, 1982; Smith, 1975; and Smith, et al., 1985) and hence the effects on defense genes occur at physiological concentrations of GSH. However, in some legumes including bean and soybean, the major free low-molecular-weight thiol is -L-glutamyl-L-cysteinyl-9-alanine (homoglutathione) , with only trace amounts of glutathione (Price, 1957) .

Figure Legends Experimental Section I

Figure 1. Accumulation of defense gene transcripts in response to GSH (1 mM) .

Figure 2. Kinetics for induction of (A) PAL and CHS transcripts and (B) PAL enzyme activity in response to GSH (1 mM) . Open symbols: Control; Closed symbols: GSH-treated; PAL (open and closed circles) ; CHS (open and closed squares) . In panel (B) the dotted line denotes changes in PAL mRNA levels.

Figure 3. Dose response for induction of defense gene transcripts by GSH. E = elicitor at a final concentration of 60 μg glucose equivalents / ml.

Figure 4. Effect of GSH on the transcription of defense genes. Nuclei were isolated from cells 1.75 h after GSH treatment or from equivalent untreated con- trol cells.

Figure 5. Effect of GSH on the pattern of protein synthesis. Two-dimensional gel electrophoretic analysis of [³⁵S]methionine-labeled products synthesized by in vitro translation of total cellar RNA isolated from: (A) Control untreated cells; or cells 4 h after treatment with: (B) GSH (1 mM) ; (C) fungal elicitor (60 μg/ml glucose equivalent) ; (D) GSH plus fungal elicitor.

Open arrows in panel B denote those species induced by both GSH and fungal elicitor; closed arrows denote those species induced by GSH but not fungal elicitor; "p" denotes PAL subunits; "c" denotes CHS subunits. "IEF": Isoelectric focusing in the first dimension; "SDS PAGE": SDS-polyacryla ide gel electrophoresis in the second dimension.

Figure 6. Induction of PAL activity by GSSG: 1 mM (closed triangle, apex pointing up); 0.1 mM (closed triangle, apex pointing down); 0.01 mM (closed circle); control (open square) . Induction by GSSG was compared to that obtained with 0.1 mM GSH (open circle).

Tables Experimental Section I

Table 1. Dose Response for the Effect of GSH on the Level of Extractable PAL Activity

Treatment PAL Activity O h 4 h 8 h

(μkat/kg protein)

No treatment 2

GSH

0.01 M 25 21

0.10 mM 40 117

1.00 mM 30 136 Elicitor 36 43 Elicitor + GSH, 1.0 mM 61 142

Elicitor was applied at a concentration of 60 μg glucose equivalents / ml. Table 2. Effect of GSH. Constituent Amino Acids and

Ascorbic Acid on the Level of Extractable PAL Activity

Treatment PAL Activity

O h 4 h 8 h

(μkat/kg protein) Untreated cells 18 22 12

GSH 105 98

Cysteine 7 23

Cysteine, glycine, glutamate 19 21 Ascorbate 13 15

All compounds were tested at a concentration of 0.1 mM

EXPERIMENTAL SECTION II

ELICITOR REGULATION OF A PLANT DEFENSE GENE

PROMOTER IN ELECTROPORATED PROTOPLASTS

Introduction Plants respond to microbial attack by synthesis of antibiotics, stimulation of lytic enzymes and reinforcement of cell walls (Darvill, et al., 1984; Dixon, et al., 1983; Dixon, et al., 1986; and Ebel, 1986). These defenses can also be induced by glycan and glycoprotein elicitors from fungal cell walls and cul¬ ture fluids or metabolites such as arachidonic acid and glutathione (Darvill, et al, 1984; Dixon, et al., 1983; Dixon, et al., 1986; Ebel, 1986; Experimental Section I and Wingate, et al., 1988). Elicitors, wounding or infection rapidly stimulate the transcription of genes involved in the erection of these defenses (Experimental Section I and Wingate, et al., 1988; Chappell, et al., 1984; Cramer, et al., 1985a; Sommsich, et al., 1986; Lawton, et al., 1987; and Hedrick, et al., 1988). To investigate this early event in the activation of resistance mechanisms, the expression in electroporated soybean protoplasts of a chimeric gene comprising the 5'-flanking region of a defense gene encoding chalcone synthase (CHS) fused to a bacterial chloramphenicol acetyltransferase (CAT) gene and the 3'-flanking region of the nopaline synthase (NOS) gene has been studied.

CHS catalyzes the condensation of 4-coumaroyl-

CoA with three acetate units from malonyl-CoA to give naringenin chalcone. This is the first step in a branch of phenylpropanoid metabolism specific for the synthesis of isoflavonoid phytoalexin antibiotics in legumes, and flavonoid pigments which are ubiquitous in higher plants (Dixon, et al., 1983; and Hahlbrock, et al., 1979). Elicitor stimulates CHS transcription in bean cells within 5 min leading to a transient accumulation of CHS mRNA with maximum levels after 3 to 4 h, correlated with the onset of phytoalexin synthesis (Cramer, et al., 1985a; Lawton, et al., 1987; and Ryder, et al., 1984).

This example shows that glutathione or a fungal elicitor preparation of high molecular weight material heat-released from mycelial cell walls of the bean pathogen Collelolrichum lindemuthianum (fungal elicitor) cause a rapid, marked but transient expression of the chimeric CHS-CAT-NOS gene electroporated into soybean protoplasts. The response of the CHS-CAT-NOS gene closely resembles that of endogenous CHS genes in elicitor treated cell suspension cultures. The data show that the 429 bp nucleotide sequence immediately upstream of the CHS coding region is sufficient to confer regulation by elicitor substances such as glutathione or fungal elicitor. Functional analysis of 5' deletions suggests that transduction of the elicitation signal to initiate elaboration of inducible defenses involves an elicitor regulated activator located between the TATA box and -173, and an upstream silencer between -173 and -326. Experimental Section II Materials and Methods

Plasmid Constructions pDO400 is identical to the previously described cauliflower mosaic virus (CaMV) 35S promoter construct pD0432 (Ow, et al., 1986) except that an 883 bp

BamΑl fragment containing the Escherichia coli chloramphenicol acetyltransferase (CAT) gene (Alton, et al., 1979) replaces the luciferase reporter gene of pD0432. pCHS15 consists of a 2.1 kb Hinάlll Phaseolus vulgaris genomic fragment containing the full-length CHS 15 gene and flanking sequences subcloned into the riboprobe vector pSP64 (Ryder, et al., 1987). In pCHCl, a 429 bp Hinfl fragment comprising 5'- untranslated sequences of CHS15 replaces the 35S transcript promoter of pDO400. pCHCl was constructed by replacing the Hindlll/Xbal CaMV 35S promoter fragment of pDO400 with the Hindlll/Xbal polylinker fragment of pUC19 to create pCNIOO. PCN100 was digested with Sail , filled-in with Klenow DNA polymerase and dNTPs and used for blunt-end ligation of the 429 bp Hinfl fragment of pCHS15 whose ends were similarly rendered blunt by Klenow fill-in. The construct was sequenced by dideoxy chain termination (Sanger, et al.. 1977) of denatured double-stranded plasmid with an M13 reverse primer (Chen, et al., 1985). Deletion mutants were constructed by digesting pCHCl with Hindlll followed by exonuclease III and mung bean nuclease treatment (Henikoff, 1984) . After Xbal digestion, deleted promoter fragments were purified on low melting agarose and ligated into Pstl (T₄ polymerase filled-in) /Xbal cut pCNIOO. Precise endpoints were determined by sequencing as described above. pHCNl was constructed by cloning a 235 bp EcoKL/Pvull fragment from the promoter region of a murine histone H₄ gene (Seiler-Tuyns, et al.. 1981) into EcoKL/Smal cut pIBI24 (a pUC-derived phagemid vector) . This construct was further cleaved with EcoRI/Xbal and sub-cloned into

HindXΣΣ/Xbal digested pCNIOO along with the entire

EcόKI/Hindlll polylinker from pIBI24.

Protoplast Isolation The origin and maintenance of bean (Phaseolus vulgaris L. ) , soybean (Glycine max L. ) and tobacco (Nicotiana labacum L.) cell suspension cultures was as described except that cells were collected by sieving (250 micron mesh) and transferred to fresh maintenance medium at 7 d intervals (Cramer, et al., 1985b; and Norman, et al., 1986).

For protoplast isolation, cells (7 g fresh weight) were collected 4 d after subculture and incubated by shaking (90 rpm) in 100 ml of protoplast isolation medium for 4 h at 27°C in darkness (From , et al., 1985) . Protoplasts were separated from the cellular debris by sieving and by centrifugation at 70 x g for 5 min at room temperature. Viability was determined by staining with Evans Blue and protoplasts were adjusted to 5 x 10⁶/ml. Protoplasts were washed twice in electroporation medium (Fromm, et al., 1985) prior to manipulation.

Electroporation and Transient Assay Electroporation was performed as described (Fromm, et al., 1985) , 3 h after isolation of protoplasts with an optimal pulse of 250 V for 10 msec. Unless otherwise noted, 30 μg of test construct DNA was electroporated together with 50 μg of calf thymus DNA as carrier. Protoplasts were maintained without agitation in 6 ml of maintenance medium containing 0.3 M mannitol at 27°C in the dark. In the experiment depicted in Fig. 8 panel (A) , protoplasts were collected for analysis 8 h after electroporation. In all other experiments, protoplasts were incubated for 21 h after electropora¬ tion prior to addition of fungal elicitor preparation heat released from mycelial cell walls of Colletotrichum lindemuthianum (fungal elicitor, Cramer, et al., 1985b) or glutathione (see Experimental Section I and Wingate, et al., 1988) in maintenance medium containing 0.3 M mannitol to give final concentrations of 60 μg glucose equivalents/ml and 1 mM respectively. Equal volumes of maintenance medium containing 0.3 M mannitol were added to control protoplasts. Protoplasts were collected by centrifugation, and extracts assayed for CAT activity by radiometric measurement of the conversion of the substrate ["C] chlora phenicol as described (Fromm, et al., 1985) . Reaction products were separated by thin layer chromatography, visualized by autoradiography and guantitated by scintillation counting. Protein was assayed by the Bradford procedure (Bradford, 1976) . Typical CAT assays involved incubation of samples containing 5 μg protein for 3 hr at 37°C leading to the conversion of 1,000-5,000 cpm of the substrate into acetylated products.

RNA Analysis Protoplasts (3 x 10^β) were resuspended in 100 μl 0.1 M Tris-HCl pH 9.0, containing 0.01% SDS. After extraction with phenol and chloroform, the supernatant was precipitated with 2 vol of 95% ethanol in the presence of 0.3 M sodium acetate. RNA was further processed and analyzed by Northern blot hybridization as described (Cramer, et al., 1985b) . The hybridization probe was a 0.8 b BamHI fragment comprising Escherichia coli CAT gene sequences (Alton, et al., 1979) labeled by nick- translation.

Results To analyze CHS promoter function, the expression of a chimeric gene comprising the 5' flanking region of the CHS 15 gene fused with the coding sequences of chloramphenicol acetyltransferase (CAT) and the 3' flanking sequences of nopaline synthase (NOS) (Fig. 7) was examined following electroporation into protoplasts derived from suspension cultured cells. CHS 15 is one of 6 CHS genes in the bean genome and encodes a major elicitor-induced CHS transcript (Ryder, et al.,

1987) . The chimeric CHS-CAT-NOS gene construct pCHCl contains 429 bp of the 5' untranslated nucleotide sequences of CHS 15, comprising 326 bp upstream of the transcription start site and 103 bp of the transcribed leader sequence (Fig. 7) . As recently reported for parsley (Dangl, et al., 1987), bean and soybean protoplasts_. respond to elicitor in a manner similar to the suspension cultured cells from which they were derived with respect to the accumulation of transcripts encoded by endogenous defense genes and the appearance of phenylpropanoid products (data not shown) . However, electroporated bean protoplasts showed only low viability and weak expression of the CHS-CAT-NOS gene compared to tobacco and soybean protoplasts (Fig. 8A) . The latter, being closely related to bean, were the major focus for elicitor regulation studies.

To minimize induction by endogenous elicitors and other stress factors released during protoplast preparation (Dangl, et al., 1987; and Mieth, et al., 1986), freshly isolated protoplasts were incubated for 3 h prior to electroporation and for a further 21 h before elicitation. Following addition of glutathione, a marked increase in the level of CAT activity was ob- served within 3 h, whereas in untreated controls there was no significant change in CAT activity in this period (Fig. 8B) . Northern blot hybridization with nick- translated CAT gene sequences as a probe demonstrated that glutathione stimulation of CAT activity reflected induction of CAT transcripts (Fig. 9) . Hence induction of CAT activity could be correlated with stimulation of the transcription of the CHS-CAT-NOS gene. In contrast, glutathione did not modulate CAT activity in protoplasts electroporated with a chimeric gene comprising the promoter of the murine histone H₄ gene fused with the CAT-NOS reporter cassette (Fig. 8B) . The response of the CHS-CAT-NOS gene was highly reproducible when different samples of a protoplast preparation were independently electroporated and induced (Fig. 8B) . Optimal elicitor regulation was observed with 30 - 50 μg of the chimeric gene (Fig. 10) .

Electroporation of larger amounts of the construct resulted in high levels of expression in control protoplasts and correspondingly weak regulation by glutathione. Fungal elicitor also induced expression of the chimeric gene (Fig. 8C) , although as with endogenous CHS genes in suspension cultured cells, the response was somewhat weaker than with glutathione (see Experimental Section I, and Wingate, et al., 1988).

The CHS-CAT-NOS gene was transiently expressed with maximum levels 3 h after addition of glutathione followed by a decay to relatively low levels after 6 hr (Fig. 8D) . No induction of CAT activity was observed over this period in the absence of glutathione. The chimeric gene was also regulated by glutathione when electroporated into protoplasts derived from tobacco cells, although the response was slower, with maximum CAT activity after 6 h (Fig. 8D) . These induction kinetics closely resembled those for expression of endogenous defense genes in the respective suspension cultured cells from which the protoplasts were derived (Ryder, et al, 1984; Grab, et al., 1985; Hahn and Lamb, unpublished observations) .

These data showed that sequences to -326 of CHS 15 were sufficient to confer regulation by glutathione or fungal elicitor. Deletion from -326 to -173 increased the basal level of CAT activity in soybean protoplasts prior to addition of an external stimulus and moreover caused a striking increase in the response to glutathione (Fig. 11) . In contrast, further deletion to -130 reduced both basal and induced expression back to about the same respective levels observed with the entire promoter. Deletion to -72 reduced expression in glutathione-treated protoplasts to the basal level observed in unstimulated, control protoplasts. This deletion, which abolishes glutathione regulation, provides an additional internal control for the specificity of induction in the transient assay, since in this construct CHS promoter sequences are re¬ placed by vector sequences adjacent to a functional TATA box. Deletion to -19, which removes the TATA box (-29 to -21) , completely abolished expression of the chimeric gene in both control and glutathione-treated protoplasts.

The 5' deletions had similar relative effects on induction by the fungal elicitor preparation (data not shown) . Thus, deletion to -173 likewise increased the response to fungal elicitor although this enhanced induction was somewhat weaker than that obtained with the same construct in response to glutathione. As with glutathione, further deletion to -136 and -72 progres- sively reduced the response to fungal elicitor.

Discussion The present data show that the CHS promoter is appropriately regulated by elicitor substances such as glutathione and fungal elicitor in electroporated protoplasts. As in other transient expression systems, it is probable that the CHS-CAT-NOS gene is not inserted into chromosomal DNA, and that our experiments monitor the expression of a plasmid-borne gene. However, the responses of the chimeric CHS-CAT-NOS gene electroporated into protoplasts closely resembles that of endogenous chromosomal CHS genes in elicitor treated cell suspension cultures with respect to the kinetics of induction and the relative potency of glutathione and fungal elicitor as inducers. Hence the protoplast system described here provides a convenient functional assay for analysis of cis-acting nucleotide sequences involved in elicitor regulation of defense genes. In addition, since it is now possible to genetically engineer plant cells that contain chimeric promoter/gene fusions, a chimeric "cassette" such as an exogenously inducible plant defense gene promoter-structural gene- terminator cassette (CGC) of the invention can now be introduced into a variety of useful plants. See generally, Caplan, et al., 1984; Horsch, et al., 1985; and Rhodes, et al, 1988. The initial studies with a set of nested 5'

CHS deletions suggest that there is an elicitor regulated activator element downstream from -173. Since 5' deletions to -130 and to -72 affect elicitor regulation by inhibition of induction rather than by elevation of basal expression, the activator appears to be a positive -acting element. This functional analysis is consistent with the pattern of sites hypersensitive to DNase I digestion in CHS genes (M.A. Lawton and C.J. Lamb, unpublished). Three such sites, which denote local opening of chromatin structure associated with binding of regulatory proteins, are found in the proximal region of the promoter in nuclei from elicitor-treated but not control cells. In contrast, sites in the upstream region show pronounced DNase I hypersensitivity in nuclei from uninduced as well as elicited cells.

While sequences between the TATA box and -130 are both necessary and sufficient for regulation by elicitor substances such as glutathione or fungal elicitor, upstream sequences appear to modulate expression, and maximum induction is obtained when sequences to -173 are present. This may reflect the existence of multiple -acting sequences that interact with the same /rαns-acting factor(s) or an independent regulatory element between -173 and -130, that is distinct from the downstream element. Alternatively, deletion of the nucleotide sequences between -173 and

-130 may have an impact on gene expression not by abolition of the binding of trans-SLCt ng factors to ex¬ acting elements located in this region, but through indirect effects on chromatin structure that modulate binding of transcription factors to the activator element downstream of -130.

Similar indirect rearrangements of chromatin structure might likewise account for the enhanced expression observed by deletion from -326 to -173. However, it is likely that this enhanced expression reflects the removal of a discrete cs-acting silencer element located between -326 and -173. Specific binding of a nuclear factor to this region has recently been detected, and moreover, co-electroporation of the putative silencer element in trans with the complete CHS-CAT-NOS gene (pCHCl) leads to a marked stimulation of expression, presumably by competition for binding of the corresponding trans-acting repressor (Lawton, et αl., 1988). Functional analysis of the nested 5¹ deletions does not indicate whether the putative silencer is elicitor regulated, although synergistic interaction be¬ tween positive and negative elicitor-regulated elements would provide a plausible "gain" mechanism for very rapid, marked, transient gene activation.

Two sequence elements, -242 to -194 and -74 to -52, in the 5' flanking region of CHS (Fig. 7) are strongly conserved in the promoter of a co-ordinately regulated gene encoding phenylalanine ammonia-lyase (PAL) , the first enzyme of phenylpropanoid biosynthesis (Cramer, et αl., unpublished observations). These motifs, which are similarly arranged in the PAL promoter, are believed to also have roles in silencer and activator function respectively. Analysis of point mutations and chimeric promoters will define more precisely the silencer and activator sequence elements and delineate the function of the silencer in elicitor regulation.

The studies disclosed in Experimental Section I showed that glutathione and the fungal elicitor have almost identical qualitative effects on the pattern of gene expression and protein synthesis (also see Wingate, et al.,

1988). The 5' deletions examined here have similar effects on regulation by glutathione and fungal elicitor, and it will be of considerable interest to determine, by further dissection of the CHS promoter, whether identical c/s-acting elements are involved in transduction of the signal(s) arising from these two different classes of elicitor.

While expression of genes introduced into protoplasts has been demonstrated in several cases, the only previous report of appropriate regulation in response to an external cue is the stimulation of a chimeric alcohol dehydrogenase 1 (ADH1)-CAT-NOS gene in electroporated maize protoplasts induced by oxygen depletion (Walker, et a!., 1987) . It appears that the signal transduction mechanisms for activation of stress-induced genes such as ADH1 and CHS remain functional during protoplast isolation and culture. Since the response to elicitors is extremely rapid, the signal transduction pathway between microbial recognition and defense gene activation may contain very few steps. Hence, analysis of the rrα«s-acting nuclear factors that interact with the c/s-acting elements identified here may provide a key for the dissection of response-coupling mechanisms that underlie induction of plant defenses.

Figure Legends Experimental Section II Figure 7. (A) Structure of the CHS-CAT-NOS construct and deletion mutants. (B) Nucleotide sequence of the CHS 15 promoter and CAT fusion junction. Restriction sites indicated are: B = BamHl ; H3 = HindXXX ; Hf = Hinfl ; K = KpnX ; R = £coRI; X = Xbal ; X2 =

Xho L . Deletion mutants are marked by arrows. The TATA box is underlined. Sequences conserved in the promoter of an elicitor-induced bean PAL gene are overscored. Figure 8. Expression of the chimeric CHS-

CAT-NOS gene electroporated into protoplasts derived from suspension cultured cells. (A) Comparison of expression in bean, soybean and tobacco protoplasts; (B) Effect of glutathione on the expression of CHS-CAT-NOS and H₄-CAT-NOS chimeric genes in soybean protoplasts; (C) Comparison of the induction by fungal cell wall elicitor and glutathione; (D) Time-course for glutathione-induced expression in soybean and tobacco protoplasts. CAT = authentic bacterial CAT enzyme; T = tobacco; B = bean; S = soybean; SC = soybean protoplasts without electroporated genes; G = protoplasts 3 h after treatment with glutathione; E = protoplasts 3 h after treatment with fungal elicitor; C = equivalent, untreated control protoplasts. Closed arrowheads denote the major CAT product 3-acetylchloramphenicol.

Figure 9. Correlation between the accumula¬ tion of CAT transcripts and CAT activity in electroporated protoplasts containing the CHS-CAT-NOS gene. Upper panel: Northern blot of equal amounts of total cellular RNA from control protoplasts (C) or 3 h after treatment with glutathione (G) hybridized with CAT sequences. Lower panel: CAT activity from extracts of equivalent protoplasts.

Figure 10. Glutathione induction of CHS-CAT- NOS relative to basal levels of expression as a function of the amount of the chimeric construct electroporated.

Figure 11. Effect of 5' deletions on glutathione regulation of the CHS-CAT-NOS gene electroporated into soybean protoplasts. Plus (+) : 3 h after addition of glutathione; minus (-) : equivalent untreated controls. The structure of 5' deletions are presented in Fig. 7A. Error bars denote standard deviation between independent replicates.

EXPERIMENTAL SECTION III

To illustrate the methods of the present invention, this example discloses protocols for (1) identifying trait-specific nucleic acid sequences that are likely to respond to agrichemicals by regulating gene transcription, and then for (2) identifying agrichemical compounds that may be useful for inducing transcription of these trait-specific nucleic acid sequences. In the illustration, the test plant is tomato, and the test traits are enhancement or delay of fruit ripening or development.

I. PROCEDURE TO IDENTIFY AND ISOLATE TOMATO

CDNAS/PROTEINS THAT RESPOND TO DEVELOPMENTAL REGULATORS

As indicated above, the following protocol can be used to develop recombinant constructs useful for testing an agrichemical's specificity for enhancing or delaying fruit ripening or development.

A. Tissue collection and RNA preparation

1. Root, leaf, stem, and fruit tissues from target tomato species were collected during several developmental stages. Collected tissues were quick frozen in liquid nitrogen prior to transport in dry ice and storage at -70°C; it was noted that initial freezing with dry ice does not protect the RNA from degradation.

2. To prepare the various tissues for extraction of RNA, the skin and seeds were removed and the still frozen tomato tissue was ground to a fine powder in the presence of liquid nitrogen.

3. Total RNA was extracted from the tissue powders using proteinase K treatment and phenol/chloroform extractions. A cesium chloride gradient and a minigel were run to evaluate the intact nature of the RNA. The poly A⁺ fraction was isolated from total RNA by performing a lithium chloride precipitation, followed by passage over an oligo d(T) column.

B. Identification of developmentally regulated proteins

4. Poly A⁺ RNA was isolated from the various developmental stages of tomato tissues (as described above) and subjected to an in vitro translation (IVT) procedure. The translation mixture was comprised of rabbit reticulocyte lysate, salts, amino acid mix, creatine phosphate, and ³⁵S- met; the procedure was performed as outlined in protocols provided by Promega Biotec, Madison, Wisconsin.

5. The IVT translation products were then run on 12.5% one dimensional (ID) gels using standard electrophoresis techniques. The gel was exposed to 0 autoradiographic film and, after an appropriate time (about 20 hrs) , the film was developed.

6. The gel banding patterns of the various -^> translation products were compared and differences noted. It was possible to identify translation products, which corresponded to mRNAs, that were 1) highly abundant in some tissues while absent in others (tissue-specific) , 2)

5 abundant during certain developmental stages and low or absent in others

(developmentally regulated) and/or 3) present in all developmental stages

(constitutive regulation) . Translation 0 products corresponding to a protein of about 38.5 KD were shown to increase in abundance as fruit development progressed. Hence, this was identified as a possible marker protein for use in

25 developing agrichemical screens for developmental chemicals. Several protein bands were evident in all tissues and all developmental stages. Such proteins are useful as controls, i.e. these markers

20 should not be affected by administration of developmental agrichemicals.

7. To better resolve the differences seen in protein patterns between various tomato tissues and developmental stages, a

25 portion of the IVT translation products were run on two dimensional (2D) gels. This procedure separated the ID protein bands into their specific, individual protein components. As with the ID gels,

30 the 2D gel patterns were compared to each other and similarities and differences are noted. Computer-assisted analysis of the 2D gel patterns was used to facilitate accurate and timely

35 comparisons. The 2D gel analyses confirmed that a protein of about 38.5 KD was "turned on" late in fruit development, adding further weight to its possible use as a marker in an agrichemical test screen. The protein of about 44 KD protein remained in all tissues, hence, was labeled a constitutive control marker.

C. Preparation of a tomato fruit cDNA library to isolate the above mentioned markers as cDNAs

8. Poly A^÷ RNA was prepared and evaluated

(as described above) from tomato fruit at an intermediate stage of development. The first strand cDNA reaction was accomplished using SI nuclease. Second strand synthesis was completed with DNA polymerase and reverse transcriptase.

9« The double-stranded cDNAs were C-tailed and inserted into a G-tailed pBR322 vector, thus forming a tomato fruit cDNA library.

D. Screening, identification, and isolation of "marker' cDNA clones

10. The cDNA library was screened with RNA from early and late developmental stages of fruit. This differential screen was performed to identify those clones that represent proteins expressed late in development but not early in development (they will hybridize to the "late" RNA probe, but not the "early" RNA probe) . a. Total RNA was prepared from early

(1" green) and late (3" intermediate) tissue in quantities sufficient to prepare poly(A) RNA ⁵ for sucrose gradient fractionation.

b. Poly(A) RNA was selected.

c. Early and late RNA was fractionated on sucrose gradients.

10 d. RNA fractions were translated (IVT) across the gradient to determine which fractions were enriched in mRNAs encoding the ca. 38.5 and ca.

15 44 KD proteins.

e. RNA from gradient fractions of choice were labeled by a polynucleotide kinase reaction with

20 ³²P-ATP.

The cDNA library was probed with fractionated, kinase-labeled RNA from early or late stages of fruit development.

25 g. Clones were selected which hybridized differentially to the different RNA preparations (thus suggesting developmental regulation) 30 and clones which hybridized equally well to the different RNA preparations (thus suggesting constitutive expression) .

35 E. Marker cDNA Characterization

11. Clones were characterized as to insert size and sequence homology.

a. These clones sequences were tested for homology to mRNA species on Northern gels.

b. Clones with homology to mRNA species encoding the i.e., mRNAs abundant in the fractions selected for study in step 4, above (Section IB, step 4) were identified.

c. Using standard mRNA hybridization and selection experiments, a clone encoding a protein of about 50 KD was identified, as were additional clones.

d. The clone encoding the ca. 50 KD protein was sequenced to identify the protein encoded and to further characterize the sequence.

TRANSGENIC PLANTS

A. Isolation of marker genes

1. The cDNA marker probe described in Section I is used to isolate their genomic counterparts by means of standard Southern hybridization and cloning techniques. As an example, the developmental marker cDNA encoding the ca. 50 KD protein is used to isolate the gene whose transcription is developmentally regulated. B. Marker promoters

2. The promoter fragment of the cloned gene is identified by DNA sequencing and - isolated from the parent clone. In brief, sequences upstream of the start codon (ATG) are examined and found to contain a TATA box; potential promoter sequences can extend as far as about 200 base pairs upstream of the ATG.

To test the strength and regulatability of the cloned promoter, the promoter fragment is fused to a reporter genes, such as lacZ, GUS, firefly luciferase or CAT. These expression constructs are inserted into vectors and gene expression is induced under appropriate conditions, e.g. a substance known to regulate development (i.e., a known developmental regulator) is added to the growth medium.

a. It is known that if the promoter is indeed regulated by the developmental agrichemical, it will initiate transcription of its attached reporter gene, whose mRNA will be translated into protein.

b. For example, the presence of lacZ can be detected by the addition of X-gal to the medium. If lacZ is present, the medium will turn blue.

4. Once the promoter regions are deemed to be under the appropriate regulation, they are used to make transgenic plants. C. Transgenic vector construction

5. The promoter-reporter gene construct is inserted into an appropriate vector (e.g., _c- the Agrobacterium Ti plasmid-based vector such as BIN19 or the vectors referred to in United States Patent 4,658,082 issued April 14, 1987 to Simpson, et al.

Transformation 0

Transformation of tomato is accomplished by means of known procedures.

E. Use of transgenic plants to evaluate developmental agrichemicals

Transgenic plants containing the promoter- reporter gene chimeric gene cassette (see Definitions section of this specification) are tested for correct expression of the reporter 0 gene, i.e., for expression of the reporter gene under developmental regulation. Plant material evidencing appropriate expression of the reporter gene is used to develop transgenic plant assay systems. For example, 5 such plants are grown to the early fruiting stage and treated with potential agrichemicals. Those chemicals which induce expression of the reporter gene are candidates for agrichemicals which will accelerate the 0 ripening process.

REFERENCES The following references are cited in the specification. The contents of each reference is ex- 5 pressly incorporated by reference herein. PUBLICATIONS

1 . Alton , N . K . and Vapnek , D . , Nature 282 : 864-869

( 1979 ) .

2. Bailey, J.A. and Deverall, B.J., Formation and activity of phaseollin in the interaction between bean hypocotyls (Phaseolus vulgaris) and physiological races of Colletotrichum lindemuthianum . Physiol. Plant Pathol.

1 : 435-449 ( 1971 ) .

3. Bielawski, W. and Joy, K.W. , Reduced and oxidized glutathione and glutathione reductase in tissues of Pisum sativum . Planta 169:267-272 (1986).

4. Bonner, W.M. and Laskey, R.A. , A film detection method for tritium-labeled proteins and nucleic acids in polyacrylamide gels. Eur. J. Biochem. 46:83-88 (1974).

Bradford, M.M. , Anal. Biochem. 72:248-254 (1976)

6. Caplan, A., Herrera-Estrella, L. , Inez, D. , Van Haute, E., Van Montagu, 1M. , Schell, J. , and Zambryski, P., "Introduction of Genetic Material into Plants" in Biotechnology & Biological Frontiers, P.H. Abelson, ed. , The American Association for the Advancement of Science, Washington, D.C., 1984 at pp. 480-493.

7. Chai, H.B. and Doke, N. , Superoxide anion generation: A response of potato leaves to infection with Phytophthora infestans . Phytopathology 77:645-649 (1987).

8. Chappell, J. and Hahlbrock, K. , Nature 311:76-78 (1984) .

9. Chen, Y. and Seeburg, P., DNA 4:165-170 (1985). 10. Corbin, D.R. , Sauer, N. and Lamb, C.J. ,

Differential regulation of a hydroxyproline-rich glycoprotein gene family in wounded and infected plants. Mol. Cell. Biol. 7:4337-4344 (1987).

11. Cramer, C.L., Bell, J.N., Ryder, T.B. , Bailey, J.A. , Schuch, W. , Bolwell, G.P., Robbins, M.P., Dixon, R.A. and Lamb, C.J. , EMBO J. 4:285-289 (1985b) .

12. Cramer, C.L., Ryder, T.B. , Bell, J.N. and Lamb, C.J., Rapid switching of plant gene expression by fungal elicitor. Science 227:1240-1243 (1985a).

13. Cramer, C.L., Edwards, K. , Dron, M. , Liang, X., Dildine, S.L. , Bolwell, G.P., Dixon, R.A. , Lamb,

C.J. , and Schuch, W. , Phenylalanine Amonia-lysase Gene Orientation and Structure. In Press. Plant Molec. Biol. (1989) .

14. Dangl, J.L., Hauffe, K.D. , Lipphardt, S., Hahlbrock, K. and Scheel, D., EMBO J. 6:2551-2556

(1987) .

15. Darvill , A. and Albersheim, P. , Annu. Rev. Plant Physiol. 35 : 243-275 (1984) .

16. Davis , K.R. , Darvill, A. G. and Albersheim, P. , Plant Mol. Biol. 6 : 23-32 (1986) .

17. Davis , K.R. and Hahlbrock, K. , Plant Physiol. 85 : 1286-1290 (1987 ) .

18 . Dekok, L.J . and Oosterhuis , F. A. , Effects of frost hardening and salinity on glutathione and sulfhydryl levels in spinach leaves . Physiol. Plant. 58 : 47- 51 ( 1983 ) . 19. Dixon, R.A. , Dey, P.M. and Lamb, C. J. , Adv. Enzymol.

Relat. Areas Mol. Biol. 55:1-135 (1983).

20. Dixon, R.A., Bailey, J.A. , Bell, J.N., Bolwell, G.P., Cramer, C.L., Edwards, K. , Hamdan, M.A.M.S., Lamb, C.J. , Robbins, M.P., Ryder, T.B. and Schuch, W. , Phil. Trans. R. Soc. London B. 314:411-426 (1986) .

21. Douglas, C. , Hoffman, H. , Schultz, W. , and Hahlbrock, K. , Structure and elicitor or u.v.- light-stimulated expression of two 4- coumarate:CoA ligase genes in parsley. EMBO J. 6(5) :1189-1195 (1987).

22. Dron, M. , Clouse, S.D., Dixon, R.A. , Lawton,

M.A. , and Lamb, C.J. , Elicitor Regulation of a Plant Defense Gene Promoter in Electroporated Protoplasts, Proc. Natl. Acad. Sci. USA 85:6738-6742 (1988) . (Portions of this manuscript are included herein as Experimental Section II.)

23. Ebel, J., Annu. Rev. Phytopathol. 24:235-264 (1986).

24. Edwards, K. , Cramer, C.L., Bolwell, G.P., Dixon,

R.A. , Schuch, W. and Lamb, C.J., Rapid transient inducti.on of phenylalani.ne ammonia-lyase mRNA in elicitor-treated bean cells. Proc. Natl. Acad. Sci. USA

82:6731-6735 (1985).

25. Edwards, R. and Owen, W.J., Comparison of glutathione-S-transferases of Zea mays responsible for herbicide detoxification in plants and suspension-cultured cells. Planta 169:208-215 (1986).

26. Fromm, M.E. , Taylor, L.P. and Walbot, V. , Proc. Nail. Acad. Sci. USA 82:5824-5828 (1985) . 27. Garrels, J.I., Two-dimensional gel electrophoresis and computer analysis of proteins synthesized by clonal cell lines. J. Biol. Chem. 254:7961-7977 (1979).

28. Grab, D. , Loyal, R. and Ebel, J. , Arch. Biochem.

Biophys. 243:523-529 (1985).

29. Grill, E., Winnacker, I.-L. and Zenk, M.H. , Phytochelatins : The principle heavy-metal complexing peptides of higher plants. Science 230:674-676 (1985).

30. Gustine, D.L., Induction of medicarpin biosynthesis in Ladino clover callus by p- chloromercuribenzoic acid is reversed by dithiothreitol. Plant Physiol. 84:3-6 (1987).

31. Hahlbrock, K. and Grisebach, H. , Annu. Rev. Plant Physiol. 30:105-130 (1979).

32. Hahlbrock, K. , Knobloch, K.-H., Kreuzaler, F. ,

Potts, J.R.M. , and Wellmann, E., Eur. J. Biochem. 61:199- 206 (1976) .

33. Hedrick, S.A. , Bell, J.N., Boiler, T. and Lamb, C.J., Plant Physiol. 86:182-186 (1988).

34. Henikoff, S., Gene 28:351-359 (1984).

35. Horsch, R. , B. , Fry, J.E., Hoffmann, N.L., Eicotz, D. , Rogers ,S.G., and Fraley, R. T. , Science 227:1229-1231 (1985).

36. Lamb, C.J. , Bell, J.N. , Corbin, D.R. , Lawton, M.A. , Mehdy, M.C., Ryder, T.B., Sauer, N. , and Walter, M.H. , "Activation of defense genes in response to elicitor and infection" in Molecular Strategies for Crop Protection, C. Arntzen and C.A. Ryan, ed. , Alan R. Liss, New York 1987, at p.49.

37. Lawton, M.A. , Dixon, R.A. , Hahlbrock, K. and Lamb, C.J., Transcriptional activation of plant defense genes by fungal infection, wounding and infection. Eur. J. Biochem. 130:131-139 (1983).

38. Lawton, M.A. and Lamb, C.J., Mol. Cell. Biol.

7:335-341 (1987).

39. Lawton, M.A. , Kragh, K. , Jenkins, S.M., Dron, M. , Clouse, S.D., Dixon, R.A. , and Lamb, C. J. , J. Cell. Biochem. Supplement 12C Abstract #L707.

40. Malbon, C.C., George, S.T., Moxham, C.P., Intramolecular disulfide bridges: avenues to receptor activation. Trends Biochem. Sci. 137:172-175 (1987) .

41. McMaster, G.K. and Carmichael, G.G., Analysis of single- and double-stranded nucleic acids on polyacrylamide and agarose gels using glyoxal and acridine orange. Proc. Natl. Acad. Sci. USA 74:4835-4839 (1977) .

42. Meister, A. and Anderson, M.E., Glutathione. Annu.

Rev. Biochem. 52:711-760 (1983).

43. Mieth, H. , Speth, V. and Ebel, J., Z. Naturforsch. 41c:193-201 (1986).

4 _# Moesta, P. and Grisebach, H. , Effects of biotic and abiotic elicitors on phytoalexin metabolism in soybean. Nature 286:710-711 (1980).

45. Nieto-Sotelo, J and Ho, Th.-D., Effect of heat shock on the metabolism of glutathione in maize roots. Plant Physiol. 82:1031-1035 (1986) . 46. Norman, P.M., Wingate, V.P.M. , Fitter, M.S. and

Lamb, C.J., Planta 167:452-459 (1986).

47. Ow, D.W. , Wood, K.V. , Deluca, M. , deWet, J.R. , ₅ Helinski, D.D. and Howell, S.H. , Science

234:886-859 (1986).

48. Price, C . , A new thiol in legumes. Nature 180:148-149 (1957).

10 49. Rennenberg, H. , Glutathione metabolism and possible biological roles in higher plants. Phytochemistry 21:2771-2781 (1982).

50. Rhodes, CA. , Pierce, D.A. , Mettler, I.J., , ,- Mascarenhas,D. , and Detmer, J.J. , Genetically

Transformed Maize Plants from Protoplasts. Science 240:204-207 (1988).

51. Ryder, T.B., Cramer, C.L., Bell, J.N. , Robbins, M.P., Dixon, R.A. and Lamb, C.J. , Elicitor

20 rapidly induces chalcone synthase mRNA in Phaseolus vulgaris cells at the onset of the phytoalexin defense response. Proc. Natl. Acad. Sci. USA 81:5724-5728 (1984).

25 52. Ryder, T.B., Hedrick, S.A., Bell, J.N., Liang, X., Clouse, S.D. and Lamb, C.J., Mol. Gen. Genet. 210:219-233 (1987).

53. Sanger, F. , Nicklen, S. and Coulsen, A.R. , Proc.

30 Natl. Acad. Sci. USA 74:5463-5467 (1977).

54. Sharp, J.K. , McNeil, M. , Albersheim, P., J. Biol. Chem. 250:11321-11336 (1984).

55. Siler-Tuyns, A. and Birnstiel, M.L. , J. Mol. Biol. 35 151:607-625 (1981). 56. Smith, I.K., Sulfate transport in cultured tobacco cells. Plant Physiol. 55:303-307 (1975).

57. Smith, I.K., Kendall, A.C, Keys, A. J. , Turner, J.C. and Lea, P. J. , The regulation of the biosynthesis of glutathione in leaves of barley (Hordeum vulgare L. ) . Plant Sci. 41:11-17 (1985) .

58. Sommsich, I., Schmelzer, E., Bollmann, J. and Hahlbrock, K. , Proc. Natl. Acad. Sci. USA 83:2427-2430 (1986).

59. Stossel, P., Regulation by sulfhydryl groups of glyceollin accumulation in soybean hypocotyls. Planta 160:314-319 (1984).

60. Thomas, P. A. , Hybridization of denatured RNA and small DNA fragments transferred to nitrocellulose. Proc. Nail. Acad. Sci. USA 77:5201-5205 (1980) .

61. Walker, J.C, Howard, E.A. , Dennis, E.S. and Peacock, W. J. , Proc. Natl. Acad. Sci. USA 84:6624-6628 (1987) .

62. Whitehead, I.M., Dey, P.M., and Dixon, R.A., Planta 154:156-164 (1982).

63. Wingate, V.P.M., Lawton, M.A. and Lamb, C.J., Plant Physiol. 87:206-210 (1988). (Portions of this reference are disclosed herein as Experimental Section I. )

PATENTS

1. Simpson, R.B., and Margossian, L. , United States Patent 4,658,082 issued April 14, 1987 for "A Method for Producing Intact Plants Containing Foreign DNA". SPECIFICATION SUMMARY From the foregoing description one of ordinary skill in the art can see that the presen -invention discloses a novel screening method for identifying agrichemical compounds that may be useful for inducing transcription of trait-specific plant genes. In addi¬ tion, the invention discloses a method for identifying trait-specific nucleic acid sequences from plants that respond to agrichemicals by regulating gene transcription. Furthermore, the invention discloses regulatory elements that control selective induction of plant defense gene. Such elements can be used, for example, to construct transgenic plants that can be induced to exhibit plant defense responses when treated with specific agrichemicals that affect gene transcription.

Without departing from the spirit and scope of this invention, one of ordinary skill can make various changes and modifications to the invention to adapt it to various usages and conditions. As such, these changes and modifications are properly, equitably, and intended to be, within the full range of equivalence of the following claims.

Claims

WHAT IS CLAIMED IS:

1. A screening method for identifying plant gene regulatory elements that respond to stimuli and affect transcription of structural genes operatively linked thereto, said method comprising: (A) isolating RNA from first plant material presently exhibiting a trait of interest and RNA from second plant material not presently exhibiting the trait of interest; (B) translating in vitro the RNAs from step (A) ; (C) identifying from a comparison of the in vitro translation products produced in step (B) a candidate gene product expressed or repressed under the desired trait-specific conditions; (D) constructing a cDNA library from the RNA that generated the candidate gene product identified in step (C) ; (E) separately screening the cDNA library from step (D) in a "plus-minus" fashion using RNA from at least a time when gene expression is on or increased ("plus" RNA) and at least a time when gene expression is off or decreased ("minus" RNA) ; (F) identifying cDNAs that correspond to the candidate gene product of (C) by identifying clones that hybridize to the "plus" RNA probe and not to the "minus" RNA probe; (G) characterizing the clones identified in step (F) to identify ones that encode a protein having the characteristics of the candidate gene product identified in step (C) ; (H) using the cDNA clone(s) identified in step (F) as a probe to screen a genomic library of plant DNA to identify gene regulatory element(s) associated with the gene that hybridizes with the cDNA probe.

2. A screening method according to Claim 1(A) wherein the trait of interest is selected from the group consisting of rooting and plant propagation, germination and dormancy, flowering, gamete production, abscission, fruit set and development, plant and organ size, production of axillary buds, self-pruning, formation of shape, tillering, resistance to and control of insects and diseases, overcoming environmental stress, uptake of minerals, plant composition, metabolic effects including ripening and yield increases, modification of sexual expression, senescence, dessication, protection against herbicide damage, and increase of herbicide absorption and translocation.

3. A screening method according to Claim 1(C) wherein the candidate gene products are identified with one and two dimensional electrophoretic gel analyses.

4. A screening method according to Claim 1(H) wherein the gene regulatory element(s) are further characterized by restriction digest analysis.

5. A screening method according to Claim 4 wherein the gene regulatory element(s) are further characterized by sequencing.

6. A screening assay for identifying substances that may be used exogenously to activate or deactivate trait-specific plant gene regulatory elements, thus causing expression or repression of native or chimeric structural genes that are operatively linked thereto, said method comprising: (A) introducing into suitable plant material from plant (P) , a chimeric gene cassette comprised of: (a) at least one trait- specific promoter, wherein said promoter(s) is operatively linked to, (b) at least one reporter gene, and (c) at least one 3' terminator sequence; (B) contacting the suitable plant material from step (A) , which contains said chimeric gene cassettes, with substances that may be capable of influencing transcription of trait-specific plant genes; (C) monitoring said plant material from step (B) for expression of said reporter gene sequence(s) ; (D) concluding: (a) that substances that increase expression of the reporter gene(s) may be used exogenously to activate trait-specific plant gene regulatory elements and (b) that substances that decrease expression of the

5 reporter gene(s) may be used exogenously to deactivate trait-specific plant gene regulatory element(s) .

7. A screening method for identifying sub¬ stances that may be used exogenously to activate or

₁₀ deactivate transcription of stress-regulated plant defense genes, said method comprising: (A) introducing into suitable plant material from a suitable plant (P) , a stress-regulated promoter/reporter gene/terminator cassette comprised of: (a) at least one stress-

₁₅ regulated promoter wherein said promoter(s) is operatively linked to, (b) at least one reporter gene, and (c) at least one 3' terminator sequence; (B) contacting the plant material from step (A) , which contains said chimeric stress-regulated cassettes, in

_2Q the presence of substances that may be capable of influencing transcription of stress-regulated plant defense genes; (C) monitoring said plant material from step (B) for expression of said reporter gene sequence(s) (D) concluding: (a) that substances that

„, increase expression of the reporter gene(s) may be used exogenously to activate stress regulated plant gene regulatory elements and (b) that substances that decrease expression of the reporter gene(s) may be used exogenously to deactivate stress regulated plant gene 0 regulatory element(s) .

8. A method according to any of Claims 6(A) and 7(A) wherein said suitable plant material is plant protoplasts, plant cells, plant callus, plant tissues, developing plantlets, immature whole plants and mature 5 whole plants. 9. A method according to any of Claims 6(A) (a) and 7(A) (a) wherein said promoter is selected from the group consisting of promoters that encode phenylalanine ammonia-lyase (PAL) , chalcone synthase (CHS), 4-coumarate:CoA ligase (4CL) , plus promoters for the plant genes that encode the cell wall hydroxyproline-rich glycoproteins.

10. A screening method for identifying sub¬ stances that may be used exogenously to activate or deactivate stress-regulated plant defense gene regulatory element(s) , said method comprising: (A) introducing into suitable plant material from plant (P) , a stress-regulated promoter/reporter gene/terminator cassette comprised of: (a) at least one stress regulated promoter selected from the group consisting of promoters that encode phenylalanine ammonia-lyase (PAL) , chalcone synthase (CHS), 4-coumarate:CoA ligase (4CL) , plus promoters for the plant genes that encode the cell wall hydroxyproline-rich glycoproteins; wherein said promoter(s) is operatively linked to (b) at least one reporter gene, and (c) at least one 3' terminator sequence; (B) contacting the suitable plant material from step (A) , which contains said chimeric stress- regulated gene promoter/reporter gene/3'terminator cassette, with substances that may be capable of influencing transcription of stress-regulated plant defense genes; (C) monitoring said plant material from step (B) for expression of the reporter gene sequence(s) ; (D) concluding: (a) that substances that increase expression of the reporter gene(s) may be used exogenously to activate stress regulated plant gene regulatory elements and (b) that substances that decrease expression of the reporter gene(s) may be used exogenously to deactivate stress regulated plant gene regulatory elemen (s) . 11. A method according to any of Claims

6(A)(b), 7(A) (b) and 10(A) (b) wherein said reporter gene(ε) is selected from the group consisting of chloramphenicol acetyltransferase (CAT) , J-galactosidase (lacZ) , beta glucuronidase (GUS) , and firefly luciferase.

12. A method according to any of Claims 6(A) (c), 7(A) (c) and 10(A) (c) wherein said 3' terminator(s) iε selected from the group conεisting of the 3' flanking region of the nopaline synthase gene (NOS) and the 3* flanking region of the octopine synthase (OCS) gene.

13. A method according to any of Claims 6(A) (a) and 7(A) (a) wherein said promoter is the chalcone synthase (CHS) gene promoter.

14. A method according to any of Claims 6(A) (a) and 7(A) (a) wherein said promoter iε the phenylalanine a monia-lyaεe (PAL) gene promoter.