EP0414809A1 - Plant defense gene regulatory elements - Google Patents

Abstract

Regulatory elements of plant defense genes which can be "activated", induced or activated by exogenous stimulators.

Description

PLANT DEFENSE GENE REGULATORY ELEMENTS FIELD OF THE INVENTION The present invention relates generally to plant defense mechanisms. More particularly, the invention relates to regulatory elements that control selective induction of plant defense genes. In addition, the invention relates to a novel method for identifying compounds that may be useful for inducing transcription of stress-regulated plant defense genes. BACKGROUND OF THE INVENTION

Plants exhibit a number of adaptive and protective responses to environmental stresses. Of particular significance in this respect is the plant's ability to convert the amino acid phenylalanine into a number of protective phenylpropanoid products, including isoflavonoid and coumarin phytoalexin antibiotics, flavonoid pigments, and the cell wall polymer lignin (Hahlbrock and Grisebach (1979), Dixon, et al., (1983)). The synthesis of these products by specific branch pathways which diverge from the central phenylpropanoid pathway is selectively modulated during development and by environmental stimuli. For example, u.v. and white light stimulate the production of protective u.v. -absorbing flavonoids (Hahlbrock, et al., (1976)) whereas infection induces phytoalexin synthesis (Whitehead, et al., (1982)).

Recent plant molecular biological studies have shown that disease resistance is an active process, dependent on plant host RNA and protein synthesis. Such studies have also shown that an actual pathogen attack or an "attack" by glycan elicitor preparations, obtained from fungal cell walls, causes massive changes in the pattern of plant host RNA synthesis, including transcriptional activation of plant defense genes en coding the lytic enzymes chitinase and glucanase, cell wall hydroxyproline-rich glycoproteins, and enzymes involved in the synthesis of lignin and phytoalexins (Cramer, et al., (1985a); Lamb, et al., (1987); Lawton and Lamb (1987)). Accumulation of defense gene transcripts leads to marked stimulation of the synthesis of the encoded proteins and expression of the corresponding defense responses.

Analysis of the molecular events underlying a plant's defense mechanisms will make it possible for plant biologists to design rational strategies for biotechnological enhancement of plant's own defense systems. For example, it is now possible to envision genetically engineered plants in which the defense genes can be pre-activated in response to developmental or environmental signals. While pre-activation of these genes would place an additional energy burden on the plant, the burden could be minimized by engineering the plant so that expression of these genes only occurs in specific organs or tissues, such as the epidermis, or only at specific developmental states under circumstances where the plant is particularly vulnerable to disease.

An alternative approach is to find environmentally safe substances that could be used to pre-activate defense genes, thereby "inducing" a state of plant "immunity" prior to an initial stress or infection. Such an approach would not place an undesirably large energy burden on the modified plant. In addition, since environmentally safe substances could be used to stimulate the plant's own "immunity" mechanisms, this approach would also aid in eliminating our current reliance on harmful pesticide chemicals. The present invention is based on several discoveries made regarding activation of plant defense genes. The first discovery is that the reduced form of glutathione (GSH), a small, water-soluble, non-toxic cellular metabolite, stimulates transcription of certain defense genes, including those that encode cell wall hydroxyproline-rich glycoproteins and the phenylpropanoid biosynthetic enzymes phenylalanine ammonia-lyase (PAL) and chalcone synthase (CHS). It has been found that transcriptional activation of these genes leads to marked transient accumulation of the corresponding transcripts, contributing to a massive change in the overall pattern of protein synthesis which closely resembles the change observed in response to fungal elicitor. In addition, it has been discovered that specific nucleotide sequences immediately upstream of the defense gene coding regions are able to confer regulation by substances such as glutathione and fungal elicitor. These specific promoter regions, which can be "turned on" by fungal elicitors and simple chemical substances like GSH, are extremely useful for engineering plants that have enhanced resistance to pathogens and environmental stresses. As shown in the method portion of the invention, these promoter regions are also useful in identifying environmentally safe substances that can be used to pre-activate a plant's own defense mechanisms.

BRIEF DESCRIPTION OF THE DRAWINGS The following is a brief description of the drawings. More detailed descriptions are found in the two Experimental Sections of this specification. The drawings comprise eleven Figures, of which: Experimental Section I Drawings Figure l is a photograph illustrating accumulation of plant defense gene transcripts in response to GSH. Figure 2 (A and B) shows two graphs that illustrate the kinetics for induction of (A) PAL and CHS transcripts and (B) PAL enzyme activity in response to GSH.

Figure 3 is a photograph illustrating dose response for induction of plant defense gene transcripts by GSH.

Figure 4 is a photograph illustrating the effect of GSH on the transcription of plant defense genes. Figure 5 (A, B, C and D) is a photograph illustrating the effect of GSH on the pattern of protein synthesis in plants.

Figure 6 is a graph illustrating the induction of PAL activity by GSSG. Experimental Section II Drawings

Figure 7 (A and B) is composed of two drawings: (A) Shows the structure of the CHS-CAT-NOS construct and deletion mutants. (B) Shows the nucleotide sequence of the CHS 15 promoter and CAT fusion junction.

Figure 8 (A, B, C, and D) is a photograph that illustrates expression of the chimeric CHS-CAT-NOS gene electroporated into protoplasts derived from suspension cultured cells of soybean. Figure 9 is a photograph that illustrates the correlation between the accumulation of CAT transcripts and CAT activity in electroporated protoplasts containing the CHS-CAT-NOS gene.

Figure 10 is a graph illustrating glutathione induction of CHS-CAT-NOS relative to basal levels of expression as a function of the amount of the chimeric construct electroporated.

Figure 11 shows thin layer chromatography analysis and a graph which illustrate the effect of 5' deletions on glutathione regulation of the CHS-CAT-NOS gene electroporated into soybean protoplasts.

DEFINITIONS In the present specification and claims, reference will be made to phrases and terms of art which are expressly defined for use herein as follows:

As used herein, the Greek letter gamma is written as "g".

As used herein, glutathione refers to g-L-glutamyl-L-cysteinyl-glycine.

As used herein, peptide analogs of glutathione are substances having the formula g-L-glutamyl-L-cysteinyl-X where X is an amino acid other than glycine. As used herein, homoglutathione refers to g-L-glutamyl-L-cysteinyl-ß-alanine.

As used herein, GSH refers to the reduced form of glutathione.

As used herein, GSSG refers to the oxidized form of glutathione. As used herein, PAL refers to phenylalanine ammonia-lyase. PAL catalyzes the conversion of the amino acid L-phenylalanine to trans-cinnamic acid and NH₄ ⁺. This is the first reaction in the synthesis of a wide range of plant natural products based on the phenylpropane skeleton, including lignins, flavonoids, isoflavonoid, coumarins and hydroxycinnamic acid esters.

As used herein, CHS refers to chalcone synthase. CHS catalyzes the condensation of 4-coumaroyl-CoA with three acetate units from malonyl-CoA to yield naringenin chalcone. This reaction is the first step in a branch of phenylpropanoid metabolism specific for the synthesis of isoflavonoid phytoalexin antibiotics in legumes, and flavonoid pigments which are ubiquitous in higher plants (Dixon, et al., (1983) and Hahlbrock, et al., (1979)).

As used herein, 4CL refers to 4-coumarate:CoA ligase. 4CL synthesizes the thiol esters that are central intermediates in the synthesis of many phenylpropanoid compounds in higher plants (Douglas, et al., (1987)).

As used herein, HRGP refers to hydroxyprolinerich glycoproteins.

As used herein, elicitor substances are compounds that can "turn on", induce or otherwise activate stress-regulated promoters such as the promoters for the plant genes that encode the phenylpropanoid biosynthetic enzymes phenylalanine ammonia-lyase (PAL), chalcone synthase (CHS), and 4-coumarate:CoA ligase (4CL), plus promoters for the plant genes that encode the cell wall hydroxyproline-rich glycoproteins. Elicitor substances of the invention include, but are not limited to, the reduced form of glutathione; the reduced form of homoglutathione and the reduced form of other peptide analogs of glutathione; glycan elicitors such as hexa(ß- D-glucopyranosyl)-D-glucitols (Sharp, et al., (1984)); lipid elicitors such as arachidonic acid and eicosapentaenoic acid, glycoprotein elicitors, fungal elicitors, and abiotic elicitors such as mercuric chloride HGCl₂.

As used herein, fungal elicitor refers to the high molecular weight material heat-released from mycelial cell walls of the bean fungal pathogen Colletotrichum lindemuthianum (Lawton, et al., (1983)). As used herein, CAT refers to chloramphenicol acetyltransferase.

As used herein, NOS refers to nopaline synthase. As used herein, GUS refers to beta glucuronidase.

As used herein, CGC means a chimeric gene cassette. The phrases "promoter/reporter gene/terminator", "chimeric defense gene promoter/reporter gene/3'terminator",

"promoter/structural gene capable of being expressed in plant material/terminator", and the like, refer to chimeric gene cassettes of the invention and are used interchangeably with the phrase "chimeric gene cassette".

As used herein, transcription refers to synthesis of RNA on a DNA template.

As used herein, promoter refers to a region of DNA involved in binding of RNA polymerase and other factors that initiate or modulate transcription.

As used herein, transcription start site refers to the position on DNA corresponding to the first base incorporated into RNA. In the DNA sequences shown in the Figures, the transcription start site is designated as +1.

As used herein, the TATA box refers to a conserved A-T rich septamer found about 25 base pairs upstream of the transcription start site of each eukaryotic RNA polymerase II transcription unit; the TATA box is believed to be involved in positioning the

RNA polymerase enzyme for correct initiation of transcription.

As used herein, terminator or 3' terminator refer to DNA sequences, represented at the 3' end of a gene or transcript, that instruct the RNA polymerase to terminate transcription. Examples of terminators include, but are not limited to, the 3' flanking region of the nopaline synthase (NOS) gene and the 3' flanking region of the octopine synthase (OCS) gene.

As used herein, "mho" refers to a standard unit of conductivity.

As used herein, suitable plant material means and expressly includes, plant protoplasts, plant cells, plant callus, plant tissues, developing plantlets and immature and mature whole plants.

As used herein, a plant protoplast is a single plant cell that does not have a plant cell wall.

As used herein, plant callus refers to an undiffentiated mass of plant cells.

Use of the phrase "substantial sequence homology" in the present specification and claims means that DNA, RNA, or amino acid sequences which have slight and non-consequential sequence variation(s) from the actual sequences disclosed and claimed herein are considered to be equivalent to the sequences of the present invention, and as such are within the scope of the appended claims. In this regard, "slight and nonconsequential sequence variation(s) (i.e., the sequences that have substantial sequence homology with the DNA,

RNA, or proteins disclosed herein) will be functionally equivalent to the sequences disclosed and claimed in the present invention. Functionally equivalent sequences will function in substantially the same manner to produce substantially the same compositions as the nucleic acid and amino acid compositions disclosed and claimed herein.

Use of the phrase "substantially pure" in the present specification and claims, as a modifier of DNA or RNA, means that the DNA or RNA has been separated from its in vivo cellular environment through human efforts, and as a result of this separation, the substantially pure DNA or RNA is useful in ways that the non-separated, impure DNA or RNA is not.

As used herein, operatively linked means that the respective DNA sequences (represented by the terms promoter and reporter gene or structural gene and terminator) are operational, i.e., work for their intended purposes. Stated another way, operatively linked means that after the respective segments are joined, upon appropriate activation of the promoter, the reporter or structural gene will be expressed.

As used herein, plant material engineered with human effort refers to plant material created by scientists who use the techniques of modern genetic engineering rather than traditional plant breeding techniques to generate new strains; engineered plant material does not exist "in nature", and therefore is not a product of nature.

As used herein, an elicitor-regulated activator domain refers to a first nucleotide sequence region on promoters from stress-regulated plant genes such as PAL, CHS, 4CL, and the plant genes that encode the cell wall hydroxyproline-rich glycoproteins. As defined by functional analysis, this elicitor-regulated activator domain or region confers on the promoter the property of being activated when protoplasts, plant cells, or plants that carry the promoter are treated with elicitors such as reduced glutathione, reduced homoglutathione, reduced peptide analogs of glutathione, fungal elicitor preparations, etc. In the CHS promoter, the activator region extends from nucleotides -29 to -173; this region has substantial sequence homology to analogous activator regions in the promoters of co-ordinately regulated genes such as PAL and 4CL.

As used herein, the upstream silencer domain refers to a second nucleotide sequence region on promoters from stress-regulated plant genes such as PAL, CHS, 4CL, and the plant genes that encode the cell wall hydroxyproline-rich glycoproteins. As defined by functional analysis, this silencer domain represses the activity of these promoters to the extent that, when the domain is removed and activity is analyzed by functional assays, elicitor induced expression (mediated by the remaining portions of the promoter) is enhanced several fold. The silencer domain is known to contain binding site(s) for a repressor factor. In the CHS promoter, the silencer domain or region extends from nucleotides - 173 to -326; this region has substantial sequence homology to analogous silencer regions in the promoters of co-ordinately regulated genes such as PAL and 4CL.

The amino acids which make up the various amino acid sequences appearing herein may be identified according to the following three-letter or one-letter abbreviations:

3 Letter 1 Letter

Amino Acid Abbreviation Abbreviation

L-Alanine Ala A

L-Arginine Arg R

L-Asparagine Asn N

L-Aspartic Acid Asp D

L-Cysteine Cys C

L-Glutamine Gin Q

L-Glutamic Acid Glu E

L-Histidine His H

L-Isoleucine lie I

L-Leucine Leu L

L-Lysine Lys K

L-Methionine Met M

L-Phenylalanine Phe F

L-Proline Pro P

L-Serine Ser S

L-Threonine Thr T

L-Tryptophan Trp w

L-Tyrosine Tyr Y

L-Valine Val V

The nucleotides which comprise the various nucleotide sequences appearing herein have their usual single-letter designations (A, G, T, C or U) used routinely in the art.

INVENTION SUMMARY

The present invention discloses plant defense gene promoters that can be "turned on", induced or otherwise activated by exogenous elicitors. The invention also discloses a screening assay useful for identifying substances that can be used exogenously to activate stress-regulated plant defense gene promoters, thus causing expression of native or chimeric genes that are operatively linked thereto. DESCRIPTION OF THE INVENTION In one aspect, the present invention comprises substantially pure plant defense gene promoters that direct stress-regulated expression of target genes when chimeric gene fusions are introduced into plant cells. Such promoters include, but are not limited to, promoters for the plant genes that encode the phenylpropanoid biosynthetic enzymes phenylalanine ammonia-lyase (PAL), chalcone synthase (CHS), and 4-coumarate:CoA ligase (4CL), plus promoters for the plant genes that encode the cell wall hydroxyproline-rich glycoproteins.

In another aspect, the present invention comprises substantially pure functional domains of stressregulated plant promoters, which domains include, but are not limited to, functional domains from promoters for the plant genes that encode the phenylpropanoid biosynthetic enzymes phenylalanine ammonia-lyase (PAL), chalcone synthase (CHS), and 4-coumarate:CoA ligase (4CL), plus promoters for the plant genes that encode the cell wall hydroxyproline-rich glycoproteins. Such substantially pure functional domains include: (1) an elicitor-regulated activator, located in the CHS promoter between the TATA box and nucleotide position - 173; and (2) an upstream silencer, located in the CHS promoter between nucleotides found at positions -173 and -326. (Nucleotide positions refer to those shown in Figure 7.) There is substantial sequence homology between elements within these functional domains within the CHS promoter and the promoters for the co-ordinately regulated genes PAL and 4CL; in addition, the substantially homologous domains in the PAL and 4CL promoters are organized in similar relative dispositions as those in the CHS promoter. For example, the PAL and CHS promoters have approximately 70% homology in the silencer region, while the CHS and 4CL promoters have 70% homology on 68 base pairs just upstream of the TATA box (the activator domain), and PAL and 4CL have more than 60% homology in this same region. See Edwards, et al., (1985) and Cramer, et al., (1989, In Press).

In another aspect, the present invention comprises two substantially pure sequences shown in Figure 7 as nucleotide sequences (-242 to -194) and (-74 to -52) in the 5' flanking region of the CHS promoter. The two sequence elements are:

(1):

(-242) ACCAATTATTGGTTACTAAATTTAACAGTGAATGAATGAATGAGTTATA (-194 and (2) : (-74)CACGTGATACTCACCTACCCTAC(-52).

In another aspect, the present invention comprises chimeric plaεmids selected from the group consisting of pCHC1 and pCHC2.

In another aspect, the present invention comprises a chimeric gene cassette (CGC) comprising: (a) at least one promoter selected from the group consisting of promoters for the plant genes that encode the phenylpropanoid biosynthetic enzymes phenylalanine ammonia-lyase (PAL), chalcone synthase (CHS), and 4-coumarate:CoA ligase (4CL), plus promoters for the plant genes that encode the cell wall hydroxyproline-rich glycoproteins, wherein the promoter is operatively linked to: (b) at least one reporter gene, and (c) at least one terminator sequence. In this aspect of the invention, useful reporter genes include, but are not limited to, chloramphenicol acetyltransferase (CAT) and beta glucuronidase (GUS); useful terminator sequences include, but are not limited to, the 3' flanking region of the NOS gene and the 3' flanking region of the OCS gene.

Several straightforward techniques are now available for inserting new genetic material into plants. As a result, the chimeric gene cassettes of the present invention will be extremely useful to those wishing to engineer new plant strains that have enhanced defense capabilities. For example, modified versions of the natural gene vector system of Acrrobacterium tumefaciens have been used successfully to create a number of engineered dicotyledonous plants, including tobacco, potato, carrot, flax, eggplant, tomato, chili pepper, sunflower and rapeseed (cabbage). Such methods can be used by those skilled in the art of plant genetic engineering, without undue experimentation, to create new plant strains that contain, as part of their genetic make-up, the chimeric gene cassettes of the present invention. Alternatively, those skilled in the art can use methods such as the leaf disk transformation procedure disclosed in Horsch, et al., (1985) to create transgenic plants, or the method of Rhodes, et al., that was used recently to transform the monocotyledonous plant, maize (Rhodes, et al., (1988)). (The leaf desk transformation procedure has been used successfully to engineer soybean protoplasts and transgenic tobacco plants that contain the chimeric gene cassettes of the present invention.)

In another aspect, the present invention comprises use of exogenous elicitor substances to activate plant defense genes. Exogenous elicitor substances useful for this purpose include, but are not limited to, the reduced form of glutathione; the reduced form of homoglutathione, and the reduced form of other peptide analogs of glutathione; glycan elicitors such as hexa(ß- D-glucopyranosyl)-D-glucitols, lipid elicitors such as arachidonic acid, glycoprotein elicitors, fungal elicitors, and abiotic elicitors such as mercuric chloride HGCl₂. Plant defense genes that can be induced by exogenous substances include, but are not limited to, plant defense genes that encode the phenylpropanoid biosynthetic enzymes phenylalanine ammonia-lyase (PAL), chalcone synthase (CHS), and 4-coumarate:CoA ligase (4CL), plus the plant genes that encode the cell wall hydroxyproline-rich glycoproteins.

Various other aspects of the present invention are further explained and exemplified in the two experimental sections that follow. Experimental Section I relates to the discovery that the reduced form of glutathione (GSH), when supplied to suspension cultured cells of bean (Phaseolus vulgaris L.) at concentrations in the range 0.01 mM to 1.0 mM, stimulates transcription of defense genes including those that encode the phenylpropanoid biosynthetic enzymes phenylalanine ammonia-lyase (PAL), chalcone synthase (CHS), involved in lignin (PAL) and phytoalexin (PAL, CHS) production, plus those that encode the cell wall hydroxyproline-rich glycoproteins. Transcriptional activation of these genes leads to marked accumulation of the corresponding transcripts, contributing to a massive change in the overall pattern of protein synthesis, which change closely resembles that previously observed in response to fungal elicitor. GSH causes a marked increase in extractable PAL activity, whereas the oxidized form of glutathione, the separate constituent amino acids of glutathione (glutamate, cysteine and glycine), and strong SH reducing reagents such as cysteine, ascorbic acid and mercaptoethanol are inactive. While the effects of exogenous GSH on the activation of defense genes and accumulation of the corresponding transcripts qualitatively resemble those previously observed following treatment with fungal elicitor, a particularly striking feature of the present invention is the massive quantitative effect of GSH. For example, induction of PAL and CHS transcripts is several fold greater and also more prolonged than with optimal concentrations of fungal elicitor. Moreover, PAL enzyme activities of about 200 μkat/kg protein obtained following GSH treatment are the highest that have been observed in cell suspension cultures or other induction systems (Lawton, et al., (1983)).

As shown in Experimental Section I, the effects of GSH are specific both in terms of the selective effects on gene activation, transcript accumulation and protein synthesis. Moreover, the lack of effect by the oxidized form of glutathione, a mixture of glutamate, glycine and cysteine (the constituent amino acid monomers that make up glutathione), or other SH reagents (such as ascorbate, cysteine or dithiothreitol) is notable. In vivo, GSH is found at concentrations in the range of 0.05 to 1.5 mM (Bielawski, et al., (1986), Rennenberg (1982), Smith (1975) and Smith, et al., (1985)) and hence the effects on defense genes occur at physiological concentrations of GSH.

With regard to the utility of the present invention, the selective induction of plant defense genes by exogenous elicitors provides an excellent experimental system for analysis of the molecular mechanisms underlying defense gene activation. Moreover, as small, water-soluble, non-toxic cellular metabolites that strongly activate a specific set of plant genes, treatment with GSH and related elicitors will be useful for engineered regulation of chimeric transgenes driven by a responsive promoter. Experimental Section II relates to efforts to investigate the mechanisms underlying activation of plant defenses against microbial attach. As part of that effort, studies were carried out on elicitor regulation of a chimeric gene comprising the 5'-flanking region of a defense gene encoding the phytoalexin biosynthetic enzyme chalcone synthase fused to a bacterial chloramphenicol acetyltrausferase gene.

Glutathione or fungal elicitor caused a rapid, marked but transient expression of the chimeric gene electroporated into soybean protoplasts. The response closely resembled that of endogenous chalcone synthase genes in suspension cultured cells.

In addition, the data presented in Experimental Section II shows that the 429 bp nucleotide sequence immediately upstream of the CHS cssdLing region is sufficient to confer regulation by elicitor substances such as glutathione or fungal elicitor. Moreover, functional analysis of 5' deletions suggests that promoter activity is determined by: (1) an elicitor-regiilated activator located between the TATA box cind nucleotide position 173, and (2) an upstream silencer between -173 and -326. These cis-acting elements function in the transduction of the elicitation signal to initiate elaboration of an inducible defense response.

The responses of the chimeric CHS-CAT-NOS gene electroporated into protoplasts closely resemble that of endogenous chromosomal CHS genes in elicitor treated cell suspension cultures with respect to the kinetics of induction and the relative potency of glutathione and fungal elicitor as inducers. Hence the preferred protoplast system described herein provides a convenient functional assay for identifying exogenous substances that can be used to induce expression of plant defense genes, or pre-activate the plant's own defense mechanisms. In addition, the system will be useful for analyzing cis-acting nucleotide sequences involved in elicitor regulation of defense genes.

Without further elaboration, it is believed that one of ordinary skill in the art can, using the preceding description, and the following Experimental Sections, utilize the present invention to its fullest extent. The material disclosed in the experimental sections, unless otherwise indicated, is disclosed for illustrative purposes and therefore should not be construed as limiting the scope of the appended claims in any way.

EXPERIMENTAL SECTION I GLUTATHIONE CAUSES A MASSIVE AND SELECTIVE INDUCTION OF PLANT DEFENSE GENES Introduction Glutathione (g-L-glutamyl-L-cysteinyl-glycine) is a low molecular weight thiol implicated in a wide range of metabolic processes (Meister, et al., (1983)). Functions proposed for glutathione in higher plants include: storage and transport of reduced sulfur; protein reductant; destruction of H₂O₂ in chloroplasts and detoxification of xenobiotics including certain herbicides and pesticides (Edwards, et al., (1986) and Rennenberg (1982)). Overall, glutathione appears to play a key role in protection against oxidative damage arising from a number of stresses such as irradiation (Meister, et al., (1983)), heat (Nieto-Sotelo, et al. (1986)) and exposure to heavy metals (Grill, et al., (1985)).

Redox perturbations including generation of superoxide anions and lipid peroxidation appear to be a characteristic response to mechanical damage and microbial infection (Chai, et al., (1987)). Moreover, certain sulfhydryl reagents stimulate the production of phytoalexins and the activation of other defense responses associated with the expression of disease resistance (Gustine (1987) and Stossel (1984)). Taken together these observations suggested to us that glutathione may play a role in mediating the response of plant cells to biological as well as physical stresses. This example shows that treatment of suspension-cultured cells of bean (Phaseolus vulgaris L.) with GSH causes a massive and selective induction of the transcription of defense genes encoding enzymes of phytoalexin and lignin biosynthesis, as well as stimulation of genes encoding cell wall HRGPs. The effects of GSH on the pattern of gene expression and protein synthesis closely resemble the response to fungal elicitor. Experimental Section I Materials and Methods Fungal Cultures and Elicitor Preparation The source, maintenance and growth of cultures of Colletotrichum lindemuthianum were as described (Bailey, et al., 1971)). Elicitor, at a final concentration of 60 μg glucose equivalents/ml, was the high molecular weight fraction released by heat treatment of isolated mycelial cell walls (Lawton, et al., 1983)).

Plant Material French Bean (Phaseolus vulgaris L. cv Canadian Wonder) cell cultures were grown as previously described, except the cultures were maintained in total darkness (Lawton, et al., (1983)). Experiments were conducted with 7-to 10-day-old cell cultures, in which the growth medium exhibited a conductivity between 2.5 and 2.8 mho. This represents the period of maximum responsiveness to elicitor during the cell culture cycle (Edwards, et al., (1985).

Enzyme Extraction and Assay Extraction and assay of PAL were as previously described (Lawton, et al., (1983)). One unit of enzyme activity (1 kat) is defined as the amount of enzyme required for the formation of 1 mol of product in 1 sec under the assay conditions.

Extraction of RNA Total cellular RNA was isolated from samples homogenized directly in a phenol/0.1 M Tris-HCl emulsion, (pH 9.0), and purified as previously described (Lawton, et al., (1983)). RNA was assayed spectrophotometrically at 260 nm. The yield of RNA was 150 to 250 μg/g fresh weight of tissue and the A₂₆₀/A₂₈₀ ratio varied between 1.8 and 2.1.

In vitro Translation and Two-Dimensional Electrophoresis Total RNA was translated m. vitro in the presence of [³⁵S]methionine (Amersham) using a messagedependent rabbit reticulocyte lysate (Lawton, et al., (1983)). Translation products were fractionated by twodimensional gel electrophoresis (Garrels (1979)) with a pH range of 3.5 to 10 for isoelectric focusing in the first dimension, followed 10% gel SDS-PAGE electrophoresis. Radio-labeled polypeptides were visualized by fluorography (Bonner, et al., (1974)).

RNA blot hybridization Total RNA was denatured by glyoxal and fractionated by electrophoresis in a 1.2% agarose gel in 10 mM phosphate buffer (pH 7.0) (McMaster, et al., (1977)). Nitrocellulose blots (Thomas (1980)) were hybridized with [³²P]-labeled cDNA sequences prepared by nick translation of the inserts of pPAL5 (Edwards, et al., (1985)), pCHS5 (Ryder, et al., (1984)), pHyp2.13 and pHyp4.1 (Corbin, et al., (1987)). Following autoradiography, specific transcripts were quantitated by scanning densitometry. Several autoradiograms, exposed for different periods, were obtained for each blot to enable quantitation of each sample in the linear range of film response.

Nuclear Run-Off Transcription Isolation of nuclei and analysis of transcripts completed in vitro in the presence of [α-³²P]UTP was as previously described (Lawton, et al., (1987)). Immobilized sequences were PAL, cDNA pPAL5 (Edwards, et al., (1985)); CHS, cDNA CHS1 (Ryder, et al., (1984)); HRGP, equal amounts of cDNAs Hyp2.13 and Hyp4.1 (Corbin, et al., (1987)). H1 is a cDNA clone containing sequences from a constitutively transcribed gene that is unaffected by elicitor treatment. Changes in the rate of transcription of PAL, CHS and HRGP genes were measured by reference to the rate of HI transcription. Results

Transcript Accumulation PAL catalyzes the first reaction in the biosynthesis from L-phenylalanine of phenylpropanoid natural products including lignin and phytoalexins. CHS catalyzes the first reaction of a branch pathway of phenylpropanoid biosynthesis specific to the formation of flavonoid pigments and isoflavonoid phytoalexins. GSH caused a massive but transient, co-ordinate accumulation of PAL and CHS transcripts from low basal levels in suspension-cultured bean cells (Figs. 1 and 2). Maximum accumulation of these transcripts was observed about 6 h after addition of GSH, following which there is a decline to relatively low levels. GSH also caused the accumulation of HRGP transcripts Hyp4.1 and Hyp2.13, which had previously been shown to be induced by fungal elicitor (Fig. 1-1). As in elicitor treated cells, accumulation of these HRGP transcripts was less rapid but more prolonged than for PAL and CHS. GSH concentrations in the range 10 - 100 μM caused accumulation of PAL, CHS, Hyp2.13 and Hyp4.1 transcripts to levels comparable to, or greater than, those observed with optimal concentrations of fungal elicitor (Fig. 3).

Transcriptional Activation Marked accumulation of defense gene transcripts from low basal levels suggested that GSH was stimulating transcription of these genes. The effects of GSH on PAL, CHS and HRGP gene transcription were monitored by analysis of transcripts completed in vitro by nuclei isolated from cells at various times after GSH treatment. Isolation of nuclei and characterization of the run-off transcription assay have been described previously (Lawton (1987)). cDNA clone H1 contains sequences complementary to an abundant transcript which is unaffected by elicitor treatment. Compared with the constitutive transcription of the H1 gene as an internal control, GSH caused a marked stimulation in the transcription of PAL, CHS, and HRGP genes (Fig. 4). Pattern of Protein Synthesis The impact on the overall pattern of protein synthesis was examined by two-dimensional gel electrophoretic analysis of the polypeptide products synthesized in vitro by translation of total cellular RNA (Fig. 5). By this criterion, GSH caused a major change in the pattern of protein synthesis compared to that in untreated control cells. Thus, GSH markedly stimulated the synthesis of a large number of polypeptides including sets of PAL and CHS isopolypeptides (Fig. 5). The effects of GSH on the pattern of protein synthesis closely resembled that observed following treatment of equivalent cells with fungal elicitor. However, in addition, GSH markedly stimulated the synthesis of four polypeptides whose levels of expression were little affected by fungal elicitor (Fig. 5). Simultaneous addition of GSH and fungal elicitor altered the pattern of protein synthesis in a similar manner to GSH alone.

Enzyme Activity and Product Accumulation GSH treatment caused a marked and prolonged increase in the level of extractable PAL activity (Fig. 2). The phase of most rapid increase in enzyme activity occurred between 3 and 8 h after GSH addition and hence was closely correlated with the timing of maximum accumulation of PAL transcripts. Likewise, the dose response for induction of PAL enzyme activity after 8 h resembled that for accumulation of PAL transcripts, with marked effects at concentrations of GSH as low as 10 μM (Table 1). GSH stimulation of PAL enzyme activity lead to increased flux through the pathway and appreciable accumulation of the phytoalexin end-product phaseolin (data not shown). GSH treatment also caused significant browning of the cells, which is characteristic of the accumulation of phenolic material. Specificity of GSH

Induction of extractable PAL enzyme activity was used as a parameter to monitor the specificity of the effects of GSH. GSSG at a concentration of 1 mM caused only a weak stimulation of PAL activity and at concentrations of 0.1 mM or lower, the oxidized form of glutathione had no significant effect (Fig. 6). Moreover, treatment of cells with ascorbate, cysteine or a mixture of glutamate, glycine and cysteine did not increase extractable PAL activity (Table 2). Dithiothreitol likewise did not induce PAL activity (data not shown).

Discussion The data presented in this example demonstrate that exogenous GSH causes marked changes in the pattern of gene expression and protein synthesis in suspension cultured bean cells, including specific activation of defense genes and accumulation of the corresponding transcripts. While these effects qualitatively resemble those previously observed following treatment with fungal elicitor, a particularly striking feature is the massive quantitative effect of GSH. Thus, induction of PAL and CHS transcripts is several fold greater and also more prolonged than with optimal concentrations of fungal elicitor. Moreover, PAL enzyme activities of about 200 μkat/kg protein obtained following GSH treatment are the highest we have observed in cell suspension cultures or other induction systems (Lawton, et al., (1983)).

The effects of GSH are specific both in terms of the selective effects on gene activation, transcript accumulation and protein synthesis, and also the lack of effect of other reducing agents, constituent amino acids or the oxidized form of glutathione. In vivo, GSH is found at concentrations in the range of 0.05 to 1.5 mM (Bielawski, et al., (1986), Rennenberg (1982), Smith

(1975) and Smith, et al., (1985)) and hence the effects on defense genes occur at physiological concentrations of GSH. However, in some legumes including bean and soybean, the major free low-molecular-weight thiol is g-L-glutamyl-L-cysteinyl-ß-alanine (homoglutathione), with only trace amounts of glutathione (Price (1957)).

Heavy metals such as cadmium perturb glutathione metabolism leading to the synthesis of phytochelatins with the structure (g-glutamyl cysteinyl)_n-glycine where n = 3 to 7 (Grill, et al., (1985)). Heavy metals have also been shown to stimulate the synthesis of phytoalexins in soybean cotyledons (Moesta, et al., (1980)) and the effects of GSH on plant defense gene expression suggest a possible mechanism.

Moreover, GSH plays a protective role in cellular metabolism by acting as a reductant to remove free radicals (Meister, et al., (1983) and Rennenberg (1982)) and it has recently been shown that heat shock of maize roots elevates the cellular concentration of GSH (Nieto¬

Sotelo, et al., (1986)). Oxidative reactions such as the release of superoxide anions and the peroxidation of lipids are early responses to mechanical damage and infection (Chai, et al., (1987)). Hence GSH might function as a secondary signal of such redox perturbations, either as an intracellular second messenger mediating the effects of external stimuli such as fungal elicitors, or as a subsequent intercellular signal of biological stress leading to activation of defense genes at a distance from the initial perturbation.

However, the close resemblance between the effects of exogenous GSH and fungal elicitor does not necessarily imply a physiological role in elicitor action. For example, recent evidence shows that a number of receptors at the surface of animal cells, e.g. ß-adrenergic receptors, possess intramolecular disulfide bridges, cleavage of which by thiol compounds activates the receptor in a manner similar to agonist binding (Malbon, et al., (1987)). Thus it is possible that in bean cells GSH may be able to cleave such linkages in an elicitor receptor and thus initiate defense gene activation in the absence of elicitor without implying a physiological role for GSH in this signal transduction pathway. Interestingly, a number of sulfhydryl reagents including p-chloromercuribenzoic acid and p-chloromercuribenzene sulfonic acid elicit synthesis of glyceollin in soybean hypocotyls and medicarpin in Ladino clover callus (Gustine (1987) and Stossel (1984)).

Figure Legends Experimental Section I Figure 1. Accumulation of defense gene transcripts in response to GSH (1 mM). Figure 2. Kinetics for induction of (A) PAL and CHS transcripts and (B) PAL enzyme activity in response to GSH (1 mM). Open symbols: Control; Closed symbols: GSH-treated; PAL (open and closed circles); CHS (open and closed squares). In panel (B) the dotted line denotes changes in PAL mRNA levels.

Figure 3. Dose response for induction of defense gene transcripts by GSH. E = elicitor at a final concentration of 60 μg glucose equivalents / ml. Figure 4. Effect of GSH on the transcription of defense genes. Nuclei were isolated from cells 1.75 h after GSH treatment or from equivalent untreated control cells.

Figure 5. Effect of GSH on the pattern of protein synthesis. Two-dimensional gel electrophoretic analysis of [³⁵S]methionme-labeled products synthesized by in vitro translation of total cellar RNA isolated from: (A) Control untreated cells; or cells 4 h after treatment with: (B) GSH (1 mM); (C) fungal elicitor (60 μg/ml glucose equivalent); (D) GSH plus fungal elicitor. Open arrows in panel B denote those species induced by both GSH and fungal elicitor; closed arrows denote those species induced by GSH but not fungal elicitor; "p" denotes PAL subunits; "c" denotes CHS subunits. "IEF": Isoelectric focusing in the first dimension; "SDS PAGE": SDS-polyacrylamide gel electrophoresis in the second dimension.

Figure 6. Induction of PAL activity by GSSG: 1 mM (closed triangle, apex pointing up); 0.1 mM (closed triangle, apex pointing down); 0.01 mM (closed circle); control (open square). Induction by GSSG was compared to that obtained with 0.1 mM GSH (open circle).

Tables Experimental Section I Table 1. Dose Response for the Effect of GSH on the Level of Extractable PAL Activity

Treatment PAL Activity

0 h 4 h 8 h

(μkat/kg protein)

No treatment 2

GSH

0.01 mM 25 21

0.10 mM 40 117

1.00 mM 30 136 Elicitor 36 43 Elicitor + GSH, 1.0 mM 61 142

Elicitor was applied at a concentration of 60 μg glucose equivalents / ml.

Table 2. Effect of GSH. Constituent Amino Acids and Ascorbic Acid on the Level of Extractable PAL Activity

Treatment PAL Activity

O h 4 h 8 h

(μkat/kg protein)

Untreated cells 18 22 12 GSH -- 105 98

Cysteine -- 7 23

Cysteine, glycine, glutamate -- 19 21

Ascorbate -- 13 15

All compounds were tested at a concentration of 0.1 mM

EXPERIMENTAL SECTION II ELICITOR REGULATION OF A PLANT DEFENSE GENE PROMOTER IN ELECTROPORATED PROTOPLASTS

Introduction Plants respond to microbial attack by synthesis of antibiotics, stimulation of lytic enzymes and reinforcement of cell walls (Darvill, et al., (1984), Dixon, et al., (1983), Dixon, et al. (1986) and Ebel (1986)). These defenses can also be induced by glycan and glycoprotein elicitors from fungal cell walls and culture fluids or metabolites such as arachidonic acid and glutathione (Darvill, et al., (1984), Dixon, et al., (1983), Dixon, et al., (1986), Ebel (1986), Experimental Section I and Wingate, et al., (1988)). Elicitors, wounding or infection rapidly stimulate the transcription of genes involved in the erection of these defenses (Experimental Section I and Wingate, et al., (1988), Chappell, et al., (1984), Cramer, et al., (1985a), Sommsich, et al. (1986), Lawton, et al., (1987) and Hedrick, et al., (1988)). To investigate this early event in the activation of resistance mechanisms we have studied the expression in electroporated soybean protoplasts of a chimeric gene comprising the 5'-flanking region of a defense gene encoding chalcone synthase (CHS) fused to a bacterial chloramphenicol acetyltransferase (CAT) gene and the 3'-flanking region of the nopaline synthase (NOS) gene.

CHS catalyzes the condensation of 4-coumaroyl-CoA with three acetate units from malonyl-CoA to give naringenin chalcone. This is the first step in a branch of phenylpropanoid metabolism specific for the synthesis of isoflavonoid phytoalexin antibiotics in legumes, and flavonoid pigments which are ubiquitous in higher plants (Dixon, et al., (1983) and Hahlbrock, et al., (1979)). Elicitor stimulates CHS transcription in bean cells within 5 min leading to a transient accumulation of CHS mRNA with maximum levels after 3 to 4 h, correlated with the onset of phytoalexin synthesis (Cramer, et al., (1985a), Lawton, et al., (1987) and Ryder, et al., (1984)).

This example shows that glutathione or a fungal elicitor preparation of high molecular weight material heat-released from mycelial cell walls of the bean pathogen Colletotrichum lindemuthianum (fungal elicitor) cause a rapid, marked but transient expression of the chimeric CHS-CAT-NOS gene electroporated into soybean protoplasts. The response of the CHS-CAT-NOS gene closely resembles that of endogenous CHS genes in elicitor treated cell suspension cultures. The data shows that the 429 bp nucleotide sequence immediately upstream of the CHS coding region is sufficient to confer regulation by elicitor substances such as glutathione or fungal elicitor. Functional analysis of 5' deletions suggests that transduction of the elicitation signal to initiate elaboration of inducible defenses involves an elicitor regulated activator located between the TATA box and -173, and an upstream silencer between -173 and -326. Experimental Section II Materials and Methods

Plasmid Constructions pD0400 is identical to the previously described cauliflower mosaic virus (CaMV) 35S promoter construct pDO432 (Ow, et al., 1986)) except that an 883 bp BamHI fragment containing the Escherichia coli chloramphenicol acetyltransferase (CAT) gene (Alton, et al., (1979)) replaces the luciferase reporter gene of pDO432. pCHS15 consists of a 2.1 kb Hindlll Phaseolus vulgaris genomic fragment containing the full-length CHS 15 gene and flanking sequences subcloned into the riboprobe vector pSP64 (Ryder, et al., (1987)). In pCHCl, a 429 bp Hinfl fragment comprising 5'-untranslated sequences of CHS15 replaces the 35S transcript promoter of pDO400. pCHCl was constructed by replacing the

HindIII/Xbal CaMV 35S promoter fragment of pDO400 with the HindIII/XbaI polylinker fragment of pUC19 to create pCNIOO. PCN100 was digested with SalI, filled-in with Klenow DNA polymerase and dNTPs and used for blunt-end ligation of the 429 bp HinfI fragment of pCHS15 whose ends were similarly rendered blunt by Klenow fill-in. The construct was sequenced by dideoxy chain termination (Sanger, et al., (1977)) of denatured double-stranded plasmid with an M13 reverse primer (Chen, et al., (1985)). Deletion mutants were constructed by digesting pCHCl with HindIII followed by exonuclease III and mung bean nuclease treatment (Henikoff (1984)). After Xbal digestion, deleted promoter fragments were purified on low melting agarose and ligated into PstI (T₄ polymerase filled-in)/Xbal cut pCN100. Precise endpoints were determined by sequencing as described above. pHCNl was constructed by cloning a 235 bp EcoRI/PvuII fragment from the promoter region of a murine histone H₄ gene (Seiler-Tuyns, et al., (1981) into EcoRI/SmaI cut pIBI24 (a pUC-derived phagemid vector). This construct was further cleaved with EcoRI/Xbal and sub-cloned into HindIII/Xbal digested pCN100 along with the entire EcoRI/HindIII polylinker from pIBI24.

Protoplast Isolation The origin and maintenance of bean (Phaseolus vulgaris L.), soybean (Glycine max L.) and tobacco (Nicotiana tabacum L.) cell suspension cultures was as described except that cells were collected by sieving (250 micron mesh) and transferred to fresh maintenance medium at 7 d intervals (Cramer, et al., (1985b) and Norman, et al., (1986)). For protoplast isolation, cells (7 g fresh weight) were collected 4 d after subculture and incubated by shaking (90 rpm) in 100 ml of protoplast isolation medium for 4 h at 27°C in darkness (Fromm, et al., (1985)). Protoplasts were separated from the cellular debris by sieving and by centrifugation at 70 × g for 5 min at room temperature. Viability was determined by staining with Evans Blue and protoplasts were adjusted to 5 × 10⁶/ml. Protoplasts were washed twice in electroporation medium (Fromm, et al., (1985)) prior to manipulation.

Electroporation and Transient Assay Electroporation was performed as described (Fromm, et al., (1985)), 3 h after isolation of protoplasts with an optimal pulse of 250 V for 10 msec. Unless otherwise noted, 30 μg of test construct DNA was electroporated together with 50 μg of calf thymus DNA as carrier. Protoplasts were maintained without agitation in 6 ml of maintenance medium containing 0.3 M mannitol at 27°C in the dark. In the experiment depicted in Fig. 8 panel (A), protoplasts were collected for analysis 8 h after electroporation. In all other experiments, protoplasts were incubated for 21 h after electroporation prior to addition of fungal elicitor preparation heat released from mycelial cell walls of Colletotrichum lindemuthianum (fungal elicitor, Cramer, et al., (1985b)) or glutathione (see Experimental Section I and Wingate, et al., (1988)) in maintenance medium containing 0.3 M mannitol to give final concentrations of 60 μg glucose equivalents/ml and 1 mM respectively. Equal volumes of maintenance medium containing 0.3 M mannitol were added to control protoplasts. Protoplasts were collected by centrifugation, and extracts assayed for CAT activity by radiometric measurement of the conversion of the substrate [¹⁴C] chloramphenicol as described (Fromm, et al., (1985)). Reaction products were separated by thin layer chromatography, visualized by autoradiography and quantitated by scintillation counting. Protein was assayed by the Bradford procedure (Bradford (1976)). Typical CAT assays involved incubation of samples containing 5 μg protein for 3 hr at 37°C leading to the conversion of 1,000-5,000 cpm of the substrate into acetylated products.

RNA Analysis Protoplasts (3 × 10⁶) were resuspended in 100 μl 0.1 M Tris-HCl pH 9.0, containing 0.01% SDS. After extraction with phenol and chloroform, the supernatant was precipitated with 2 vol of 95% ethanol in the presence of 0.3 M sodium acetate. RNA was further processed and analyzed by Northern blot hybridization as described (Cramer, et al., (1985b)). The hybridization probe was a 0.8 kb BamHI fragment comprising E. coli CAT gene sequences (Alton, et al., (1979)) labeled by nicktranslation.

Results To analyze CHS promoter function, the expression of a chimeric gene comprising the 5' flanking region of the CHS 15 gene fused with the coding sequences of chloramphenicol acetyltransferase (CAT) and the 3' flanking sequences of nopaline synthase (NOS) (Fig. 7) was examined following electroporation into protoplasts derived from suspension cultured cells. CHS 15 is one of 6 CHS genes in the bean genome and encodes a major elicitor-induced CHS transcript (Ryder, et al., (1987)). The chimeric CHS-CAT-NOS gene construct pCHCl contains 429 bp of the 5' untranslated nucleotide sequences of CHS 15, comprising 326 bp upstream of the transcription start site and 103 bp of the "transcribed leader sequence (Fig. 7). As recently reported for parsley (Dangl, et al., (1987)), bean and soybean protoplasts respond to elicitor in a manner similar to the suspension cultured cells from which they were derived with respect to the accumulation of transcripts encoded by endogenous defense genes and the appearance of phenylpropanoid products (data not shown). However, electroporated bean protoplasts showed only low viability and weak expression of the CHS-CAT-NOS gene compared to tobacco and soybean protoplasts (Fig. 8). The latter, being closely related to bean, were the major focus for elicitor regulation studies.

To minimize induction by endogenous elicitors and other stress factors released during protoplast preparation (Dangl, et al., (1987) and Mieth, et al., (1986)), freshly isolated protoplasts were incubated for 3 h prior to electroporation and for a further 21 h before elicitation. Following addition, of glutathione, a marked increase in the level of CAT activity was observed within 3 h, whereas in untreated controls there was no significant change in CAT activity in this period (Fig. 8). Northern blot hybridization with nicktranslated CAT gene sequences as a probe demonstrated that glutathione stimulation of CAT activity reflected induction of CAT transcripts (Fig. 9). Hence induction of CAT activity could be correlated with stimulation of the transcription of the CHS-CAT-NOS gene. In contrast, glutathione did not modulate CAT activity in protoplasts electroporated with a chimeric gene comprising the promoter of the murine histone H₄ gene fused with the CAT-NOS reporter cassette (Fig. 8).

The response of the CHS-CAT-NOS gene was highly reproducible when different samples of a protoplast preparation were independently electroporated and induced (Fig. 8). Optimal elicitor regulation was observed with 30 - 50 μg of the chimeric gene (Fig. 10). Electroporation of larger amounts of the construct resulted in high levels of expression in control protoplasts and correspondingly weak regulation by glutathione. Fungal elicitor also induced expression of the chimeric gene (Fig. 8), although as with endogenous CHS genes in suspension cultured cells, the response was somewhat weaker than with glutathione (see Experimental Section I, and Wingate, et al., (1988)).

The CHS-CAT-NOS gene was transiently expressed with maximum levels 3 h after addition of glutathione followed by a decay to relatively low levels after 6 hr (Fig. 8D). No induction of CAT activity was observed over this period in 'the absence of glutathione. The chimeric gene was also regulated by glutathione when electroporated into protoplasts derived from tobacco cells, although the response was slower, with maximum CAT activity after 6 h (Fig. 8D). These induction kinetics closely resembled those for expression of endogenous defense genes in the respective suspension cultured cells from which the protoplasts were derived (Ryder, et al., (1984); Grab, et al., (1985); Hahn and Lamb, unpublished observations).

These data showed that sequences to -326 of CHS 15 were sufficient to confer regulation by glutathione or fungal elicitor. Deletion from -326 to -173 increased the basal level of CAT activity in soybean protoplasts prior to addition of an external stimulus and moreover caused a striking increase in the response to glutathione (Fig. 11). In contrast, further deletion to -130 reduced both basal and induced expression back to about the same respective levels observed with the entire promoter. Deletion to -72 reduced expression in glutathione-treated protoplasts to the basal level observed in unstimulated, control protoplasts. This deletion, which abolishes glutathione regulation, provides an additional internal control for the specificity of induction in the transient assay, since in this construct CHS promoter sequences are replaced by vector sequences adjacent to a functional TATA box. Deletion to -19, which removes the TATA box (-29 to -21), completely abolished expression of the chimeric gene in both control and glutathione-treated protoplasts.

The 5' deletions had similar relative effects on induction by the fungal elicitor preparation (data not shown). Thus, deletion to -173 likewise increased the response to fungal elicitor although this enhanced induction was somewhat weaker than that obtained with the same construct in response to glutathione. As with glutathione, further deletion to -136 and -72 progressively reduced the response to fungal elicitor.

Discussion The present data show that the CHS promoter is appropriately regulated by elicitor substances such as glutathione and fungal elicitor in electroporated protoplasts. As in other transient expression systems, it is probable that the CHS-CAT-NOS gene is not inserted into chromosomal DNA, and that our experiments monitor the expression of a plasmid-borne gene. However, the responses of the chimeric CHS-CAT-NOS gene electroporated into protoplasts closely resembles that of endogenous chromosomal CHS genes in elicitor treated cell suspension cultures with respect to the kinetics of induction and the relative potency of glutathione and fungal elicitor as inducers. Hence the protoplast system described here provides a convenient functional assay for analysis of cis-acting nucleotide sequences involved in elicitor regulation of defense genes. In addition, since it is now possible to genetically engineer plant cells that contain chimeric promoter/gene fusions, a chimeric "cassette" such as an exogenously inducible plant defense gene promoter-structural geneterminator cassette (CGC) of the invention can now be introduced into a variety of useful plants. See generally, Caplan, et al., (1984); Horsch, et al., (1985); and Rhodes, et al., (1988).

The initial studies with a set of nested 5' CHS deletions suggest that there is an elicitor-regulated activator element downstream from -173. Since 5' deletions to -130 and to -72 affect elicitor regulation by inhibition of induction rather than by elevation of basal expression, the activator appears to be a positive cis-acting element. This functional analysis is consistent with the pattern of sites hypersensitive to DNase I digestion in CHS genes (M.A. Lawton and C.J. Lamb, unpublished). Three such sites, which denote local opening of chromatin structure associated with binding of regulatory proteins, are found in the proximal region of the promoter in nuclei from elicitor-treated but not control cells. In contrast, sites in the upstream region show pronounced DNase I hypersensitivity in nuclei from uninduced as well as elicited cells.

While sequences between the TATA box and -130 are both necessary and sufficient for regulation by elicitor substances such as glutathione or fungal elicitor, upstream sequences appear to modulate expression, and maximum induction is obtained when sequences to -173 are present. This may reflect the existence of multiple cis-acting sequences that interact with the same trans-acting factor(s) or an independent regulatory element between -173 and -130, that is distinct from the downstream element. Alternatively, deletion of the nucleotide sequences between -173 and -130 may have an impact on gene expression not by abolition of the binding of trans-acting factors to cis-acting elements located in this region, but through indirect effects on chromatin structure that modulate binding of transcription factors to the activator element downstream of -130.

Similar indirect rearrangements of chromatin structure might likewise account for the enhanced expression observed by deletion from -326 to -173. However, it is likely that this enhanced expression reflects the removal of a discrete cis-acting silencer element located between -326 and -173. Specific binding of a nuclear factor to this region has recently been detected, and moreover, co-electroporation of the putative silencer element in trans with the complete CHS-CAT-NOS gene (pCHC1) leads to a marked stimulation of expression, presumably by competition for binding of the corresponding trans-acting repressor (Lawton, et al. (1988)). Functional analysis of the nested 5' deletions does not indicate whether the putative silencer is elicitor regulated, although synergistic interaction between positive and negative elicitor-regulated elements would provide a plausible "gain" mechanism for very rapid, marked, transient gene activation.

Two sequence elements, -242 to -194 and -74 to -52, in the 5' flanking region of CHS (Fig. 7) are strongly conserved in the promoter of a co-ordinately regulated gene encoding phenylalanine ammonia-lyase (PAL), the first enzyme of phenylpropanoid biosynthesis (Cramer, et al., unpublished observations). These motifs, which are similarly arranged in the PAL promoter, are believed to also have roles in silencer and activator function respectively. Analysis of point mutations and chimeric promoters will define more precisely the silencer and activator sequence elements and delineate the function of the silencer in elicitor regulation. The studies disclosed in Experimental Section I showed that glutathione and the fungal elicitor have almost identical qualitative effects on the pattern of gene expression and protein synthesis (also see Wingate, et al. (1988)). The 5' deletions examined here have similar effects on regulation by glutathione and fungal elicitor, and it will be of considerable interest to determine, by further dissection of the CHS promoter, whether identical cis-acting elements are involved in transduction of the signal (s) arising from these two different classes of elicitor.

While expression of genes introduced into protoplasts has been demonstrated in several cases, the only previous report of appropriate regulation in response to an external cue is the stimulation of a chimeric alcohol dehydfogenase 1 (ADH1) -CAT-NOS gene in electroporated maize protoplasts induced by oxygen depletion (Walker, et al., (1987)). It appears that the signal transduction mechanisms for activation of stressinduced genes such as ADH1 and CHS remain functional during protoplast isolation and culture. Since the response to elicitors is extremely rapid, the signal transduction pathway between microbial recognition and defense gene activation may contain very few steps.

Hence, analysis of the trans-acting nuclear factors that interact with the cis-acting elements identified here may provide a key for the dissection of response coupling mechanisms that underlie induction of plant defenses.

Figure Legends Experimental Section II Figure 7. (A) Structure of the CHS-CAT-NOS construct and deletion mutants. (B) Nucleotide sequence of the CHS 15 promoter and CAT fusion junction. Restriction sites indicated are: B = BamHI; H3 = Hindlll; Hf = HinfI; K = KpnI; R = EcoRI; X = XbaI; X2 = XhoII. Deletion mutants are marked by arrows. The TATA box is underlined. Sequences conserved in the promoter of an elicitor-induced bean PAL gene are overscored.

Figure 8. Expression of the chimeric CHS-CAT-NOS gene electroporated into protoplasts derived from suspension cultured cells. (A) Comparison of expression in bean, soybean and tobacco protoplasts; (B) Effect of glutathione on the expression of CHS-CAT-NOS and H₄-CAT-NOS chimeric genes in soybean protoplasts; (C) Comparison of the induction by fungal cell wall elicitor and glutathione; (D) Time-course for glutathione-induced expression in soybean and tobacco protoplasts. CAT = authentic bacterial CAT enzyme; T = tobacco; B = bean; S = soybean; SC = soybean protoplasts without electroporated genes; G = protoplasts 3 h after treatment with glutathione; E = protoplasts 3 h after treatment with fungal elicitor; C = equivalent, untreated control protoplasts. Closed arrowheads denote the major CAT product 3-acetylchloramphenicol.

Figure 9. Correlation between the accumulation of CAT transcripts and CAT activity in electroporated protoplasts containing the CHS-CAT-NOS gene. Upper panel: Northern blot of equal amounts of total cellular RNA from control protoplasts (C) or 3 h after treatment with glutathione (G) hybridized with CAT sequences. Lower panel: CAT activity from extracts of equivalent protoplasts.

Figure 10. Glutathione induction of CHS-CAT-NOS relative to basal levels of expression as a function of the amount of the chimeric construct electroporated. Figure 11. Effect of 5' deletions on glutathione regulation of the CHS-CAT-NOS gene electroporated into soybean protoplasts. Plus (+) : 3 h after addition of glutathione; minus (-) : equivalent untreated controls. The structure of 5' deletions are presented in Fig. 7A. Error bars denote standard deviation between independent replicates.

REFERENCES The following references are cited in the specification. The contents of each reference is expressly incorporated by reference herein.

PUBLICATIONS 1. Alton, N.K. and Vapnek, D., Nature 282:864-869 (1979). 2. Bailey, J.A. and Deverall, B.J., Formation and activity of phaseollin in the interaction between bean hypocotyls (Phaseolus vulgaris) and physiological races of Colletotrichum lindemuthianum. Physiol. Plant Pathol., 1:435-449 (1971).

3. Bielawski, W. and Joy, K.W., Reduced and oxidized glutathione and glutathione reductase in tissues of Pisum sativum. Planta, 169:267-272 (1986). 4. Bonner, W.M. and Laskey, R.A., A film detection method for tritium-labeled proteins and nucleic acids in polyacrylamide gels. Eur. J. Biochem., 46:83-88 (1974). 5. Bradford, M.M., Anal. Biochem., 72:248- 254 (1976).

6. Caplan, A., Herrera-Estrella, L., Inez, D., Van Haute, E., Van Montagu, 1M., Schell, J., and Zambryski, P.,

"Introduction of Genetic Material into Plants" in Biotechnology & Biological Frontiers, P.H. Abelson, ed., The American Association for the Advancement of Science, Washington, D.C., 1984 at pp.

480-493.

7. Chai, H.B. and Doke, N., Superoxide anion generation: A response of potato leaves to infection with Phytophthora infestans. Phytopathology, 77:645-649 (1987).

8. Chappell, J. and Hahlbrock, K., Nature 311:76-78 (1984).

9. Chen, Y. and Seeburg, P., DNA, 4:165-170 (1985). 10. Corbin, D.R., Sauer, N. and Lamb, C.J.,

Differential regulation of a hydroxyproline-rich glycoprotein gene family in wounded and infected plants. Mol. Cell. Biol.. 7:4337-4344 (1987). 11. Cramer, C.L., Bell, J.N., Ryder, T.B.,

Bailey, J.A., Schuch, W., Bolwell, G.P., Robbins, M.P., Dixon, R.A. and Lamb, C.J., EMBO J. , 4:285-289 (1985b).

12. Cramer, C.L., Ryder, T.B., Bell, J.N. and Lamb, C.J., Rapid switching of plant gene expression by fungal elicitor. Science, 227:1240-1243 (1985a) .

13. Cramer, C.L., Edwards, K., Dron, M., Liang, X., Dilbine, S.L., Bolwell, G.P., Dixon, R.A., Lamb, C.J., and Schuch, W., 1989, In Press. Plant Molec. Biol. (1989).

14. Dangl, J.L., Hauffe, K.D., Lipphardt, S., Hahlbrock, K. and Scheel, D., EMBO J.,

6:2551-2556 (1987).

15. Darvill, A. and Albersheim, P., Annu. Rev. Plant Phvsiol., 35:243-275 (1984).

16. Davis, K.R., Darvill, A.G. and Albersheim, P., Plant Mol. Biol., 6:23-32

(1986).

17. Davis, K.R. and Hahlbrock, K., Plant Physiol., 85:1286-1290 (1987).

18. Dekok, L.J. and Oosterhuis, F.A., Effects of frost hardening and salinity on glutathione and sulfhydryl levels in spinach leaves. Phvsiol. Plant.. 58:47- 51 (1983).

19. Dixon, R.A., Dey, P.M. and Lamb, C.J., Adv. Enzymol. Relat. Areas Mol. Biol.,

55:1-135 (1983).

20. Dixon, R.A., Bailey, J.A., Bell, J.N., Bolwell, G.P., Cramer, C.L., Edwards, K., Hamdan, M.A.M.S., Lamb, C.J., Robbins, M.P., Ryder, T.B. and Schuch, W., Phil.

Trans. R. Soc. London B., 314:411-426 (1986).

21. Douglas, C., Hoffman, H., Schultz, W., and Hahlbrock, K., Structure and elicitor or u.v. -light-stimulated expression of two

4-coumarate: CoA ligase genes in parsley. EMBO J., 6(5) : 1189-1195 (1987).

22. Dron, M., Clouse, S.D., Dixon, R.A., Lawton, M.A., and Lamb, C.J., Elicitor Regulation of a Plant Defense Gene Promoter in Electroporated Protoplasts, Proc. Natl. Acad. Sci. USA, 85:6738- 6742 (1988). (Portions of this manuscript are included herein as Experimental

Section II.)

23. Ebel, J., Annu. Rev. Phvtopathol., 24:235-264 (1986).

24. Edwards, K., Cramer, C.L., Bolwell, G.P., Dixon, R.A., Schuch, W. and Lamb, C.J.,

Rapid transient induction of phenylalanine ammonia-lyase mRNA in elicitor-treated bean cells. Proc. Natl. Acad. Sci. USA. 82:6731-6735 (1985). 25. Edwards, R. and Owen, W.J., Comparison of glutathione-S-transferases of Zea mays responsible for herbicide detoxification in plants and suspension-cultured cells. Planta, 169:208-215 (1986). 26. Fromm, M.E., Taylor, L.P. and Walbot, V.,

Proc. Natl. Acad. Sci. USA, 82:5824-5828 (1985).

27. Garrels, J.I., Two-dimensional gel electrophoresis and computer analysis of proteins synthesized by clonal cell lines. J. Biol. Chem.. 254:7961-7977 (1979).

28. Grab, D., Loyal, R. and Ebel, J., Arch. Biochem. Biophys., 243:523-529 (1985). 29. Grill, E., Winnacker, I.-L. and Zenk,

M.H., Phytochelatins : The principle heavy-metal complexing peptides of higher plants. Science, 230:674-676 (1985). 30. Gustine, D.L., Induction of medicarpin biosynthesis in Ladino clover callus by p-chloromercuribenzoic acid is reversed by dithiothreitol. Plant Phvsiol.. 84:3-6 (1987).

31. Hahlbrock, K. and Grisebach, H., Annu. Rev. Plant Phvsiol., 30:105-130 (1979).

32. Hahlbrock, K., Knobloch, K.-H., Kreuzaler, F., Potts, J.R.M., and Wellmann, E., Eur. J. Biochem., 61:199- 206 (1976).

33. Hedrick, S.A., Bell, J.N., Boiler, T. and Lamb, C.J., Plant Physiol.. 86:182-186 (1988). 34. Henikoff, S., Gene. 28:351-359 (1984).

35. Horsch, R., B., Fry, J.E., Hoffmann, N.L., Eicotz, D., Rogers,S.G., and Fraley, R. T., Science. 227:1229-1231 (1985). 36. Lamb, C.J., Bell, J.N., Corbin, D.R.,

Lawton, M.A., Mehdy, M.C., Ryder, T.B., Sauer, N., and Walter, M.H., Activation of defense genes in response to elicitor and infection. In Molecular Strategies for Crop Protection (ed. C. Arntzen and

CA. Ryan), p. 49. Alan R. Liss, New York (1987).

37. Lawton, M.A., Dixon, R.A., Hahlbrock, K. and Lamb, C.J., Transcriptional activation of plant defense genes by fungal infection, wounding and infection. Eur. J. Biochem.. 130:131-139 (1983).

38. Lawton, M.A. and Lamb, C.J., Mol. Cell. Biol., 7:335-341 (1987). 39. Lawton, M.A., Kragh, K., Jenkins, S.M., Dron, M., Clouse, S.D., Dixon, R.A., and Lamb, C.J., J. Cell. Biochem. Supplement 12C, Abstract #L707. 40. Malbon, C.C., George, S.T., Moxham, C.P.,

Intramolecular disulfide bridges: avenues to receptor activation. Trends Biochem. Sci.. 137:172-175 (1987).

41. McMaster, G.K. and Carmichael, G.G., Analysis of single- and double-stranded nucleic acids on polyacrylamide and agarose gels using glyoxal and acridine orange. Proc. Natl. Acad. Sci. USA, 74:4835-4839 (1977). 42. Meister, A. and Anderson, M.E.,

Glutathione. Annu. Rev. Biochem.. 52:711-760 (1983).

43. Mieth, H., Speth, V. and Ebel, J., Z. Naturforsch.. 41c:193-201 (1986). 44. Moesta, P. and Grisebach, H., Effects of biotic and abiotic elicitors on phytoalexin metabolism in soybean. Nature. 286:710-711 (1980).

45. Nieto-Sotelo, J and Ho, Th.-D., Effect of heat shock on the metabolism of glutathione in maize roots. Plant Phvsiol., 82:1031-1035 (1986).

46. Norman, P.M., Wingate, V.P.M., Fitter, M.S. and Lamb, C.J., Planta, 167:452-459 (1986).

47. Ow, D.W., Wood, K.V., Deluca, M., deWet, J.R., Helinski, D.D. and Howell, S.H., Science, 234:886-859 (1986). 48. Price, CA., A new thiol in legumes. Nature- 180:148-149 (1957).

49. Rennenberg, H., Glutathione metabolism and possible biological roles in higher plants. Phytochemistry. 21:2771-2781

(1982).

50. Rhodes, CA., Pierce, D.A., Mettler,

I.J., Mascarenhas,D., and Detmer, J.J., Genetically Transformed Maize Plants from Protoplasts. Science, 240:204-207 (1988).

51. Ryder, T.B., Cramer, CL., Bell, J.N., Robbins, M.P., Dixon, R.A. and Lamb, C.J., Elicitor rapidly induces chalcone synthase mRNA in Phaseolus vulgaris cells at the onset of the phytoalexin defense response. Proc. Natl. Acad. Sci. USA. 81:5724-5728 (1984).

52. Ryder, T.B., Hedrick, S.A., Bell, J.N., Liang, X., Clouse, S.D. and Lamb, CJ., Mol. Gen. Genet.. 210:219-233 (1987).

53. Sanger, F., Nicklen, S. and Coulsen, A.R., Proc. Natl. Acad. Sci. USA, 74:5463-5467 (1977).

54. Sharp, J.K., McNeil, M., Albersheim, P., J. Biol. Chem.. 250:11321-11336 (1984).

55. Siler-Tuyns, A. and Birnstiel, M.L., J. Mol. Biol., 151:607-625 (1981).

56. Smith, I.K., Sulfate transport in cultured tobacco cells. Plant Phvsiol., 55:303-307 (1975).

57. Smith, I.K., Kendall, A.C, Keys, A.J., Turner, J.C and Lea, P.J., The regulation of the biosynthesis of glutathione in leaves of barley (Hordeum vulgare L.). Plant Sci., 41:11-17 (1985).

58. Sommsich, I., Schmelzer, E., Bollmann, J. and Hahlbrock, K., Proc. Natl. Acad. Sci. USA, 83:2427-2430 (1986).

59. Stossel, P., Regulation by sulfhydryl groups of glyceollin accumulation in soybean hypocotyls. Planta. 160:314-319 (1984). 60. Thomas, P.A., Hybridization of denatured

RNA and small DNA fragments transferred to nitrocellulose. Proc. Natl. Acad. Sci. USA. 77:5201-5205 (1980).

61. Walker, J.C, Howard, E.A., Dennis, E.S. and Peacock, W.J., Proc. Natl. Acad. Sci.

USA. 84:6624-6628 (1987).

62. Whitehead, I.M., Dey, P.M., and Dixon, R.A., Planta. 154:156-164 (1982).

63. Wingate, V.P.M., Lawton, M.A. and Lamb, C.J., Plant Physiol., in press (1988).

(Portions of this reference are disclosed herein as Experimental Section I.) PATENTS 1. Simpson, R.B., and Margossian, L., United States Patent 4,658,082 issued

April 14, 1987 for "A Method for Producing Intact Plants Containing Foreign DNA".. SPECIFICATION SUMMARY From the foregoing description one of ordinary skill in the art can see that the present invention discloses useful regulatory elements that control selective induction of plant defense genes. These elements can be used to engineer plants that have enhanced abilities to defend against environmental and pathogenic stresses. The regulatory elements can also be used to identify environmentally safe substances that can be used to pre-activate a plant's own defense mechanisms. Use of such environmentally safe substances to induce a state of plant "immunity" prior to an initial stress or infection will aid in eliminating the current reliance on harmful pesticide chemicals.

Without departing from the spirit and scope of this invention, one of ordinary skill can make various changes and modifications to the invention to adapt it to various usages and conditions. As such, these changes and modifications are properly, equitably, and intended to be, within the full range of equivalence of the following claims.

Claims

WHAT IS CLAIMED IS:

1. A substantially pure plant defense gene promoter that directs stress-regulated expression of an operatively linked gene, said promoter selected from the group consisting of: promoters for the plant genes that encode the phenylpropanoid biosynthetic enzymes phenylalanine ammonia-lyase (PAL), chalcone synthase (CHS), and 4-coumarate:CoA ligase (4CL), plus promoters for the plant genes that encode the cell wall hydroxyproline-rich glycoproteins.

2. A substantially pure functional domain in the promoter of Claim 1, wherein said functional domain is selected from the group consisting of (1) an elicitor-regulated activator domain, and (2) an upstream silencer domain.

3. A DNA sequence comprising: ACCAATTATTGGTTACTAAATTTAACAGTGAATGAATGAATGAGTTATA.

4. A DNA sequence comprising: CACGTGATACTCACCTACCCTAC.

5. A DNA sequence having substantial sequence homology with the DNA sequences in any of Claims 3 or 4.

6. Chimeric plasmids selected from the group, consisting of pCHCl and pCHC2.

7. A chimeric gene cassette (CGC) comprising: (a) at least one promoter selected from the group consisting of phenylalanine ammonia-lyase (PAL), chalcone synthase (CHS), 4-coumarate:CoA ligase (4CL), and promoters for the plant genes that encode cell wall hydroxyproline-rich glycoproteins; wherein said promoter is operatively linked to (b) at least one reporter gene; and (c) at least one 3' terminator.

8. A chimeric gene cassette (CGC) according to Claim 7 wherein said reporter gene(s) is selected from the group consisting of chloramphenicol acetyltransferase (CAT), beta glucuronidase (GUS), ß-lactamase (lacZ) and firefly luciferase.

9. A chimeric gene cassette (CGC) comprising: (a) at least one promoter selected from the group consisting of phenylalanine ammonia-lyase (PAL), chalcone synthase (CHS), 4-coumarate:CoA ligase (4CL), and promoters for the plant genes that encode cell wall hydroxyproline-rich glycoproteins; wherein said promoter is operatively linked to (b) at least one structural gene capable of being expressed in plants; and (c) at least one 3' terminator.

10. A chimeric gene cassette (CGC) according to any of Claims 7 or 9 wherein said 3' terminator(s) is selected from the group consisting of the 3' flanking region of the nopaline synthase (NOS) gene and the 3' flanking region of the octopine synthase (OCS) gene.

11. The reduced form of glutathione when used exogenously to activate plant defense genes.

12. A method for activating plant genes, said method comprising: applying reduced glutathione exogenously to plant material that contains at least one structural gene operatively linked to at least one promoter that is activated by reduced glutathione.

13. A method according to Claim 12 wherein said promoter (s) is selected from the group consisting of promoters that encode phenylalanine ammonia-lyase (PAL), chalcone synthase (CHS), 4-coumarate:CoA ligase (4CL), and promoters for the plant genes that encode the cell wall hydroxyproline-rich glycoproteins.

14. Plant material engineered with human effort wherein said plant material contains the chimeric gene cassette (CGC) any of Claims 7 or 9.

15. Plant material according to Claim 14 wherein said plant material is selected from the group consisting of tobacco, potato, carrot, flax, eggplant, tomato, chili pepper, sunflower, rapeseed, rice, maize and loblolly pine plant material