WO2014127744A1 - Compositions and methods involving genes encoding wrkytranscription factors - Google Patents

Abstract

Isolated polynucleotides and polypeptides, and recombinant DNA constructs useful for conferring drought tolerance; compositions (such as plants or seeds) comprising these recombinant DNA constructs; and methods utilizing these recombinant DNA constructs. The recombinant DNA constructs include polynucleotides operably linked to promoters that are functional in a plant. Polynucleotides encode WRKY transcript factors.

Description

COMPOSITIONS AND METHODS INVOLVING GENES

ENCODING WRKYTRANSCRIPTION FACTORS FIELD

The field relates to plant breeding and genetics and, in particular, relates to recombinant DNA constructs useful in plants for conferring tolerance to drought.

BACKGROUND

Abiotic stress is the primary cause of crop loss worldwide, causing average yield losses more than 50% for major crops (Boyer, J.S. (1982) Science 218:443-448; Bray, E.A. et al. (2000) In Biochemistry and Molecular Biology of Plants, edited by Buchannan, B.B. et al., Amer. Soc. Plant Biol., pp. 1 158-1249). Among the various abiotic stresses, drought is the major factor that limits crop productivity worldwide, and exposureof plants to a water-limiting environment during various developmental stages appears to activate various physiological and developmental changes.

Althoughmany reviews on molecular mechanisms of abiotic stress responses and genetic regulatory networks of drought stress tolerance have been published

(Valliyodan, B., and Nguyen, H.T. (2006) Curr. Opin. Plant Biol. 9:189-195; Wang, W., et al. (2003) Planta 218:1 -14; Vinocur, B., and Altman, A. (2005) Curr. Opin. Biotechnol. 16:123-132; Chaves, M.M., and Oliveira, M.M. (2004) J. Exp. Bot.

55:2365-2384; Shinozaki, K., et al. (2003) Curr. Opin. Plant Biol. 6:410-417;

Yamaguchi-Shinozaki, K., and Shinozaki, K. (2005) Trends Plant Sci. 10:88-94),it is also a major challenge in biology to understandthe basic biochemical and molecular mechanisms for drought stress perception, transduction and tolerance.

Earlier work on molecular aspects of abiotic stress responses was accomplished by differential and/or subtractive analysis (Bray, E.A. (1993) Plant Physiol. 103:1035- 1040; Shinozaki, K., and Yamaguchi-Shinozaki, K. (1997) Plant Physiol. 1 15:327- 334; Zhu, J.-K. et al. (1997) Crit. Rev. Plant Sci. 16:253-277; Thomashow, M.F. (1999) Annu. Rev. Plant Physiol. Plant Mol. Biol. 50:571 -599);andother methods which include selection of candidate genes and analysis of expression of such a gene or its active product under stresses, or by functional complementation in a stressor system that is well defined (Xiong, L. and Zhu, J.-K. (2001 ) Physiologia Plantarum 1 12:152-166). Additionally, forward and reverse genetic studies involving the identification and isolation of mutations in regulatory genes have been used to provide evidence for observed changes in gene expression under stress (Xiong, L. and Zhu, J.-K. (2001 ) Physiologia Plantarum 1 12:152-166).

Activation tagging can be utilized to identify genes with the ability to affect a trait,andthis approach has been used in Arabidopsis thaliana(the model plant species) (Weigel, D., et al. (2000) Plant Physiol. 122:1003-1013). Insertions of transcriptional enhancer elements can dominantly activate and/or elevate the expression of nearby endogenous genes, sothis method can be used to select genes involved in agronomically important phenotypes, including abiotic stress

tolerancesuch as improved drought tolerance.

WRKY transcription factors that are plant-specific proteinsinclude a type of transcriptional regulatory factors in which N-terminal ends contain a conserved WRKYGQR amino acids sequences. WRKY transcription factors regulate the target gene expression by specifically bindingW-box elements in the promoter regions to a (T)(T)TGAC(C/T) sequence. Therefore, the WRKY transcription factors participate in various defense responses in the plantand regulate the plant growth and development. As a member of the WRKY transcription factor family,arice WRKY transcription factor 66 (OsWRKY66) contains a conserved amino acid sequence of WRKYGQR.

SUMMARY

The following embodiments are among those encompassed by the invention: 1 . An isolated polynucleotide comprising: (a)a nucleotide sequence encoding a polypeptide with an amino acid sequence of at least 90% sequence identity to SEQ ID NO: 5, or (b) a nucleotide sequence of SEQ ID NO: 3, or (c) a nucleotide sequence of SEQ ID NO: 4, or (d)a nucleotide sequence having at least 85% identity with the full length nucleotide sequence of (a) or (b) or (c); (e) a full complement of the nucleotide sequence of (a) or (b) or (c) or (d), wherein the full complement and the nucleotide sequence consist of the same number of nucleotides and are 100% complementary. The polypeptide may comprise the amino acid sequence of SEQ ID NO:5. The nucleotide sequence may comprise the nucleotide sequence of SEQ ID NO: 3and 4. 2. A recombinant DNA construct comprising the isolated polynucleotide of embodiment 1 operably linked to at least one regulatory sequence.

3. A plant comprising in its genome a recombinant DNA construct comprising a polynucleotide operably linked to at least one regulatory element, wherein said polynucleotide encodes a WRKY transcription factor66 (WRKY66) having an amino acid sequence of at least 85% sequence identity, as measured by GAP

parametersdescribed elsewhere herein, to SEQ ID NO: 5, and wherein said plant exhibits increased drought tolerancewhen compared to a control plant.

4. A plant comprising in its genome a recombinant DNA construct comprising a polynucleotide operably linked to at least one regulatory element, wherein said polynucleotide encodes a polypeptide having an amino acid sequence of at least 85% sequence identity, as measured by GAP, to SEQ ID NO:5, and wherein said plant exhibits an alteration of at least one agronomic characteristics when compared to a control plant. Optionally, the plant exhibits said alteration of said at least one agronomic characteristics when compared, under water limiting conditions, to a control plant. The at least one agronomic trait may be grain yield or biomass, and the alteration may be an increase.

5. A plant of embodiment 3or 4, wherein the plant is selected from the group consisting of:rice, maize, soybean, sunflower, sorghum, canola, wheat, alfalfa, cotton, barley, millet, sugar cane and switchgrass.

6. Seed of embodiment 3 or 4 or 5, wherein said seed comprises in its genome a recombinant DNA construct comprising a polynucleotide operably linked to at least one regulatory element, wherein said polynucleotide encodes a polypeptide having an amino acid sequence of at least 85% sequence identity, as measured by GAP, when compared to SEQ ID NO:5, and wherein a plant produced from said seed exhibits an increased drought tolerance, or an alteration of at least one other agronomic characteristics, or both, when compared to a control plant. The at least one other agronomic trait may begrainyield, biomass, or a combination, and the alteration may be an increase.

7. A method of increasing drought tolerance in a plant, comprising:

(a)introducing into a regenerable plant cell a recombinant DNA construct comprising a polynucleotide operably linked to at least one regulatory sequence, wherein the polynucleotide encodes a polypeptide having an amino acid sequence of at least 85% sequence identity, as measured by GAP, to SEQ ID NO:5; (b)regenerating a transgenic plant from the regenerable plant cell after step (a), wherein the transgenic plant comprises in its genome the recombinant DNA construct; and (c)obtaining a progeny plant derived from the transgenic plant of step (b), wherein said progeny plant comprises in its genome the recombinant DNA construct and exhibits

increased drought tolerance when compared to a control plant.

8. A method of improving drought tolerance also comprising: (a) crossing the plant of embodiment 3 or 4 or 5 with a second plant to produce progeny seed;(b) harvesting and planting the progeny seed to produce at least one progeny plant of a subsequent generation; (c) crossing the progeny plant with the second plant to produce at least one backcross progeny seed; and optionally,(d) repeating steps (b) and (c) for additional generations to produce a plant with improved drought tolerance when compared to the second plant.

9. Amethod of evaluating drought tolerance in a plant, comprising: (a) obtaining a transgenic plant, wherein the transgenic plant comprises in its genome a

recombinant DNA construct comprising a polynucleotide operably linked to at least one regulatory element, wherein said polynucleotide encodes a polypeptide having an amino acid sequence of at least 85% sequence identity, as measured by GAP,to SEQ ID NO:5; (b) obtaining a progeny plant derived from the transgenic plant, wherein the progeny plant comprises in its genome the recombinant DNA construct; and (c)evaluating the progeny plant for drought tolerance compared to a control plant.

10. A method of determining an alteration of at least one agronomic

characteristics in a plant, comprising: (a) obtaining a transgenic plant, wherein the transgenic plant comprises in its genome a recombinant DNA construct comprising a polynucleotide operably linked to at least one regulatory element, wherein said polynucleotide encodes a polypeptide having an amino acid sequence of at least 85% sequence identity, as measured by GAP, to SEQ ID NO: 5, wherein the transgenic plant comprises in its genome the recombinant DNA construct; (b)obtaining a progeny plant derived from the transgenic plant, wherein the progeny plant

comprises in its genome the recombinant DNA construct; and (c)determining whether the progeny plant exhibits an alteration of at least one agronomic

characteristics when compared to a control plant. Optionally, said determining step (c) comprises determining whether the transgenic plant exhibits an alteration of at least one agronomic characteristic when compared, under water limiting conditions, to a control plant. The at least one agronomic trait may begrain yield, biomass, or a combination, and the alteration may be an increase.

1 1 . Any of the methods of the embodiment 7-10, wherein the plant is selected from the group consisting of:rice, maize, soybean, sunflower, sorghum, canola, wheat, alfalfa, cotton, barley, millet, sugar cane and switchgrass.

12. A rice plant comprising a recombinant transcriptional activator element enhancing the expression of an endogenous polynucleotide, wherein the

polynucleotide encodes an amino acid sequence that is 90% identical to SEQ ID NO: 5.

13. A method of increasing drought tolerance of a rice plant in a field, the method comprising (a) expressing a recombinant nucleic acid encoding a rice WRKY transcription factor in a rice plant; (b) growing the rice plant under crop growing conditions in the field, wherein the rice plant is exposed to drought conditions; and (c) increasing the drought tolerance of the rice plant.

14. A method of increasing yield of a rice plant in a field, the method comprising

(a) expressing a recombinant nucleic acid encoding a rice WRKY transcription factor in a rice plant; (b) growing the rice plant under crop growing conditions in the field, wherein the rice plant is exposed to drought conditions; and (c) increasing the grain yield of the rice plant.

15. A method of identifying an allele of OsWRKY66 that results in an increased expression or activity of the OsWRKY66 polypeptide, the method comprising the steps of: (a) performing a genetic screen on a population of mutant plants; (b) identifying one or more mutant plants that exhibit the increased expression or activity of the OsWRKY66 polypeptide or a homolog thereof; and (c) identifying the

OsWRKY66 allele or a homolog thereof from the mutant plant.

16. A method of screening for alleles of OsWRKY66, the method comprising (a) sequencing one or more genomic DNA fragments isolated from one or more rice populations with an oligonucleotide primer targeted to the OsWRKY66 gene; (b) analyzing the differences of the DNA sequence in the regulatory or the coding region of the OsWRKY66 gene; and (c) correlating an allele of OsWRKY66 with increased drought tolerance or yield.

17. A rice plant, comprising in its genome a recombinant construct that results in an increased expression of OsWRKY66 polypeptide, wherein the polypeptide comprises SEQ ID NO: 5. In another embodiment, the present disclosure concerns a recombinant DNA construct comprising any of the isolated polynucleotides of the present disclosure operably linked to at least one regulatory sequence, and a cell, a plant, or a seed comprising the recombinant DNA construct. The cell may be eukaryotic, e.g., a yeast, insect or plant cell;or prokaryotic, e.g., a bacterial cell.

BRIEF DESCRIPTION OF THE DRAWINGSAND SEQUENCE LISTING

The invention can be more fully understood from the following detailed

description and the accompanying drawings and Sequence Listing which form a part of this application.

Figure 1 provides OsWRKY66transgene expression levels in leaves of seven separate transgenic rice eventsby real-time PCR analyses. Becausethe expression level of OsWRKY66 transgene incontrol (DP0005)leaf tissues was not detectable, the base level of expression in DP0010.13 event was set 1 .00, and the expression levels in other OsWRKY66 events are shown as fold-increases compared to

DP0010.13.

Figure 2 shows changes of soil volumetric moisture content at different developmental stagein Hainan field in a growing season.

Figure 3shows that overexpression of OsWRKY66transgene under CaMV 35S promoter in Arabidopsis (AtDP0010-6, AtDP0010-10,AtDP0010-13) can significantly increase drought tolerance.A. semi-quantitative PCR analysis of OsWRKY66 in Arabidopsis,B. Survival rate on the 3^rd day after re-watering. WT, wild type Columbia; VC, vector control DP0009 transformants.

Table 1 .SEQ ID NOs for nucleotide and amino acid sequences provided in the sequence listing.

Table 2. Drought tolerance assays of AH01460under greenhouse conditions. Table 3. Enhanced drought tolerance of CaMV35S Pro: OsWRKY66-rice plants atTOgeneration under greenhouse conditions.

Table 4. Enhanced drought tolerance of CaMV35S Pro: OsWRKY66-rice plants atT2 generation under greenhouse conditions.

Table 5. Seed yield assay of CaMV35S Pro: OsWRKY66-rice plants atT2 generationunder field drought conditions. Table 1 . SEQ ID NOs for nucleotide and amino acid sequences provided in the sequence listing

The Sequence Listing contains the one-letter code for nucleotide sequences and the three-letter code for amino acid sequences as defined in conformity with the lUPAC-IUBMB standards described in Nucleic Acids Res. 73:3021 -3030 (1985) and in the Biochemical J. 219 (No.2^:345-373 (1984) which are herein incorporated by reference. The symbols and format used for nucleotide and amino acid sequence data comply with the rules set forth in 37C.F.R.§1 .822.

DETAILED DESCRIPTION

The disclosure of each reference set forth herein is hereby incorporated by reference in its entirety.

As used herein and in the appended claims, the singular forms "a", "an", and

"the" include plural reference unless the context clearly dictates otherwise. Thus, for example, reference to "a plant" includes a plurality of such plants; reference to "a cell" includes one or more cells and equivalents thereof known to those skilled in the art, and so forth.

As used herein:

"WRKY transcription factor66"is a WRKY transcription factor.

The terms "monocot" and "monocotyledonous plant" are used interchangeably herein. A monocot of the current invention includes plants of the Gramineae family.

The terms "dicot" and "dicotyledonous plant" are used interchangeably herein. A dicot of the current invention includes the following families: Brassicaceae,

Leguminosae, and Solanaceae.

The terms "full complement" and "full-length complement" are used

interchangeably herein, and refer to a complement of a given nucleotide sequence, wherein the complement and the nucleotide sequence consist of the same number of nucleotides and are 100% complementary.

An "Expressed Sequence Tag" ("EST") is a DNA sequence derived from a cDNA library and therefore represents a sequence which has been transcribed. An EST is typically obtained by a single sequencing pass of a cDNA insert. The sequence of an entire cDNA insert is termed the "Full-Insert Sequence" ("FIS"). A "Contig" sequence is a sequence assembled from two or more sequences that can be selected from, but not limited to, the group consisting of an EST, FIS and PCR sequence. A sequence encoding an entire or functional protein is termed a

"Complete Gene Sequence" ("CGS") and can be derived from an FIS or a contig.

The term"trait" refers to a physiological, morphological, biochemical, or physical characteristics of a plant or particular plant material or cell. In some instances, this characteristics is visible to the human eye, such as seed or plant size, or can be measured by biochemical techniques, such as detecting the protein, starch, or oil content of seed or leaves, or by observation of a metabolic or physiological process, e.g. by measuring tolerance to water deprivation or particular salt or sugar or nitrogen concentrations, or by the observation of the expression level of a gene or genes, or by agricultural observations such as osmotic stress tolerance or yield.

"Agronomic characteristics" is a measurable parameter including but not limited to:greenness, grain yield, growth rate, total biomass or rate of accumulation, fresh weight at maturation, dry weight at maturation, fruit yield, seed yield, total plant nitrogen content, fruit nitrogen content, seed nitrogen content, nitrogen content in a vegetative tissue, total plant free amino acid content, fruit free amino acid content, seed free amino acid content, free amino acid content in a vegetative tissue, total plant protein content, fruit protein content, seed protein content, protein content in a vegetative tissue, drought tolerance, nitrogen uptake, root lodging, harvest index, stalk lodging, plant height, ear height, ear length, salt tolerance,tiller number, panicle size, early seedling vigor and seedling emergence under low temperature stress.

Increased biomass can be measured, for example, as an increase in plant height, plant total leaf area, plant fresh weight, plant dry weight or plant seed yield, as compared with control plants.

The ability to increase the biomass or size of a plant would have several important commercial applications. Crop cultivars may be developedtoproduce higher yield of the vegetative portion of the plant,to be used in food, feed, fiber, and/or biofuel.

Increased leaf size may be of particular interest. Increasedleaf biomass can be used to increase production of plant-derived pharmaceutical or industrial products. Increased tiller number may be of particular interest and can be used to increase yield. An increase in total plant photosynthesis is typically achieved by increasing leaf area of the plant. Additional photosynthetic capacity may be used to increase the yield derived from particular plant tissue, including the leaves, roots, fruits or seed, or permit the growth of a plant under decreased light intensity or under high light intensity.

Modification of the biomass of another tissue, such as root tissue, may be useful to improve a plant's ability to grow under harsh environmental conditions, including drought or nutrient deprivation, because larger roots may better reach or take up water or nutrients.

For some ornamental plants, the ability to provide larger varieties would be highly desirable. For many plants, including fruit-bearing trees, trees that are used for lumber production, or trees and shrubs that serve as view or wind screens, increased stature provides improved benefits, such as in the forms of greater yield or improved screening.

"Transgenic"refers to any cell, cell line, callus, tissue, plant part or plant, the genome of which has been altered by the presence of a heterologous nucleic acid, such as a recombinant DNA construct, the term "transgenic" used herein includes those initial transgenic events as well as those created by sexual crosses or asexual propagation from the initial transgenic event, and does not encompass the alteration of the genome (chromosomal or extra-chromosomal) by conventional plant breeding methods or by naturally occurring events such as random cross-fertilization, non- recombinant viral infection, non-recombinant bacterial transformation, non- recombinant transposition, or spontaneous mutation.

A "control" or "control plant" or "control plant cell" provides a reference point for measuring changes in phenotype of a subject plant or plant cell which was geneticallyaltered by, such as transformation, and has been affected as to a gene of interest. A subject plant or plant cell may be descended from a plant or cell so altered and will comprise the alteration. A control plant or plant cell may comprise, for example: (a) a wild-type plant or cell, i.e., of the same genotype as the starting material for the genetic alteration which resulted in the subject plant or cell; (b) a plant or plant cell of the same genotype as the starting material but which has been transformed with a null construct (i.e., with a construct which has no known effect on the trait of interest, such as a construct comprising a marker gene); (c) a plant or plant cell which is a non-transformed segregant among progeny of a subject plant or plant cell; (d) a plant or plant cell genetically identical to the subject plant or plant cell but which is not exposed to a condition or stimulus that would induce expression of the gene of interest; or (e) the subject plant or plant cell itself, under conditions in which the gene of interest is not expressed.

"Genome" as it applies to plant cells encompasses not only chromosomal DNA found within the nucleus, but also organelle DNA found within subcellular

components (e.g., mitochondria, plastid) of the cell.

"Plant" includes reference to whole plants, plant organs, plant tissues, seeds and plant cells and progeny of the same. Plant cells include, without limitation, cells from seeds, suspension cultures, embryos, meristematic regions, callus tissues, leaves, roots, shoots, gametophytes, sporophytes, pollen, and microspores.

"Progeny" comprises any subsequent generation of a plant.

"Transgenic plant" includes reference to a plant which comprises within its genome a heterologous polynucleotide. For example, the heterologous

polynucleotide is stably integrated within the genome such that the polynucleotide is passed on to successive generations. The heterologous polynucleotide may be integrated into the genome alone or as part of a recombinant DNA construct. A TO plant is directly recovered from the transformation and regeneration process.

Progeny of TO plants are referred to as T1 (first progeny generation), T2 (second progeny generation), etc.

"Heterologous" with respect to sequence means a sequence that originates from a foreign species, or, if from the same species, is substantially modified from its native form in composition and/or genomic locus by deliberate human intervention.

"Polynucleotide", "nucleic acid sequence", "nucleotide sequence", and "nucleic acid fragment" are used interchangeably and refer to a polymer of RNA or DNA that is single- or double-stranded, optionally containing synthetic, non-natural or altered nucleotide bases. Nucleotides (usually found in their 5'-monophosphate form) are referred to by their single-letter designation as follows: "A" for adenylate or deoxyadenylate, "C" for cytidylate or deoxycytidylate, and "G" for guanylate or deoxyguanylatefor RNA or DNA, respectively; "U" for uridylate;"T" for

deoxythymidylate;"R" for purines (A or G);"Y" for pyrimidines (C or T);"K" for G or T;"H" for A or C or T;"l" for inosine;and "N" for any nucleotide.

"Polypeptide", "peptide", "amino acid sequence" and "protein" are used interchangeably herein to refer to a polymer of amino acid residues. The terms apply to amino acid polymers in which one or more amino acid residue is an artificial chemical analogue of a corresponding naturally occurring amino acid, as well as to naturally occurring amino acid polymers. The terms "polypeptide", "peptide", "amino acid sequence", and "protein" are also inclusive of modifications including, but not limited to, glycosylation, lipid attachment, and sulfation, gamma-carboxylation of glutamic acid residues, hydroxylation and ADP-ribosylation.

"Messenger RNA (mRNA)" refers to the RNA whichhas no intron and can be translated into protein by the cell.

"cDNA" refers to a DNA that is complementary to and synthesized from an mRNA template using reverse transcriptase. The cDNA can be single-stranded or converted into the double-stranded form using the Klenow fragment of DNA polymerase I.

"Mature" protein refers to a post-translationally processed polypeptide; i.e., any pre- or pro-peptides present in the primary translation product has been removed.

"Precursor" protein refers to the primary product of translation of mRNA; i.e., with pre- and pro-peptides still present. Pre- and pro-peptides may be and are not limited to intracellular localization signals.

"Isolated" refers to materials, such as nucleic acid molecules and/or proteins, which are substantially free or otherwise removed from components that normally accompany or interact with the materials in a naturally occurring environment.

Isolated polynucleotides may be purified from a host cell in which they naturally occur. Conventional nucleic acid purification methods known to skilled artisans may be used to obtain isolated polynucleotides. The term also embraces recombinant polynucleotides and chemically synthesized polynucleotides.

"Recombinant" refers to an artificial combination of two otherwise separated segments of sequence, e.g., by chemical synthesis or by the manipulation of isolated segments of nucleic acids by genetic engineering techniques. "Recombinant" also includes reference to a cell or vector, that has been modified by the introduction of a heterogonous nucleic acid or a cell derived from a cell so modified, but does not encompass the alteration of the cell or vector by naturally occurring events (e.g., spontaneous mutation, natural transformation/transduction/transposition) such as those occurring without deliberate human intervention.

"Recombinant DNA construct" refers to a combination of nucleic acid fragments that are not normally found together in nature. Accordingly, a recombinant DNA construct may comprise regulatory sequences and coding sequences that are derived from different sources, or regulatory sequences and coding sequences derived from the same source, but arranged in a manner different than that normally found in nature.

The terms "entry clone" and "entry vector" are used interchangeably herein.

"Regulatory sequences" refer to nucleotide sequences located upstream (5' non- coding sequences), within, or downstream (3' non-coding sequences) of a coding sequence, and influencing the transcription, RNA processing or stability, or translation of the associated coding sequence. Regulatory sequences may include, but are not limited to, promoters, translation leader sequences, introns, and poly- adenylation recognition sequences. The terms "regulatory sequence" and "regulatory element" are used interchangeably herein.

"Promoter" refers to a nucleic acid fragment capable of controlling transcription of another nucleic acid fragment.

"Promoter functional in a plant" is a promoter capable of controllingtranscription of genes in plant cells whether or not its origin is from a plant cell.

"Tissue-specific promoter" and "tissue-preferred promoter"may refer to a promoter that is expressed predominantly but not necessarily exclusively in one tissue or organ, but that may also be expressed in one specific cell or cell type.

"Developmentally regulated promoter" refers to a promoter whose activity is determined by developmental events.

"Operably linked" refers to the association of nucleic acid fragments in a single fragment so that the function of one is regulated by the other. For example, a promoter is operably linked with a nucleic acid fragment when it is capable of regulating the transcription of that nucleic acid fragment.

"Expression" refers to the production of a functional product. For example, expression of a nucleic acid fragment may refer to transcription of the nucleic acid fragment (e.g., transcription resulting in mRNA or functional RNA) and/or translation of mRNA into a precursor or mature protein.

"Phenotype" means the detectable characteristics of a cell or organism.

"Introduced" in the context of inserting a nucleic acid fragment (e.g., a

recombinant DNA construct) into a cell, means "transfection" or "transformation" or "transduction" and includes reference to the incorporation of a nucleic acid fragment into a eukaryotic or prokaryotic cell where the nucleic acid fragment may be incorporated into the genome of the cell (e.g., chromosome, plasmid, plastid or mitochondrial DNA), converted into an autonomous replicon, or transiently

expressed (e.g., transfected mRNA).

A "transformed cell" is any cell into which a nucleic acid fragment (e.g., a recombinant DNA construct) has been introduced.

"Transformation" as used herein refers to both stable transformation and transient transformation.

"Stable transformation" refers to the introduction of a nucleic acid fragment into a genome of a host organism resulting in genetically stable inheritance. Once stably transformed, the nucleic acid fragment is stably integrated in the genome of the host organism and any subsequent generation.

"Transient transformation" refers to the introduction of a nucleic acid fragment into the nucleus, or DNA-containing organelle, of a host organism resulting in gene expression without genetically stable inheritance.

An "allele" is one of two or more alternative forms of a gene occupying a given locus on a chromosome. When the alleles present at a given locus on a pair of homologous chromosomes in a diploid plant are the same, that plant is homozygous at that locus. If the alleles present at a given locus on a pair of homologous chromosomes in a diploid plant differ, that plant is heterozygous at that locus. If a transgene is present on one of a pair of homologous chromosomes in a diploid plant, that plant is hemizygous at that locus.

A "chloroplast transit peptide" is an amino acid sequence which is translated in conjunction with a protein and directs the protein to the chloroplast or other plastid types present in the cell in which the protein is made. "Chloroplast transit sequence" refers to a nucleotide sequence that encodes a chloroplast transit peptide. A "signal peptide" is an amino acid sequence which is translated in conjunction with a protein and directs the protein to the secretory system (Chrispeels. (1991 ) Ann. Rev. Plant Phys. Plant Mol. Biol. 42:21 -53). If the protein is to be directed to a vacuole, a vacuolar targeting signal (supra) can further be added, or if to the endoplasmic reticulum, an endoplasmic reticulum retention signal (supra) may be added. If the protein is to be directed to the nucleus, any signal peptide present should be removed and instead a nuclear localization signal included (Raikhel. (1992) Plant Phys. 100Ά 627-1632). A "mitochondrial signal peptide" is an amino acid sequence which directs a precursor protein into the mitochondria (Zhang and Glaser. (2002) Trends Plant Sci 7:14-21 ).

Methods to determine the relationship of various polynucleotide and polypeptide sequences are known. As used herein, "reference sequence" is a defined sequence used as a basis for sequence comparison. A reference sequence may be a subset or the entirety of a specified sequence, such as a segment of a full-length cDNA or gene sequence, or may be the complete cDNA or gene sequence. As used herein, "comparison window" makes reference to a contiguous and specified segment of a polynucleotide or polypeptide sequence, wherein the sequence in the comparison window may comprise additions or deletions (i.e., gaps) compared to the reference sequence (which does not comprise additions or deletions) for optimal alignment of the two sequences. Generally, the comparison window is at least 20 contiguous nucleotides or amino acids in length, and optionally can be 30, 40, 50, 100 or longer. Those of skill in the art understand that to avoid a high similarity to a reference sequence due to inclusion of gaps in the sequence, a gap penalty is typically introduced and is subtracted from the number of matches.

The determination of percent sequence identity between any two sequences can be accomplished using a mathematical algorithm. Examples of such

mathematical algorithms for sequence comparison include the algorithm of Myers and Miller.(1988) CABIOS 4:1 1 -17; the local alignment algorithm of Smith, et al. (1981 ) Adv. Appl. Math.2A82; the global alignment algorithm of Needleman and Wunsch.(1970) J. Mol. Biol. 48:443-453; the search-for-local alignment method of Pearson and Lipman.(1988) Proc. Natl. Acad. Sci. 85:2444-2448; the algorithm of Karlin and Altschul.(1990) Proc. Natl. Acad. Sci. USA 872264, modified as in Karlin and Altschul.(1993) Proc. Natl. Acad. Sci. USA 90:5873-5877.

Computer implementations of these mathematical algorithms can be utilized for comparison of sequences to determine sequence identity. Such implementations include, but are not limited to: CLUSTAL in the PC/Gene program (available from Intelligenetics, Mountain View, California); the ALIGN program (Version 2.0) and GAP, BESTFIT, BLAST, FASTA and TFASTA in the GCG Wisconsin Genetics Software Package, Version 10 (available from Accelrys Inc., 9685 Scranton Road, San Diego, California, USA); and the Megalign® program of the LASERGENE® bioinformatics computing suite (DNASTAR® Inc., Madison, Wl).

Alignments using these programs can be performed using the default parameters. The CLUSTAL program is well described by Higgins, et al. (1988) Gene 73:237-244; Higgins, et al. (1989) CABIOS 5:151 -153; Corpet, et al. (1988) Nucleic Acids Res. 16:10881 -10890; Huang, et al. (1992) CABIOS 8:155-165 and Pearson, et al. (1994) Meth. Mol. Biol. 24:307-331 . The ALIGN program is based on the algorithm of Myers and Miller, (1988) supra. A PAM120 weight residue table, a gap length penalty of 12 and a gap penalty of 4 can be used with the ALIGN program when comparing amino acid sequences. The BLAST programs of Altschul, et al. (1990) J. Mol. Biol. 215:403 are based on the algorithm of Karl in and Altschul. (1990) supra. BLAST nucleotide searches can be performed with the BLASTN program, score = 100, wordlength = 12, to obtain nucleotide sequences homologous to a nucleotide sequence encoding a protein of the inventions. BLAST protein searches can be performed with the BLASTX program, score = 50, wordlength = 3, to obtain amino acid sequences homologous to a protein or polypeptide of the inventions. To obtain gapped alignments for comparison purposes, Gapped BLAST (in BLAST 2.0) can be utilized as described in Altschul, et al. (1997) Nucleic Acids Res. 25:3389. Alternatively, PSI-BLAST (in BLAST 2.0) can be used to perform an iterated search that detects distant relationships between molecules (Altschul, et al. (1997) supra). When utilizing BLAST, Gapped BLAST, PSI-BLAST andthe default parameters of the respective programs (e.g., BLASTN for nucleotide sequences, BLASTX for proteins) can be used (the National Center for Biotechnology Information of the National Library of Medicine of the National Institutes of Health of the U.S.

government). Alignment may also be performed by manual inspection.

Paired sequence identity/similarity values can be obtained using GAP Version 10 with the following parameters: % identity and % similarity for a nucleotide sequence using GAP Weight of 50 and Length Weight of 3 and the nwsgapdna.cmp scoring matrix; % identity and % similarity for an amino acid sequence using GAP Weight of 8 and Length Weight of 2, and the BLOSUM62 scoring matrix; or any equivalent program thereof. By "equivalent program" is intended any sequence comparison program that, for any two sequences in question, generates an alignment having identical nucleotide or amino acid residue matches and an identical percent sequence identity when compared to the corresponding alignment generated by GAP Version 10.

GAP uses the algorithm of Needleman and Wunsch. (1970) J. Mol. Biol. 48:443-

453, to find the alignment of two complete sequences that maximizes the number of matches and minimizes the number of gaps. GAP considers all possible alignments and gap positions and creates the alignment with the largest number of matched bases and the fewest gaps. It allows for the provision of a gap creation penalty and a gap extension penalty in units of matched bases. GAP must make a profit of gap creation penalty number of matches for each gap it inserts. If a gap extension penalty greater than zero is chosen, GAP must, in addition, make a profit for each gap inserted of the length of the gap times the gap extension penalty. Default gap creation penalty values and gap extension penalty values in Version 10 of the GCG Wisconsin Genetics Software Package for protein sequences are 8 and 2,

respectively. For nucleotide sequences the default gap creation penalty is 50 while the default gap extension penalty is 3. The gap creation and gap extension penalties can be expressed as an integer selected from the group of integers consisting of from 0 to 200. Thus, for example, the gap creation and gap extension penalties can be 0, 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65 or greater.

GAP presents one member of the family of best alignments. There may be many members of this family, but no other member has a better quality. GAP displays four figures of merit for alignments: Quality, Ratio, Identity and Similarity. The Quality is the metric maximized in order to align the sequences. Ratio is the Quality divided by the number of bases in the shorter segment. Percent Identity is the percent of the symbols that actually match. Percent Similarity is the percent of the symbols that are similar. Symbols that are across from gaps are ignored. A similarity is scored when the scoring matrix value for a pair of symbols is greater than or equal to 0.50, the similarity threshold. The scoring matrix used in Version 10 of the GCG Wisconsin Genetics Software Package is BLOSUM62 (Henikoff and Henikoff. (1989) Proc. Natl. Acad. Sci. USA 89:10915).

Unless stated otherwise, multiple alignments of the sequences provided herein is performed using the Clustal V method of alignment (Higgins and Sharp. (1989) CABIOS. 5:151 -153) with the default parameters (GAP PENALTY=10, GAP LENGTH PENALTY=10). Default parameters for pairwise alignments and calculation of percent identity of amino acidsequences using the Clustal V method are

KTUPLE=1 , GAP PENALTY=3, WINDOW=5 and DIAGONALS SAVED=5. For nucleic acids these parameters are KTUPLE=2, GAP PENALTY=5, WINDOW=4 and DIAGONALS SAVED=4. After alignment of the sequences, using the Clustal V program, it is possible to obtain "percent identity" and "divergence" values by viewing the "sequence distances" table on the same program; unless stated otherwise, percent identities and divergences provided and claimed herein were calculated in this manner.

As used herein, "sequence identity" or "identity" in the context of two

polynucleotides or polypeptide sequences makes reference to the residues in the two sequences that are the same when aligned for maximum correspondence over a specified comparison window. When percentage of sequence identity is used in reference to proteins it is recognized that residue positions which are not identical often differ by conservative amino acid substitutions, where amino acid residues are substituted for other amino acid residues with similar chemical properties (e.g., charge or hydrophobicity) and therefore do not change the functional properties of the molecule. When sequences differ in conservative substitutions, the percent sequence identity may be adjusted upwards to correct for the conservative nature of the substitution. Sequences that differ by such conservative substitutions are said to have "sequence similarity" or "similarity". Means for making this adjustment are well known to those of skill in the art. Typically this involves scoring a conservative substitution as a partial rather than a full mismatch, thereby increasing the

percentage sequence identity. Thus, for example, where an identical amino acid is given a score of 1 and a non-conservative substitution is given a score of zero, a conservative substitution is given a score between zero and 1 . The scoring of conservative substitutions is calculated, e.g., as implemented in the program

PC/GENE (Intelligenetics, Mountain View, California).

As used herein, "percentage of sequence identity" is calculated by determining the number of positions at which the identical nucleic acid base or amino acid residue occurs in both sequences to yield the number of matched positions, dividing the number of matched positions by the total number of positions in the window of comparison, and multiplying the result by 100. Standard recombinant DNA and molecular cloning techniques used herein are well known in the art and are described more fully in Sambrook, J., Fritsch, E.F. and Maniatis, T. Molecular Cloning: A Laboratory Manual; Cold Spring Harbor Laboratory Press: Cold Spring Harbor, 1989 (hereinafter "Sambrook").

Embodiments include isolated polynucleotides and polypeptides, and

recombinant DNA constructs useful for conferring drought tolerance;compositions (such as plants or seeds) comprising these recombinant DNA constructs;and methods utilizing these recombinant DNA constructs.

Isolated Polynucleotides and Polypeptides:

The present disclosure includes the following isolated polynucleotides and polypeptides:

An isolated polynucleotide comprising: (i) a nucleic acid sequence encoding a polypeptide having at least 50%, 51 %, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61 %, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71 %, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81 %, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity, based on the Clustal V method of alignment, to SEQ ID NO:5; or (ii) a full complement of the nucleic acid sequence of (i), wherein the full complement and the nucleic acid sequence of (i) consist of the same number of nucleotides and are 100% complementary. Any of the foregoing isolated polynucleotides may be utilized in any recombinant DNA constructs (including suppression DNA constructs) of the present disclosure. Overexpression of the encoded polypeptide preferably increases plant drought toleranceactivity.

An isolated polypeptide having an amino acid sequence of at Ieast50%, 51 %, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61 %, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71 %, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81 %, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity, based on the Clustal V method of alignment,to SEQ ID NO:5. The polypeptide is preferably an

OsWRKY66polypeptide. Over-expression of the polypeptide preferably increases plant drought tolerance activity.

An isolated polynucleotide comprising (i) a nucleic acid sequence of at least 50%, 51 %, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61 %, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71 %, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81 %, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity, based on the Clustal V method of alignment, to SEQ ID NO:3; or (ii)a nucleic acid sequence of at least 50%, 51 %, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61 %, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71 %, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81 %, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity, based on the Clustal V method of alignment, to SEQ ID NO:4; or (iii) a full

complement of the nucleic acid sequence of (i) or (ii). Any of the foregoing isolated polynucleotides may be utilized in any recombinant DNA constructs (including suppression DNA constructs) of the present disclosure. The isolated polynucleotide preferably encodesanOsWRKY66polypeptide.Overexpression of the

OsWRKY66polypeptide preferably improves plantdrought toleranceactivity.

Recombinant DNA Constructs and Suppression DNA Constructs:

In one aspect, the present disclosure includes recombinant DNA constructs

(including suppression DNA constructs).

In one embodiment, a recombinant DNA construct comprises a polynucleotide operably linked to at least one regulatory sequence (e.g., a promoter functional in a plant), wherein the polynucleotide comprises (i) a nucleic acid sequence encoding an amino acid sequence of at least 50%, 51 %, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61 %, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71 %, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81 %, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity, based on the Clustal V method of alignment, to SEQ ID NO:5; or (ii) a full complement of the nucleic acid sequence of (i).

In another embodiment, a recombinant DNA construct comprises a

polynucleotide operably linked to at least one regulatory sequence (e.g., a promoter functional in a plant), wherein said polynucleotide comprises (i) a nucleic acid sequence of at least 50%, 51 %, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61 %, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71 %, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81 %, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity, based on the Clustal V method of alignment, to SEQ ID NO:3; or (ii) a nucleic acid sequence of at least 50%, 51 %, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61 %, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71 %, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81 %, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity, based on the Clustal V method of alignment, to SEQ ID NO:4;or (iii) a full complement of the nucleic acid sequence of (i) or (ii).

In another embodiment, a recombinant DNA construct comprises a

polynucleotide operably linked to at least one regulatory sequence (e.g., a promoter functional in a plant), wherein said polynucleotide encodes a WRKY66polypeptide. The WRKY66 polypeptide preferably has drought tolerance activity.The WRKY66 polypeptidemay be from, for example, Oryza sativa,Arabidopsis thaliana, Zea mays, Glycine max, Glycine tabacina, Glycine sojaorGlycine tomentella.

In another aspect, the present disclosure includes suppression DNA constructs. A suppression DNA construct may comprise at least one regulatory sequence (e.g., a promoter functional in a plant) operably linked to (a) all or part of: (i) a nucleic acid sequence encoding a polypeptide having an amino acid sequence of at least 50%, 51 %, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61 %, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71 %, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81 %, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity, based on the Clustal V method of alignment, to SEQ ID NO:5, or (ii) a full complement of the nucleic acid sequence of (a)(i); or (b) a region derived from all or part of a sense strand or antisense strand of a target gene of interest, said region having a nucleic acid sequence of at least 50%, 51 %, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61 %, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71 %, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81 %, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity, based on the Clustal V method of alignment, when compared to said all or part of a sense strand or antisense strand from which said region is derived, and wherein said target gene of interest encodes a WRKY66polypeptide; or (c) all or part of: (i) a nucleic acid sequence of at least 50%, 51 %, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61 %, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71 %, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81 %, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity, based on the Clustal V method of alignment, to SEQ ID NO:3,or (ii) a nucleic acid sequence of at least 50%, 51 %, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61 %, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71 %, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81 %, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity, based on the Clustal V method of alignment, to SEQ ID NO:4, or (iii) a full complement of the nucleic acid sequence of (c)(i) or (c)(ii). The suppression DNA construct may comprise a cosuppression construct, antisense construct, viral-suppression construct, hairpin suppression construct, stem-loop suppression construct, double-stranded RNA- producing construct, RNAi construct, or small RNA construct (e.g., an siRNA construct or an miRNA construct).

It is understood, as those skilled in the art will appreciate, that the invention encompasses more than the specific exemplary sequences. Alterations in a nucleic acid fragment which result in the production of a chemically equivalent amino acid at a given site, but do not affect the functional properties of the encoded polypeptide, are well known in the art. For example, a codon for the amino acid alanine, a hydrophobic amino acid, may be substituted by a codon encoding another less hydrophobic residue, such as glycine, or a more hydrophobic residue, such as valine, leucine, or isoleucine. Similarly, changes which result in substitution of one

negatively charged residue for another, such as aspartic acid for glutamic acid, or one positively charged residue for another, such as lysine for arginine, can also be expected to produce a functionally equivalent product. Nucleotide changes which result in alteration of the N-terminal and C-terminal portions of the polypeptide molecule would also not be expected to alter the activity of the polypeptide. Each of the proposed modifications is well within the routine skill in the art, as is

determination of retention of biological activity of the encoded products.

"Suppression DNA construct" is a recombinant DNA construct which when transformed or stably integrated into the genome of the plant, results in "silencing" of a target gene in the plant. The target gene may be endogenous or transgenic to the plant. "Silencing", as used herein with respect to the target gene, refers generally to the suppression of levels of mRNA or protein/enzyme expressed by the target gene, and/or the level of the enzyme activity or protein functionality. The terms

"suppression", "suppressing" and "silencing", used interchangeably herein, include lowering, reducing, declining, decreasing, inhibiting, eliminatingor preventing. "Silencing" or "gene silencing" does not specify mechanism and is inclusive of, and not limited to, anti-sense, cosuppression, viral-suppression, hairpin suppression, stem-loop suppression, RNAi-based approaches, and small RNA-based approaches.

A suppression DNA construct may comprise a region derived from a target gene of interest and may comprise all or part of the nucleic acid sequence of the sense strand (or antisense strand) of the target gene of interest. Depending upon the approach to be utilized, the region may be 100% identical or less than 100%

identical (e.g., at least 50%, 51 %, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61 %, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71 %, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81 %, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical) to all or part of the sense strand (or antisense strand) of the gene of interest.

Suppression DNA constructs are well-known in the art, are readily constructed once the target gene of interest is selected, and include, without limitation,

cosuppression constructs, antisense constructs, viral-suppression constructs, hairpin suppression constructs, stem-loop suppression constructs, double-stranded RNA- producing constructs, and more generally, RNAi (RNA interference) constructs and small RNA constructs such as siRNA (short interfering RNA) constructs and miRNA (microRNA) constructs.

"Antisense inhibition" refers to the production of antisense RNA transcripts capable of suppressing the expression of the target gene or gene product. "Antisense RNA" refers to an RNA transcript that is complementary to all or part of a target primary transcript or mRNA and that blocks the expression of a target isolated nucleic acid fragment (for example, U .S. Patent No. 5,107,065). The

complementarity of an antisense RNA may be with respect to any part of the specific gene transcript, i.e., at the 5' non-coding sequence, 3' non-coding sequence, introns, or the coding sequence.

"Cosuppression" refers to the production of sense RNA transcripts capable of suppressing the expression of the target gene or gene product. "Sense" RNA refers to RNA transcript that includes the mRNA and can be translated into protein within a cell or in vitro. Cosuppression constructs in plants have been previously designed by focusing on overexpression of a nucleic acid sequence having homology to a native mRNA, in the sense orientation, which results in the reduction of all RNA having homology to the overexpressed sequence (Vaucheret et al.(1998)P/anf J. 16:651 - 659; and Gura. (2000)Nature 404:804-808).

Another variation describes the use of plant viral sequences to direct the suppression of proximal mRNA encoding sequences (PCT Publication No. WO 98/36083 published on August 20, 1998).

RNA interference (RNAi)refers to the process of sequence-specific post- transcriptional gene silencing (PTGS)in animals mediated by short interfering RNAs (siRNAs) (Fire et al.(1998)/Vafure 391 :806). The corresponding process in plants is commonly referred to as PTGSor RNA silencing and is also referred to as quelling in fungi. The process of PTGSis thought to be an evolutionarily-conserved cellular defense mechanism used to prevent the expression of foreign genes and is

commonly shared by diverse flora and phyla (Fire et al.(1999) Trends Genet. 15:358).

Small RNAs play an important role in controlling gene expression, forexample, small RNAs regulatemany developmental processes whichinclude flowering. It is now possible to engineer changes in gene expression of plant genes by using transgenic constructs which produce small RNAs in the plant.

Small RNAs appear to function by base-pairing to complementary RNA or DNA target sequences. When bound to RNA, small RNAs trigger either RNA cleavage or translational inhibition of the target sequence. When bound to DNA target sequences, it is thought that small RNAs can mediate DNA methylation of the target sequence. The consequence of these events, regardless of the specific mechanism, is that gene expression is inhibited.

MicroRNAs (miRNAs) are noncoding RNAs of about 19 to 24 nucleotides (nt) in length that have been identified in both animals and plants (Lagos-Quintana et al. (2001 )Science 294:853-858, Lagos-Quintana et al. (2002)Curr. Biol. 12:735-739;

Lau et al. (2001 )Science 294:858-862; Lee and Ambros.(2001 ) Science 294:862-864; Llave et al. (2002)Plant Cell 14:1605-1619; Mourelatos et al.(2002)Genes Dev.

16:720-728; Park et al. (2002)Curr. Biol. 12:1484-1495; Reinhart et al. (2002)Genes. Dev. 16:1616-1626). They are processed from longer precursor transcripts that range in size from approximately 70 to 200 nt, and these precursor transcripts have the ability to form stable hairpin structures.

miRNAs appear to regulate target genes by binding to complementary

sequences located in the transcripts produced by these genes. It seems likely that miRNAs can enter at least two pathways of target gene regulation: (1 ) translational inhibition; and (2) RNA cleavage. miRNAs entering the RNA cleavage pathway are analogous to the 21 -25 nt siRNAs generated during RNAi in animals and PTGS in plants, and likely are incorporated into an RNA-induced silencing complex (RISC) that is similar or identical to that seen for RNAi.

Regulatory Sequences:

A recombinant DNA construct (including a suppression DNA construct) of the present disclosuremay comprise at least one regulatory sequence.

A regulatory sequence may be a promoter.

A number of promoters can be used in recombinant DNA constructs of the present disclosure. The promoters can be selected based on the desired outcome, and may include constitutive, tissue-specific, inducible, or other promoters for expression in the host organism.

Promoters that cause a gene to be expressed in most cell types at most times are commonly referred to as "constitutive promoters".

High-level, constitutive expression of the candidate gene under control of the

35S or UBI promoter may have pleiotropic effects, although candidate gene efficacy may be estimated when driven by a constitutive promoter.Use of tissue-specific and/or stress-inducedpromoters may eliminate undesirable effects but retain the ability to enhance drought tolerance. This effect has been observed in Arabidopsis (Kasuga et al. (1999) Nature Biotechnol. 17:287-91 ).

Suitable constitutive promoters for use in a plant host cell include, for example, the core promoter of the Rsyn7 promoter and other constitutive promoters disclosed in WO 99/43838 and U.S. Patent No. 6,072,050; the core CaMV 35S promoter (Odell et al. (1985)Nature 313:810-812); rice actin (McElroy et al. (1990)P/anf Cell 2:163-171 ); ubiquitin (Christensen et al. (1989)Plant Mol. Biol. 12:619-632 and

Christensen et al.(1992)P/anf Mol. Biol. 18:675-689); pEMU (Last et al. (1991 )Theor. Appl. Genet. 81 :581 -588); MAS (Velten et al.(1984)EMBO J. 3:2723-2730); ALS promoter (U.S. Patent No. 5,659,026), and the like. Other constitutive promoters include, for example, those discussed in U.S. Patent Nos. 5,608,149; 5,608,144; 5,604,121 ; 5,569,597; 5,466,785; 5,399,680; 5,268,463; 5,608,142; and 6,177,61 1 .

In choosing a promoter to use in the methods of the invention, it may be desirable to use a tissue-specific or developmentally regulated promoter.

A tissue-specific or developmentally-regulated promoter is a DNA sequence which regulates the expression of a DNA sequence selectively in the cells/tissues of a plant, such as in those cells/tissues critical to tassel development, seed set, or both, and which usually limits the expression of such a DNA sequence to the

developmental period of interest (e.g. tassel development or seed maturation) in the plant. Any identifiable promoter which causes the desired temporal and spatial expressionmay be used in the methods of the present disclosure.

Many leaf-preferred promoters are known in the art (Yamamoto et al. (1997) Plant J. 12(2):255-265; Kwon et al. (1994) Plant Physiol. 105:357-367; Yamamoto et al. (1994) Plant Cell Physiol. 35(5):773-778; Gotor et al. (1993) Plant J. 3:509-518; Orozco et al. (1993) Plant Mol. Biol. 23(6):1 129-1 138; and Matsuoka et al. (1993) Proc. Natl. Acad. Sci. USA 90(20):9586-9590).

Promoters which are seed or embryo-specific and may be useful in the invention include soybean Kunitz trypsin inhibitor (Kti3, Jofuku and Goldberg. (1989)P/anf Cell 1 :1079-1093), convicilin, vicilin, and legumin (pea cotyledons) (Rerie, W.G., et al. (1991 ) Mol. Gen. Genet. 259:149-157; Newbigin, E.J., et al. (1990) Planta 180:461 - 470; Higgins, T.J.V., et al. (1988) Plant. Mol. Biol. 1 1 :683-695), zein (maize

endosperm) (Schemthaner, J. P., et al. (1988) EMBO J. 7:1249-1255), phaseolin (bean cotyledon) (Segupta-Gopalan, C, et al. (1985) Proc. Natl. Acad. Sci. 82:3320- 3324), phytohemagglutinin (bean cotyledon) (Voelker, T. et al. (1987) EMBO J.

6:3571 -3577), B-conglycinin and glycinin (soybean cotyledon) (Chen, Z-L, et al.

(1988) EMBO J. 7:297-302), glutelin (rice endosperm), hordein (barley endosperm) (Marris, C, et al. (1988) Plant Mol. Biol. 10:359-366), glutenin and gliadin (wheat endosperm) (Colot, V., et al. (1987) EMBO J. 6:3559-3564). Promoters of seed- specific genes operably linked to heterologous coding regions in chimeric gene constructions maintain their temporal and spatial expression pattern in transgenic plants. Such examples include Arabidopsis 2S seed storage protein gene promoter to express enkephalin peptides in Arabidopsis and Brassica napus seeds

(Vanderkerckhove et a\.^ 989)Bio/Technology 7:L929-932), bean lectin and bean beta-phaseolin promoters to express luciferase (Riggs et al. (1989)P/anf Sci. 63:47- 57), and wheat glutenin promoters to express chloramphenicol acetyl transferase (Colot et al. (1987)EMBO J 6:3559-3564).

Inducible promoters selectively express an operably linked DNA sequence in response to the presence of an endogenous or exogenous stimulus, for example by chemical compounds (chemical inducers) or in response to environmental, hormonal, chemical, and/or developmental signals. Inducible or regulated promoters include, for example, promoters regulated by light, heat, stress, flooding or drought, phytohormones, wounding, or chemicals such as ethanol, jasmonate, salicylic acid, or safeners.

Promoters for use in certain embodiments include the following: 1 ) the stress- induciblepromoter RD29A (Kasuga et al. (1999)/Vafure Biotechnol. 17:287-291 ); 2) the stress-inducible promoter Rab17 (Vilardell et al. (1991 ) Plant Mol. Bio. 17:985- 993; Kamp Busk et al. (1997) Plant J 1 1 (6): 1285-1295); 3)the barley promoterB22E whose expression is specific to the pedicel in developing maize kernels ("Primary Structure of a Novel Barley Gene Differentially Expressed in Immature Aleurone Layers". Klemsdal, S.S. et al. (1991 )Mo/. Gen. Genet. 228(1/2):9-16); and 4) maize promoter Zag2 ("Identification and molecular characterization of ZAG1 , the maize homolog of the Arabidopsis floral homeotic gene AGAMOUS", Schmidt, R.J. et al. (1993)P/anf Cell 5(7):729-737; "Structural characterization, chromosomal localization and phylogenetic evaluation of two pairs of AGAMOUS-Wke MADS-box genes from maize", Theissen et al.(1995)Gene 156(2):155-166; NCBI GenBank Accession No. X80206)). Zag2 transcripts can be detected 5 days prior to pollination to 7 to 8 days after pollination ("DAP"), and directs expression in the carpel of developing female inflorescences and Ciml which is specific to the nucleus of developing maize kernels. Ciml transcript is detected 4 to 5 days before pollination to 6 to 8 DAP. Other useful promoters include any promoter which can be derived from a gene whose

expression is maternally associated with developing female florets. For the

expression of a polynucleotide in developing seed tissue, promoters of particular interest include seed-preferred promoters, particularly early kernel/embryo promoters and late kernel/embryo promoters. Kernel development post-pollination is divided into approximately three primary phases. The lag phase of kernel growth occurs from about 0 to 10-12DAP. During this phase the kernel is not growing significantly in mass, but rather important events are being carried out that will determine kernel vitality (e.g., number of cells established). The linear grain fill stage begins at about 10-12 DAP and continues to about 40 DAP. During this stage of kernel development, the kernel attains almost all of its final mass, and various storage products (i.e., starch, protein, oil) are produced. Finally, the maturation phase occurs from about 40 DAP to harvest. During this phase of kernel development the kernel becomes quiescent and begins to dry down in preparation for a long period of dormancy prior to germination. As defined herein "early kernel/embryo promoters" are promoters that drive expression principally in developing seed during the lag phase of

development (i.e., from about 0 to about 12 DAP). "Late kernel/embryo promoters", as defined herein, drive expression principally in developing seed from about 12 DAP through maturation. There may be some overlap in the window of expression. The choice of the promoter will depend on the ABA-associated sequence utilized and the phenotype desired. Early kernel/embryo promoters include, for example, Cim1 that is active 5 DAP in particular tissues (WO 00/1 1 177), which is herein incorporated by reference. Other early kernel/embryo promoters include the seed- preferred promoters endl which is active 7-10 DAP, and enc/2, which is active 9-14 DAP in the whole kernel and active 10 DAP in the endosperm and pericarp. (WO 00/12733), herein incorporated by reference. Additional early kernel/embryo promoters that find use in certain methods of the present disclosure include the seed-preferred promoter /fp2(U.S. Pat. No. 5,525,716); maize Zm40 promoter (U.S. Pat. No. 6,403,862); maize nuc1c{\J.S. Pat. No. 6,407,315); maize ckx1-2 promoter (U.S. Pat. No. 6,921 ,815 and US Patent Application Publication Number

2006/0037103); maize led promoter (U.S. Pat. No. 7,122,658); maize ESR

promoter (U.S. Pat. No. 7,276,596); maize ZAP promoter (U.S. Patent Application Publication Numbers 20040025206 and 20070136891 ); maize promoter eep7(U.S. Patent Application Publication Number 20070169226); and maize promoter

ADF4(U.S. Patent Application No. 60/963,878, filed 7 Aug. 2007).

Additional promoters for regulating the expression of the nucleotide sequences of the present disclosure in plants are stalk-specific promoters, including the alfalfa S2A promoter (GenBank Accession No. EF030816; Abrahams et al. (1995)P/anf Mol. Biol. 27:513-528) and S2B promoter (GenBank Accession No. EF030817) and the like, herein incorporated by reference.

Promoters may be derived in their entirety from a native gene, or be composed of different elements derived from different promoters found in nature, or even comprise synthetic DNA segments.

Promoters for use in certain embodimentsof the current invention may include: RIP2, ml_IP15, ZmCORI , Rab17, CaMV 35S, RD29A, B22E, Zag2, SAM synthetase, ubiquitin, CaMV 19S, nos, Adh, sucrose synthase, R-allele, the vascular tissue preferred promoters S2A (Genbank accession number EF030816) and S2B

(Genbank accession number EF030817), and the constitutive promoter GOS2 from Zea mays; root preferred promoters, such as the maize NAS2 promoter, the maize Cyclo promoter (US 2006/0156439, published July 13, 2006), the maize ROOTMET2 promoter (WO05063998, published July 14, 2005), the CR1 BIO promoter

(WO06055487, published May 26, 2006), the CRWAQ81 (WO05035770, published April 21 , 2005) and the maize ZRP2.47 promoter (NCBI accession number: U38790; Gl No. 1063664).

Recombinant DNA constructs of the present disclosure may also include other regulatory sequences, including but not limited to, translation leader sequences, introns, and polyadenylation recognition sequences. In certain embodiments, a recombinant DNA construct further comprises an enhancer or silencer.

An intron sequence can be added to the 5' untranslated region, the protein- coding region or the 3' untranslated region to increase the amount of the mature message that accumulates in the cytosol. Inclusion of a spliceable intron in the transcription unit in both plant and animal expression constructs has been shown to increase gene expression at both the mRNA and protein levels up to 1000-fold (Buchman and Berg.(1988)Mo/. Cell Biol. 8:4395-4405; Callis et al. (1987)Genes Dev. 1 :1 183-1200).

Any plant can be selected for the identification of regulatory sequences and WRKY66polypeptide genes to be used in recombinant DNA constructs of the present disclosure. Examples of suitable plant targets for the isolation of genes and regulatory sequences would include but are not limited to alfalfa, apple, apricot, Arabidopsis, artichoke, arugula, asparagus, avocado, banana, barley, beans, beet, blackberry, blueberry, broccoli, brussels sprouts, cabbage, canola, cantaloupe, carrot, cassava, castorbean, cauliflower, celery, cherry, chicory, cilantro, citrus, Clementines, clover, coconut, coffee, corn, cotton, cranberry, cucumber, Douglas fir, eggplant, endive, escarole, eucalyptus, fennel, figs, garlic, gourd, grape, grapefruit, honey dew, jicama, kiwifruit, lettuce, leeks, lemon, lime, Loblolly pine, linseed, mango, melon, mushroom, nectarine, nut, oat, oil palm, oil seed rape, okra, olive, onion, orange,ornamental plant, palm, papaya, parsley, parsnip, pea, peach, peanut, pear, pepper, persimmon, pine, pineapple, plantain, plum, pomegranate, poplar, potato, pumpkin, quince, radiata pine, radicchio, radish, rapeseed, raspberry, rice, rye, sorghum, Southern pine, soybean, spinach, squash, strawberry, sugarbeet, sugarcane, sunflower, sweet potato, sweetgum, switchgrass, tangerine, tea, tobacco, tomato, triticale, turf, turnip, vine, watermelon, wheat, yams, and zucchini.

Compositions: A composition of the present disclosure is a plant comprising in its genome any of the recombinant DNA constructs (including any of the suppression DNA

constructs) of the present disclosure (such as any of the constructs discussed above). Compositions also include any progeny of the plant, and any seed obtained from the plant or its progeny, wherein the progeny or seed comprises within its genome the recombinant DNA construct (or suppression DNA construct). Progeny includes subsequent generations obtained by self-pollination or out-crossing of a plant. Progeny also includes hybrids and inbreds.

In hybrid seed propagated crops, mature transgenic plants can be self-pollinated to produce a homozygous inbred plant.The inbred plant produces seed containing the newly introduced recombinant DNA construct (or suppression DNA construct). These seeds can be grown to produce plants that would exhibit an altered

agronomic characteristics (e.g., an increased agronomic characteristicsoptionally under water limiting conditions), or used in a breeding program to produce hybrid seed, which can be grown to produce plants that would exhibit such an altered agronomic characteristics. The seeds may be maizeseeds or rice seeds.

The plant may be a monocotyledonous or dicotyledonous plant, for example, a rice or maize or soybean plant, such as a maize hybrid plant or a maize inbred plant. The plant may also be sunflower, sorghum, canola, wheat, alfalfa, cotton, rice, barley, millet, sugar cane or switchgrass.

The recombinant DNA construct may be stably integrated into the genome of the plant.

Particular embodiments include but are not limited to the following:

1 . A plant (for example, a rice or maize or soybean plant) comprising in its genome a recombinant DNA construct comprising a polynucleotide operably linked to at least one regulatory sequence, wherein said polynucleotide encodes a

polypeptide having an amino acid sequence of at least 50%, 51 %, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61 %, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71 %, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81 %, 82%, 83%, 84%,85%, 86%, 87%, 88%, 89%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity, based on the Clustal V method of alignment, to SEQ ID NO:5, and wherein said plant exhibits increased drought tolerance when compared to a control plant. The plant may further exhibit an alteration of at least one agronomic characteristics when compared to the control plant. 2. A plant (for example,a rice or maize or soybeanplant) comprising in its genome a recombinant DNA construct comprising a polynucleotide operably linked to at least one regulatory sequence, wherein said polynucleotide encodes a

WRKY66polypeptide, and wherein said plant exhibits increased drought tolerance when compared to a control plant. The plant may further exhibit an alteration of at least one agronomic characteristic when compared to the control plant.

3. A plant (for example,a rice or maize or soybeanplant) comprising in its genome a recombinant DNA construct comprising a polynucleotide operably linked to at least one regulatory sequence, wherein said polynucleotide encodes a

WRKY66polypeptide, and wherein said plant exhibits an alteration of at least one agronomic characteristics when compared to a control plant.

4. A plant (for example,a rice or maize or soybeanplant) comprising in its genome a recombinant DNA construct comprising a polynucleotide operably linked to at least one regulatory element, wherein said polynucleotide encodes a

polypeptide having an amino acid sequence of at least 50%, 51 %, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61 %, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71 %, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81 %, 82%, 83%, 84%,85%, 86%, 87%, 88%, 89%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity, based on the Clustal V method of alignment, to SEQ ID NO:5, and wherein said plant exhibits an alteration of at least one agronomic characteristic when compared to a control plant.

5. A plant (for example,a rice or maize or soybeanplant) comprising in its genome a suppression DNA construct comprising at least one regulatory element operably linked to a region derived from all or part of a sense strand or antisense strand of a target gene of interest, said region having a nucleic acid sequence of at least 50%, 51 %, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61 %, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71 %, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81 %, 82%, 83%, 84%,85%, 86%, 87%, 88%, 89%,90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity, based on the Clustal V method of alignment, to said all or part of a sense strand or antisense strand from which said region is derived, and wherein said target gene of interest encodes a WRKY66polypeptide, and wherein said plant exhibits an alteration of at least one agronomic characteristics when compared to a control plant. 6. A plant (for example,a rice or maize or soybeanplant) comprising in its genome a suppression DNA construct comprising at least one regulatory element operably linked to all or part of (a) a nucleic acid sequence encoding a polypeptide having an amino acid sequence of at least 50%, 51 %, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61 %, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%,

71 %, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81 %, 82%, 83%, 84%,85%, 86%, 87%, 88%, 89%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity, based on the Clustal V method of alignment, to SEQ ID NO:5, or (b) a full complement of the nucleic acid sequence of (a), and wherein said plant exhibits an alteration of at least one agronomic characteristics when compared to a control plant.

7. Any progeny of the above plants in embodiment 1 -6, any seeds of the above plants in embodiment 1 -6, any seeds of progeny of the above plants in embodiment 1 -6, and cells from any of the above plants in embodiment 1 -6 and progeny thereof.

In any of the foregoing embodiment 1 -7 or other embodiments, the

WRKY66polypeptidemay be from Oryza sativa, Arabidopsis thaliana, Zea mays, Glycine max, Glycine tabacina, Glycine soja or Glycine tomentella.

In any of the foregoing embodiment 1 -7 or other embodiments, the recombinant DNA construct (or suppression DNA construct) may comprise at least a promoter functional in a plant as a regulatory sequence.

In any of the foregoing embodiment 1 -7 or other embodiments, the alteration of at least one agronomic characteristic is either an increase or decrease.

In any of the foregoing embodiment 1 -7 or other embodiments, the at least one agronomic characteristics may be selected from the group consisting of greenness, grain yield, growth rate, biomass, fresh weight at maturation, dry weight at

maturation, fruit yield, seed yield, total plant nitrogen content, fruit nitrogen content, seed nitrogen content, nitrogen content in a vegetative tissue, total plant free amino acid content, fruit free amino acid content, seed free amino acid content, free amino acid content in a vegetative tissue, total plant protein content, fruit protein content, seed protein content, protein content in a vegetative tissue, drought tolerance, nitrogen uptake, root lodging, harvest index, stalk lodging, plant height, ear height, ear length, salt tolerance,tiller number, panicle size,early seedling vigor and seedling emergence under low temperature stress. For example, the alteration of at least one agronomic characteristicmay be an increase in grain yield, greennessor biomass. In any of the foregoing embodiment 1 -7 or other embodiments, the plant may exhibit the alteration of at least one agronomic characteristicswhen compared, under water limiting conditions, to a control plant.

"Drought" refers to a decrease in water availability to a plant that, especially when prolonged or when occurring during critical growth periods, can cause damage to the plant or prevent its successful growth (e.g., limiting plant growth or seed yield).

"Drought tolerance"reflects a plant's ability to survive under drought without exhibiting substantial physiological or physical deterioration, and/ or its ability to recover when water is restored following a period of drought.

"Drought tolerance activity" of a polypeptide indicates that overexpression of the polypeptide in a transgenic plant confers increased drought tolerance ofthe transgenic plant relative to a reference or control plant.

"Increased drought tolerance" of a plant is measured relative to a reference or control plant, and reflects ability of the plant to survive under drought conditions with less physiological or physical deterioration than a reference or control plant grown under similar drought conditions, or ability of the plant to recover more substantially and/or more quickly than would a control plant when water is restored following a period of drought.

One of ordinary skill in the art is familiar with protocols for simulating drought conditions and for evaluating drought tolerance of plants that have been subjected to simulated or naturally-occurring drought conditions. For example, one can simulate drought conditions by giving plants less water than normally required, or no water, over a period of time, and one can evaluate drought tolerance by observing and measuring differences in physiological and/or physical condition, including (but not limited to) vigor, overall growth, leaf color, or size or growth rate of one or more tissues (e.g. leaf or root). Other techniques for evaluating drought tolerance include measuring chlorophyll fluorescence, photosynthetic rates and gas exchange rates.

A drought stress experiment may involve a chronic stress (i.e., slow dry down) and/or may involve two acute stresses (i.e., abrupt removal of water) separated by a day or two of recovery. Chronic stress may last 8-20 days. Acute stress may last 3- 15 days. The examples below describe some representative protocols and

techniques for simulating drought conditions and/or evaluating drought tolerance.

One can also evaluate drought tolerance by the ability of a plant to maintain sufficient yield (at least 75%, 76%, 77%, 78%, 79%, 80%, 81 %, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% yield)in field testing under simulated or naturally-occurring drought conditions (e.g., by measuring for substantially equivalent yield under drought conditions compared to non-drought conditions, or by measuring for less yield loss under drought conditions compared to yield loss exhibited by a control or reference plant).

Parameters such as gene expression level, water use efficiency, level or activity of an encoded protein, and others are typically presented with reference to a control cell or control plant. A "control" or "control plant" or "control plant cell" provides a reference point for measuring changes in phenotype of a subject plant or plant cell in which genetic alteration, such as transformation, has been effected as to a gene of interest. A subject plant or plant cell may be descended from a plant or cell so altered and will comprise the alteration. One of ordinary skill in the art would readily recognize a suitable control or reference plant to be utilized when assessing or measuring an agronomic characteristics or phenotype of a transgenic plantusing compositions or methods as described herein. For example, by way of non-limiting illustrations:

1 . Progeny of a transformed plant which is hemizygous with respect to a recombinant DNA construct (or suppression DNA construct), such that the progeny are segregating into plants either comprising or not comprising the recombinant DNA construct (or suppression DNA construct): the progeny comprising the recombinant DNA construct (or suppression DNA construct) would be typically measured relative to the progeny not comprising the recombinant DNA construct (or suppression DNA construct). The progeny not comprising the recombinant DNA construct (or the suppression DNA construct) is the control or reference plant.

2. Introgression of a recombinant DNA construct (or suppression DNA construct) into an inbred line, such as in rice and maize, or into a variety, such as in soybean: the introgressed line would typically be measured relative to the parent inbred or variety line (i.e., the parent inbred or variety line is the control or reference plant).

3. Two hybrid lines, wherein the first hybrid line is produced from two parent inbred lines, and the second hybrid line is produced from the same two parent inbred lines except that one of the parent inbred lines contains a recombinant DNA construct (or suppression DNA construct): the second hybrid line would typically be measured relative to the first hybrid line (i.e., the first hybrid line is the control or reference plant).

4. A plant comprising a recombinant DNA construct (or suppression DNA construct): the plant may be assessed or measured relative to a control plant not comprising the recombinant DNA construct (or suppression DNA construct) but otherwise having a comparable genetic background to the plant (e.g., sharing at least 50%, 51 %, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61 %, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71 %, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81 %, 82%, 83%, 84%,85%, 86%, 87%, 88%, 89%,90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity of nuclear genetic material compared to the plant comprising the recombinant DNA construct (or suppression DNA construct)). There are many laboratory-based techniques available for the analysis, comparison and characterization of plant genetic

backgrounds; among these are Isozyme Electrophoresis, Restriction Fragment Length Polymorphisms (RFLPs), Randomly Amplified Polymorphic DNAs (RAPDs), Arbitrarily Primed Polymerase Chain Reaction (AP-PCR), DNA Amplification

Fingerprinting (DAF), Sequence Characterized Amplified Regions (SCARs),

Amplified Fragment Length Polymorphisms (AFLP®s), and Simple Sequence

Repeats (SSRs) which are also referred to as Microsatellites.

A control plant or plant cell may comprise, for example: (a) a wild-type (WT) plant or cell, i.e., of the same genotype as the starting material for the genetic alteration which resulted in the subject plant or cell; (b) a plant or plant cell of the same genotype as the starting material but which has been transformed with a null construct (i.e., with a construct which has no known effect on the trait of interest, such as a construct comprising a marker gene); (c) a plant or plant cell which is a non-transformed segregant among progeny of a subject plant or plant cell; (d) a plant or plant cell genetically identical to the subject plant or plant cell but which is not exposed to conditions or stimulus that would induce expression of the gene of interest or (e) the subject plant or plant cell itself, under conditions in which the gene of interest is not expressed. A control may comprise numerous individuals representing one or more of the categories above; for example, a collection of the non-transformed segregants of category "c" is often referred to as a bulk null.

Methods: Methods include but are not limited to methods for increasing drought tolerance in a plant, methods for evaluating drought tolerance in a plant, methods for altering an agronomic characteristic in a plant, methods for determining an alteration of an agronomic characteristic in a plant, and methods for producing seed. The plant may be a monocotyledonous or dicotyledonous plant, for example, a rice, maize or soybean plant. The plant may also be sunflower, canola, wheat, alfalfa, cotton, rice, barley, millet, sugar cane or sorghum. The seed may be a maize or soybean seed, for example, a maize hybrid seed or maize inbred seed.

Methods include but are not limited to the following:

A method for transforming a cell comprising transforming a cell with any one or more of the isolated polynucleotides of the present disclosure,wherein, in particular embodiments, the cell is eukaryotic cell, e.g., a yeast, insect or plant cell; or prokaryotic cell, e.g., a bacterial cell.

A method for producing a transgenic plant comprising transforming a plant cell with any of the isolated polynucleotides or recombinant DNA constructs (including suppression DNA constructs) of the present disclosure and regenerating a transgenic plant from the transformed plant cell,wherein, the transgenic plant and the transgenic seed obtained by this method may be used in other methods of the present disclosure.

A method for isolating a polypeptide of the invention from a cell or culture medium of the cell, wherein the cell comprises a recombinant DNA construct comprising a polynucleotide of the invention operably linked to at least one regulatory sequence, and wherein the transformed host cell is grown under conditions that are suitable for expression of the recombinant DNA construct.

A method foraltering the level of expression of a polypeptide of the invention in a host cell comprising: (a) transforming a host cell with a recombinant DNA construct of the present disclosure; and (b) growing the transformed host cell under conditions that are suitable for the expression of the recombinant DNA construct, wherein the expression of the recombinant DNA construct results in production of altered levels of the polypeptide of the invention in the transformed host cell.

A method of increasing drought tolerance in a plant, comprising: (a) introducing into a regenerable plant cell a recombinant DNA construct comprising a

polynucleotide operably linked to at least one regulatory sequence (for example, a promoter functional in a plant), wherein the polynucleotide encodes a polypeptide having an amino acid sequence of at least 50%, 51 %, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61 %, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71 %, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81 %, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity, based on the Clustal V method of alignment, to SEQ ID NO:5;(b) regenerating a transgenic plant from the regenerable plant cell after step (a), wherein the transgenic plant comprises in its genome the recombinant DNA construct andexhibits increased drought tolerance when compared to a control plant;andfurther (c) obtaining a progeny plant derived from the transgenic plant, wherein said progeny plant comprises in its genome the recombinant DNA construct and exhibits increased drought tolerance when compared to a control plant.

A method of evaluating drought tolerance in a plant comprising (a) obtaining a transgenic plant, which comprises in its genome a recombinant DNA construct comprising a polynucleotide operably linked to at least one regulatory sequence (for example, a promoter functional in a plant), wherein said polynucleotide encodes a polypeptide having an amino acid sequence of at least 50%, 51 %, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61 %, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71 %, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81 %, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%,90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity, based on the Clustal V method of alignment, to SEQ ID NO:5; (b) obtaining a progeny plant derived from said transgenic plant, wherein the progeny plant comprises in its genome the recombinant DNA construct; and (c) evaluating the progeny plant for drought tolerance compared to a control plant.

A method of evaluating drought tolerance in a plant comprising (a) obtaining a transgenic plant, wherein the transgenic plant comprises in its genomea suppression DNA construct comprising at least one regulatory sequence (for example, a promoter functional in a plant) operably linked to all or part of (i) a nucleic acid sequence encoding a polypeptide having an amino acid sequence of at Ieast50%, 51 %, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61 %, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71 %, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81 %, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity, based on the Clustal V method of alignment, when compared to SEQ ID NO:5, or (ii) a full complement of the nucleic acid sequence of (a)(i); (b) obtaining a progeny plant derived from said transgenic plant, wherein the progeny plant comprises in its genome the suppression DNA construct; and (c) evaluating the progeny plant for drought tolerance compared to a control plant.

A method of evaluating drought tolerance in a plantcomprising (a) obtaining a transgenic plant, wherein the transgenic plant comprises in its genomea suppression DNA construct comprising at least one regulatory sequence (for example, a promoter functional in a plant) operably linked to a region derived from all or part of a sense strand or antisense strand of a target gene of interest, said region having a nucleic acid sequence of at least 50%, 51 %, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61 %, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71 %, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81 %, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity, based on the Clustal V method of alignment, when compared to said all or part of a sense strand or antisense strand from which said region is derived, and wherein said target gene of interest encodes a WRKY66polypeptide; (b) obtaining a progeny plant derived from the transgenic plant, wherein the progeny plant comprises in its genome the suppression DNA construct; and (c) evaluating the progeny plant for drought tolerance compared to a control plant.

A method of determining an alteration of an agronomic characteristics in a plantcomprising (a) obtaining a transgenic plantwhich comprises in its genomea recombinant DNA construct comprising a polynucleotide operably linked to at least one regulatory sequence (for example, a promoter functional in a plant), wherein said polynucleotide encodes a polypeptide having an amino acid sequence of at least 50%, 51 %, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61 %, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71 %, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81 %, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity, based on the Clustal V method of alignment, when compared to SEQ ID NO:5; (b) obtaining a progeny plant derived from said transgenic plant, wherein the progeny plant comprises in its genome the recombinant DNA construct; and (c) determining whether the progeny plant exhibits an alteration in at least one agronomic

characteristics when compared, optionally under water limiting conditions, to a control plant. A method of determining an alteration of an agronomic characteristics in a plant comprising (a) obtaining a transgenic plant, wherein the transgenic plant comprises in its genomea suppression DNA construct comprising at least one regulatory sequence (for example, a promoter functional in a plant) operably linked to all or part of (i) a nucleic acid sequence encoding a polypeptide having an amino acid

sequence of at least 50%, 51 %, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61 %, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71 %, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81 %, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity, based on the Clustal V method of alignment, when compared to SEQ ID NO:5, or (ii) a full complement of the nucleic acid sequence of (i); (b) obtaining a progeny plant derived from said transgenic plant, wherein the progeny plant comprises in its genome the suppression DNA construct; and (c) determining whether the progeny plant exhibits an alteration in at least one agronomic

characteristics when compared, optionally under water limiting conditions, to a control plant.

A method of determining an alteration of an agronomic characteristics in a plant comprising (a) obtaining a transgenic plant, wherein the transgenic plant comprises in its genomea suppression DNA construct comprising at least one regulatory sequence (for example, a promoter functional in a plant) operably linked to a region derived from all or part of a sense strand or antisense strand of a target gene of interest, said region having a nucleic acid sequence of at least 50%, 51 %, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61 %, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71 %, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81 %, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91 %, 92%, 93%, 94%, 95%,

96%, 97%, 98%, 99%, or 100% sequence identity, based on the Clustal V method of alignment, when compared to said all or part of a sense strand or antisense strand from which said region is derived, and wherein said target gene of interest encodes a WRKY66polypeptide; (b) obtaining a progeny plant derived from said transgenic plant, wherein the progeny plant comprises in its genome the suppression DNA construct; and (c) determining whether the progeny plant exhibits an alteration in at least one agronomic characteristics when compared, optionally under water limiting conditions, to a control plant. A method of producing seed (for example, seed that can be sold as a drought tolerant product offering) comprising any of the preceding methods, and further comprising obtaining seeds from said progeny plant, wherein said seeds comprise in their genome said recombinant DNA construct (or suppression DNA construct).

In any of the preceding methods or any other embodiments of methods of the present disclosure, in said introducing step,the said regenerable plant cell may comprise a callus cell, an embryogenic callus cell, a gametic cell, a meristematic cell, or a cell of an immature embryo. The regenerable plant cell may derive from an inbred maize plant.

In any of the preceding methods or any other embodiments of methods of the present disclosure, said regenerating step may comprise the following: (i) culturing said transformed plant cells in a medium comprising an embryogenic promoting hormone until callus organization is observed; (ii) transferring said transformed plant cells of step (i) to a first media which includes a tissue organization promoting hormone; and (iii) subculturing said transformed plant cells after step (ii) onto a second media, to allow for shoot elongation, root development or both.

In any of the preceding methods or any other embodiments of methods of the present disclosure, the at least one agronomic characteristics may be selected from the group consisting of greenness, grain yield, growth rate, biomass, fresh weight at maturation, dry weight at maturation, fruit yield, seed yield, total plant nitrogen content, fruit nitrogen content, seed nitrogen content, nitrogen content in a vegetative tissue, total plant free amino acid content, fruit free amino acid content, seed free amino acid content, amino acid content in a vegetative tissue, total plant protein content, fruit protein content, seed protein content, protein content in a vegetative tissue, drought tolerance, nitrogen uptake, root lodging, harvest index, stalk lodging, plant height,earheight, ear length,tiller number, panicle size, salt tolerance,early seedling vigor and seedling emergence under low temperature stress.The alteration of at least one agronomic characteristic may be an increase in seed yield, greenness or biomass.

In any of the preceding methods or any other embodiments of methods of the present disclosure, the plant may exhibit the alteration of at least one agronomic characteristics when compared, under water limiting conditions, to a control plant.

In any of the preceding methods or any other embodiments of methods of the present disclosure, alternatives exist for introducing into a regenerable plant cell a recombinant DNA construct comprising a polynucleotide operably linked to at least one regulatory sequence. For example, one may introduce into a regenerable plant cell a regulatory sequence (such as one or more enhancers, optionally as part of a transposable element), and then screen for an event in which the regulatory sequence is operably linked to an endogenous gene encoding a polypeptide of the instant invention.

The introduction of recombinant DNA constructs of the present disclosure into plants may be carried out by any suitable technique, including but not limited to direct DNA uptake, chemical treatment, electroporation, microinjection, cell fusion, infection, vector-mediated DNA transfer, bombardment, or Agrobacterium-mediated transformation. Techniques for plant transformation and regeneration have been described in International Patent Publication WO 2009/006276, the contents of which are herein incorporated by reference.

In addition, methods to modify or alter the host endogenous genomic DNA are available. This includes altering the host native DNA sequence or a pre-existing transgenic sequence including regulatory elements, coding and non-coding sequences. These methods are also useful in targeting nucleic acids to pre- engineered target recognition sequences in the genome. As an example, the genetically modified cell or plant described herein, is generated using

"custom"engineered endonucleasesincluding meganucleases produced to modify plant genomes (e.g., WO 2009/1 14321 ; Gao et al. (2010) Plant Journal 1 :176-187). Another site-directed engineering is through the use of zinc finger domain

recognition coupled with the restriction properties of restriction enzyme (e.g., Urnov, et al. (2010) Nat Rev Genet. 1 1 (9):636-46; Shukla, et al. (2009) Nature 459

(7245):437-41 ).

The development or regeneration of plants containing the foreign, exogenous isolated nucleic acid fragment that encodes a protein of interest is well known in the art. The regenerated plants may be self-pollinated to provide homozygous transgenic plants. Otherwise, pollen obtained from the regenerated plants is crossed to seed- grown plants of agronomically important lines. Conversely, pollen from plants of these important lines is used to pollinate regenerated plants. A transgenic plant containing a desired polypeptide is cultivated using methods well known to one skilled in the art.

EXAMPLES Certain embodiments of the present invention are further illustrated in the following examples, in which parts and percentages are by weight and degrees are Celsius, unless otherwise stated. It should be understood that these examples, while indicating embodiments of the invention, are given by way of illustration only. From the above discussion and these examples, one skilled in the art can ascertain the essential characteristics of this invention, and without departing from the spirit and scope thereof, can make various changes and modifications of the invention to adapt it to various usages and conditions. Thus, various modifications of the invention in addition to those shown and described herein will be apparent to those skilled in the art from the foregoing description. Such modifications are also intended to fall within the scope of the appended claims.

EXAMPLE 1

Creation of a Rice Population with an Activation-TaggingConstruct In this research, a4 X CaMV 35S enhancer- based binary construct was used, and the rice activation tagging population was developed from Zhonghual 1 (Oryza sativa L. Zhonghual 1 ) which was transformed by /AgrOi acter/a-mediated

transformation.Zhonghual 1 was cultivated by Institute of Crop Sciences, Chinese Academy of Agricultural Sciences. The first batch of seeds used in this research wasprovided by Beijing Weiming Kaituo Agriculture Biotech Co.,Ltd.Calli induced from embryos was transformed with Agrobacteria with T-vector. The events generated with the T-vector were developed and the transgenic seeds were harvested to formthe rice activation tagging population.

EXAMPLE 2

Seedling Screens to Identify Lines with Enhanced Drought Tolerance in Greenhouse

Seedling screens for drought tolerance were carried out in greenhouse. Two types of lamps are provided as light source, i.e. sodium lamp and metal halide lamp, the ratio is 1 :1 . Lamps provide the 16 h/8 h period of day/night, and are placed approximately 1 .5m above the seedbed. The light intensity 30 cm above the seedbed is measured as 10,000-20,000 Ix in sunny day, while 6,000-10,000lx in cloudy day, the relative humidity rangesfrom 30% to 90%, and the temperature rangesfrom 20 to 35°C. For the mutant line, T1 seeds were used in the first round of screen. 16 uniform seedlingsand 16 wild-type control seedlings (Zhonghual 1 ) from tissue culture procedure were used for the drought tolerance screens and planted in the different positions of the trays which were filled with mixture of planting soil (FangJie soil from Beijing HuiYeShengDa Center), vermiculite (Beijing QingYuanShiJiGarden

Center)and sand (Beijing Shuitun Construction Material Market) (V:V:V= 3:3:2).After all the seedlings grew to 3-leaf stage, watering wasstopped and the trays were kept in a dry place until the leaves became curved (approximately 9-15 days depending on the seasons).The trays were transferred into water pool and the seedlings recovered for 5-7 days, and then the recovery degrees of plants were scored. The following scoring system was used: one green stem = 1 , one green leaf = 1 , a half green stem or leaf = 0.5, one-third green leaf=0.2, no green leaf or stem = 0. The recovery degree is the sum of the score of the green tissues, and the data were statistically analyzed using SAS-ANOVA. The lines which showed significant difference from controls and other mutant plants were considered as primary positive lines.

The primary positive lines were screened again, and T2seeds which showed red color under greenfluorescent light were used in the second drought screens in greenhouse. 60primary positive plants and 50 wild-type control plants (Zhonghual 1 generated from tissue culture procedure) were treated by the above described method. The result was analyzed using SAS-ANOVA (P<0.05).

Survival rate was also used as a parameter for the screens, which is the percentage of survived plants over the total plant number.

Lines which passed thesecond roundscreenwere planted in greenhouse soil or in field (depending the seasons) for harvesting leaf materials and molecular cloning of the T-DNA-flanking sequences and candidate genes. In general, 20-30 gof fresh leaf tissues were harvested from 30 uniform seedlings of the same line, frozen in liquid nitrogen, and stored in -80 °C freezer.

EXAMPLE 3

Results for Line AH01460 In repeated greenhouse drought screening assays, line AH01460 consistently showed enhanced drought tolerance compared to the Zhonghual 1 tissue

culturedcontrol.

As shown in Table 2, forT1 seeds from line AH01460, 6 of 16 plants (37.5%) were recovered or survived under greenhouse drought stress condition;whileall of the Zhonghual 1 tissue culturedcontrol plants died. The result indicates that

AH01460 has significantly enhanced drought tolerance compared to control.

Observationswere further carried out at the T2 generation. In the second round screen,AH01460 plants were analyzed with respect to the Zhonghual 1 tissue cultured control, and AH01460 had higher survival rate and average recovery degree.

In tworepeated screens, both survival rate and recovery degree of AH01460 consistently exhibited enhanced drought tolerance compared to the control (Table 2). These results demonstrated that AH01460 has enhanced drought tolerance under greenhouse drought condition at seedling stages.

Table2. Drought Tolerance Assay of AH01460 under greenhouse conditions (CK control)

In light of these results, further work was carried out to identify the gene(s) which contributes to the enhanced drought tolerance in AH01460. EXAMPLE 4

Identification of Activation-Tagged Genes

Genes flanking the T-DNA insertion locus in the drought-tolerant line

AH01460were identified using one or both of the following two standard procedures: (1 ) Plasmid Rescue (Friedrich J. Behringer and June I. Medford. (1992), Plant Molecular Biology Reporter 'Vol. 10, 2:190-198); and (2) Inverse PCR (M. J.

McPherson and Philip Quirke. (1991 ), PCR: a practical approach, 137-146). Forlines with complex multimerized T-DNA inserts, plasmid rescue and inverse PCR may both prove insufficient to identify candidate genes. In these cases, other procedures, includingTAIL PCR (Liu et al. (1995), Plant J. 8:457-463)can be employed.

A successful sequencing result is one where a single DNA fragment contains a T-DNA border sequence and flanking genomic sequence. When a tag of genomic sequence flanking a T-DNA insert is obtained, candidate genes are identified by alignment to publicly available rice genome sequence. Specifically, the annotated genes nearest the enhancer elements/T-DNA RB and LB are candidates ofgenes that are activated.

To verify that an identified gene is near a T-DNA and to rule out the possibility that the DNA fragment is a chimeric cloning artifact, a diagnostic PCR on genomic DNA is done with one oligo in the T-DNA and one oligo specific for the local genomic DNA. Genomic DNA samples that give a PCR product are interpreted as

representing a T-DNA insertion. This analysis also verifies a situation in which more than one insertion event occurs in the same line, e.g., if multiple differing genomic fragments are identified in Plasmid Rescue and/or Inverse-PCR analyses.

Genomic DNA was isolated from leaf tissues of the AH01460 line using CTAB method (Murray, M.G. and W.F. Thompson. (1980) Nucleic Acids Res.8: 4321 -4326).

10 g of genomic DNA from AH01460 was digested by 2 μί restriction enzyme Xho\ (NEB). After self-ligation and transformation into competent E. coli DH5a through electroporation, the survived colonies on an ampicillin-containing plate were validated by colony-PCR using primers of P2up 5389 and P2down 3534.

P2up 5389: 5'-ACCCCAGGCTTTACACTTTATGCTTCC-3' (SEQ ID NO: 6),

P2down 3534: 5'-AACCCACTCGTGCACCCAACTGATC-3'(SEQ ID NO: 7).

PCR reaction mixture and procedure:

Reaction mix (25 μί):

Template 2 μί

Primer (10 μΜ) each 1 μί

dNTPs (2.5 mM each) 2 μί

La Taq (TaKaRa) 0.2 μί

10xLA PCR buffer II 1 .25 μΙ_ 2xGC bufferl 6.25 μΙ_

ddH₂O 1 1 .3 μί

PCR cycle:

94 °C 3 min

98 °C 20 s

30 Cycles

68 °C 15 min

72 °C 10 min

A total of 5 colonies were analyzed and all of them produced a band about 4kb in size on an agarose gel electrophoresis. After sequencing the 4kb DNA fragment, the flanking sequence of T-DNA in AH01460 was obtained. This nucleotide sequence is shown as SEQ ID NO: 1 . According to the rice genomic annotation of the National Center for Biotechnology Information of the U.S. National Library of Medicine, National Institutes of Health (http://www.ncbi. nlm.nih.gov)and theRice Genome Annotation Project at Michigan State University

(http://rice.plantbiology.msu.edu), wedesigned the primers for determiningthe accurate T-DNA insert site. The accurate right border sequence of T-DNA was obtained and was shown as SEQ ID NO:2,the primers are as follow:

AP004778-F1 : 5'-CGTGGCCTATCGATCCTTTAGACCTTC-3'(SEQ ID NO: 8) RB out down:5'- TGAAAGCGACGTTGGATGTTCATTCG-3'(SEQ ID NO: 9)

The T-DNA inserted in Chromosome 2 of AH01460's genome, and there is only one T-DNA insertion locus in Chromosome 2 in AH01460's genome. OsWRKY66was located downstream of the T-DNA left-border.

OsWRKY66 gene wasnear the T-DNA insertion locus, and AH01460 line had enhanced drought tolerance. Therefore, this genewas cloned and validated as to its functions in drought tolerance and other agronomic trait improvement.

EXAM PL E5

OsWRKY66 gene cloning and vector construction

The OsWRKY66 (LOC_Os02g47060.1 ) gene was amplified by using KOD-FX PCR mix (TOYOBO), using genomic DNA of Zhonghual 1 rice as PCR template. The primers are:

KXF-F: 58:5'-GAAGATCTATGTGTGATTACTTCTTGCAAC-3' (SEQ ID NO:

10) KXF-R: 34:5'-TCATAAACCTCCCTCCCC-3' (SEQ ID NO: 1 1 ).

A BglW site,which is underlined, was designed in primer KXF-F. An expected -4 kb DNA fragment was amplified and purified, and then digested by BglW. Because a BglW site is present in the OsWRKY66 gene at the site of 694 bp from the ATG, the PCR product was cut into two fragments by BglW (-700 bp and -3300 bp). Therefore, two-step cloning wascarried outto clone this gene into overexpression vector

DP0005. The two-step cloning comprises digesting DP0005 with BglW and Nru\ and ligatingit with the -3300 bp-Sg/l I fragment, and ligating the -700 bp-Sg/l I fragment with this new construct which was digested by BglW. The right clone (DP0010) was confirmed by restriction mapping and DNA sequencing. The genomic sequence and the coding sequenceof OsWRKY66 gene and its encoded protein sequenceare shown in SEQID NO:3 and 4 and SEQID NO:5.

EXAMPLE 6

Vector Construction of DP0005 and DP0009

DP-0005 was constructed from pCAMBIA1300 (Cambia, Brisbane, Australia). The CaMV 35S promoter was amplified using template of pCAMBIA1300 and primers of 35sF and 35sR. The restriction enzyme sites H/ndlM and Pst\ were added at 35S CaMV promoter 5'- and 3'-ends, respectively.

35sF: 5'- AAGCTTAGAGCAGCTTGGCAACATGGTGGAGCAC-3'(SEQ ID NO: 12)

35sR: 5'-CTGCAGAGAGATAGATTTGTAGAGAGAG-3' (SEQ ID NO: 13) This amplified CaMV35S promoter fragment was digested by H/ndl M and Pst\ and ligated into H/r?d 11 l-Psfl-d igested pCAMBIA1300 to produce pCAMBIA1300-35s.

The Terminator NOS polyA was amplified using template of pCAMBIA1303 and primers of TnosF and TnosR. The restriction enzyme sites

Pst\+BglW+Kpn\+Nco\+Sal\ and BamH\ were designed in Terminator NOS polyA 5' and 3'ends of the primers, respectively.

TnosF:5'-

CTGCAGAGATCTGGTACCGGTCGCCACCATGGAAGTCGACGTTTCTTGTTTCTT AAGATTGAATCCTGTTG-3' (SEQ ID NO: 14)

TnosR: 5'- GGATCCTCTAGTCCCGATCTAGTAACATAG-3' (SEQ ID NO: 15) Terminator NOS polyA fragment was digested with Pst\ and BamH\ and ligated into the Pst\ -BamHI-digested vector. The produced vector was designated as pCAMBIAI 300-35s-Tnos.

The AsRED gene was used from pAsRED2 (Clontech Laboratories Inc.), and inserted in thepCAMBIAI 300-35s-Tnos vector to produce pCAMBIAI 300-35s - AsRED-Tnos.

For convenient construction of gene expression vectors, the new Terminator NOS polyA fragment hasBamHI+A/ral+Sa/l site in 5'end and EcoRI in 3'end. The primers are:

TnosF2:5'-CCGGGATCCTCGCGAGTCGACCTCCAAGCTGGGCCACAACTGAAG- 3' (SEQ ID NO: 16)

TnosR2:5'-CGAGAATTCTCTAGTCCCGATCTAGTAACATAG-3' (SEQ ID NO: 17)

The new Terminator NOS polyA fragment was amplified by PCR using pCAMBIAI 300-35s-AsRED-Tnos as a template. This DNA fragment was digested byBamHI and EcoRI, and ligated to pCAMBIAI 300-35s-AsRED-Tnos which was digested byBamHI and EcoRlto produce DP0005, an over-expression vector backbone for OsWRKY66. DP0005 was digested by BglW and BamHI, and then self- ligated for eliminating the AsRED gene from DP0005 to produce DP0009.

EXAMPLE 7

OsWRKY66 Transgenic Rice Events

Both control vector (DP0005) and overexpression vector (DP0010) were transformed into Zhonghual 1 as described above (rice transformation method). More than 60 independent transgenic events for every vector were generated. The drought tolerance assaywas carried out at TO and/or T2 generations.

The TO plants were cultured in greenhouse to 4 leaf-stage, and uniformand healthy plants were selected for drought screens as described above. For the T2seeds, we selected the hygromycin-resistant seedlings by culturing the

seedlingsabout 1 -2 cm in 75mg/L hygromycin solution for 3-5 days. Only the survived plants (hygromycin-resistant) were used in the drought assays as described above.

The expression levels of OsWRKY66gene in transgenic DP0010 rice plants were identified. Leaf samples were collected from different DP0010 rice plants, and a real-time PCR procedure, such as the QuantiTect® Reverse Transcription Kit from Qiagen® and Real Time-PCR(SYBR^RPremix Ex Taq™, TaKaRa),was used. EF-1 gene was used as a control to show that the amplification and loading of samples from the mutant line and wild-type were similar. Assay conditions were optimized for each gene.

The total RNA was extracted from about 50mg leaf of DP0010 plants at 4-leaf- stage using RNAiso Plus kit (TaKaRa) according to manufacturer's instruction. The cDNA were prepared by RevertAidTM First Strand cDNA Synthesis Kit (Fermentas) and from 500ng total RNA. The real-time-PCR (SYBR^RPremix Ex Taq™, TaKaRa) was conducted using 7,500 Fast real-time PCR equipment and according to the manual (ABI).

The primers for real time PCR for OsWRKY66 are listed below:

DP10-F:5'-CCCAACATGCTCGTCATCACC-3'(SEQ ID NO:18)

DP10-R:5'-ATCGTTGGGTTCCGCCTTGAC-3'(SEQ ID NO:19)

As shown in Figurel , OsWRKY66transgene overexpressed in DP0010 plants, but the expression level of OsWRKY66 transgene was not detectable in the control (Zhonghua1 1 transformed with empty vectorDP0005).

EXAMPLE 8

Enhanced Drought Tolerance by OverexpressinqOsWRKY66 transgene

TO and T2 DP0010 transgenic seedlings were planted in greenhouse and treated as described in example 2.

As shown in Table 3 and 4, constitutive overexpression of OsWRKY66

transgene resulted in significantly enhanced drought tolerance in greenhouse.

At TO generation, DP0010 seedlings generated from tissue culture process were used, and DP0005 seedlings generated from the same process were used as control. The drought treatment results in greenhouse indicated that overexpression of

OsWRKY66transgene significantly enhanced survival rate and recovery degree after the drought treatments (Table 3), which indicated enhanced drought tolerance in the OsWRKY66 -transgenic plants.

The transgenic events were further evaluated at T2 generations. In the

treatments of DP0010.07, DP0010.09 and DP0010.10 rice plants, DP0005 rice plants were used as control, and in other treatments, the segregated T2 negative seeds were used as control. The drought treatment results are shown in

Table4;fiveevents which overexpressed OsWRKY66 transgene (FIG.1 ) consistently exhibited increased drought tolerance under the greenhouse conditions. These results demonstrated that overexpression ofOsWRKY66 contributed to the enhanced drought tolerance of DP0010 rice plant.

Table 3. Enhanced drought tolerance of CaMV35S Pro: OsWRKY66- riceplants at TO generation under greenhouse conditions(CK is control)

Table 4. Enhanced drought tolerance of CaMV35S Pro: OsWRKY66- plants atT2 generation under greenhouse conditions(CK is control)

To understand if the transgenic events exhibit enhanced drought tolerance under field conditions, we evaluated some events in the field drought experiments. Field drought experiments were carried out in Hainan province, the segregated T2 positive seeds were used, and its corresponding segregated negative seeds were used as control. For each transgenicevent to be tested, 100 positive seeds were soaked in water for 16 h at room temperature, germinated for 36 h at 35-37°Cin an incubator, and planted in a bedded field. At 3-leaf stage, the seedlings were transplanted into the testing field, with 4 replicates and 10 plants per replicate for each transgenic line, and the 4 replicates were planted in the same block. The Zhonghual 1 plants transformed with empty vector of DP0005 were planted nearby the transgenic lines in the same block, and were used as control in the statistical analysis.

The rice plants were managed as normal practice using pesticides and fertilizers. Watering was stopped at booting stage to generate drought stress at flowering stage depending on the weather (temperature and humidity). InHainan Province, the rice plants were stopped watering 25 days after transplanted in January-February. The rice plants were re-watered one or two times during the drought stress to avoid severe condition and to keep reasonable yield. The soil water content was measured every 3days at 10 sites per block using TDR300 (Spectrum Technologies, Inc.).

At the end of the season, about 20representative rice plants in the middle of the row per line were harvested and the grain weight per plant was measured.The grain weight data were statistically analyzed using SAS-ANOVA-mixed model by ASReml program.

Figure 2 shows that the soil volumetric moisture content decreased from 28% to 10% during heading and maturation stage. The DP0010 rice plants were subjected to drought stress, which affects the seed yield. Table 5 indicatesthat three events had increased seed yield per plants than its negative control. These results indicated thatoverexpression of OsWRKY66 also enhanced drought tolerance in field. Notably, event DP0010.12 showed enhanced drought tolerance under both greenhouse drought condition (Table 4) and field drought conditions (Table 5).

Table 5. Seed yield assay of CaMV35S Pro: OsWRKY66-rice plants atT2 generation after field drought treatment(CK is control)

# # Seed

Line Survived Harvested yield per P-value P<0.05

plants plants plant (g)

DP0010.12 39 24 6.062 0.0003 Y

CK (DP0010.12) 39 24 2.249

DP0010.13 40 24 5.091 0.0202 Y

CK (DP0010.13) 30 18 2.534 DP0010.18 30 18 7.749 0.0638

CK (DP0010.18) 30 18 5.844

EXAMPLE 9

Transformation and Evaluation of Maize with OsWRKY66 gene

Maize plants can be transformed to overexpress OsWRKY66gene or a corresponding homolog from maize, Arabidopsis, or other species. Expression of the gene in the maize transformation vector can be under control of a constitutive promoter such as the maize ubiquitin promoter (Christensen et al. (1989) Plant Mol. Biol. 12:619-632 and Christensen et al . (1992) Plant Mol. Biol. 18:675-689) or under control of another promoter, such as a stress-responsive promoter. The recombinant DNA construct can be introduced into maize cells by particle bombardment substantially as described in International Patent Publication WO 2009/006276.

Alternatively, maize plants can be transformed with the recombinant DNA construct by Agrobacterium-mediated transformation substantially as described by Zhao et al. in Meth. Mol. Biol. 318:315-323 (2006) and in Zhao et al., Mol. Breed. 8:323-333 (2001 ) and U.S. Patent No. 5,981 ,840 issued November 9, 1999. The Agrobacterium- mediated transformation process involves bacterium inoculation, co-cultivation, resting, selection and plant regeneration.

Progeny of the regenerated plants, such as T1 plants, can be subjected to a soil-based drought stress. Using image analysis, plant area, volume, growth rate and color can be measured at multiple times before and during drought stress. Significant delay in wilting or leaf area reduction, a reduced yellow-color accumulation, and/or an increased growth rate during drought stress, relative to a control, will be

considered evidence that the OsWRKY66 functions in maize to enhance drought tolerance.

EXAMPLE 10

Transformation and Evaluation of Gaspe Flint Derived Maize Lines As described in example 9, maize plants can be transformed to overexpress the

OsWRKY66 gene, or a corresponding homolog from another species. In certain circumstances, recipient plant cells can be from a uniform maize line having a short life cycle ("fast cycling"), a reduced size, and high transformation potential, asdisclosed in Tomes et al. U.S. Patent 7,928,287.

The population of transgenic (TO) plants resulting from the transformed maize embryos can be grown in a controlled greenhouse environment using a modified randomized block design to reduce or eliminate environmental error. For example, a group of 30 plants, comprising 24 transformed experimental plants and 6 control plants (collectively, a "replicate group"), are placed in pots which are arranged in an array (a.k.a. a replicate group or block) on a table located inside a greenhouse. Each plant, control or experimental, is randomly assigned to a location with the block which is mapped to a unique, physical greenhouse location as well as to the replicate group. Multiple replicate groups of 30 plants each may be grown in the same greenhouse in a single experiment. The layout (arrangement) of the replicate groups should be determined to minimize space requirements as well as

environmental effects within the greenhouse. Such a layout may be referred to as a compressed greenhouse layout.

Each plant in the event population is identified and tracked throughout the evaluation process, and the data gathered from that plant are automatically associated with that plant so that the gathered data can be associated with the transgene carried by the plant. For example, each plant container can have a machine readable label (such as a Universal Product Code (UPC) bar code) which includes information about the plant identity, which in turn is correlated to a greenhouse location so that data obtained from the plant can be automatically associated with that plant.

Alternatively any efficient, machine readable, plant identification system can be used, such as two-dimensional matrix codes or even radio frequency identification tags (RFID) in which the data is received and interpreted by a radio frequency receiver/processor (Patents 7,403,855 and 7,702,462).

Each greenhouse plant in the TO event population, including any control plants, is analyzed for agronomic characteristics of interest, and the agronomic data for each plant are recorded or stored in a manner so as to be associated with the identifying data for that plant. Confirmation of a phenotype (gene effect) can be accomplished in the T1 generation with a similar experimental design to that described above. EXAMPLE 1 1

Yield Analysis of Maize Lines transformed with the

OSVVRKY66 gene

As described in example 9, maize plants can be transformed to overexpress the OsWRKY66 gene, or a corresponding homolog from another species. Transgenic plants, either inbred or hybrid, can undergo field-based experiments to study yield enhancement and/or stability under both well-watered and water-limiting conditions. Specifically, drought conditions can be imposed during the flowering and/or grain filling period, and reduction in yield can be measured for both transgenic and control plants. Improvement in yield performance may be reflected by reduced yield loss under drought stress by the transgenic plants relative to the control plants.

This method may be used to select transgenic plants with increased yield, under water-limiting conditions and/or well-watered conditions, when compared to a control plant.

EXAMPLE 12

Transformation of Arabidopsisw^'tih OsWRKY66 gene

Soybean, sorghum and Arabidopsis homologs to OsWRKY66 gene can be identified (for example based on homology searches), and transformed into

Arabidopsisand/or soybean under control of the CaMV 35S promoter for

assessmentof their ability to enhance drought tolerance. Vector construction, plant transformation and phenotypic analysis will be similar to that in previously described examples.

To understand ifOsWRKY66 gene can improve dicot plants' drought tolerance, or other traits, OsWRKY66 gene (vector DP0010)and vector DP0009 were

transformed into Arabidopsis using standard known protocols.

To identify the transgenic progeny, the Arabidopsisseeds wereplanted onto MS selection plates containing appropriate antibiotics. The seeds were vernalized by placing at 4 °C for 3 days; and then were moved to a growth chamber under long-day conditions.After growing on MS selection plates for 7-10 days, seedlings with healthy green cotyledons and true leaves and rootsextending into the selection medium were considered as transformants. The transformantswere then transplanted in planting soil to produce Arabidopsis seeds, andthe transgenic plants werefurther confirmed by PCR analysis. The expression levels of OsWRKY66 gene in transgenic Arabidopsis were analyzed. The total RNA of the transfornned Arabidopsis seedlings were extracted as described in example 7.The cDNA were obtained, actin gene was used as control, and DP10-F and DP10-R were used as primers for OsWRKY66 gene. The primers for actin gene are listed as below:

actin-F: 5'-AGGCACCTCTTAACCCTAAAGC-3' (SEQ ID NO:20)

actin-R: 5'-GGACAACGGAATCTCTCAGC-3' (SEQ ID NO:21 )

PCR reaction mixture and procedure:

Reaction mix (20μΙ_)

Template 1 μΙ_

Primers (10 μΙ_) each 0.5 μί

2xTaq MIX 10 μΙ_

ddH₂O 8 μΙ_

PCR cycle:

94 °C 5 min

94°C30s

60°C30s ^ ^cY^cl^es f°^{r act}iⁿ g^ene> ^or 34

cycles for OsWRKY66 gene

72°C30s J

72°C5min

As shown in Figure 3A, semi-quantitative PCR revealed that OsWRKY66 transgene was expressed in AtDP0010-6, AtDP0010-10, and AtDP0010- 13Arabidopsis plants, but was notexpressed in wild-type (WT) and empty vector (VC) transformed Arabidopsis.

To characterize the performance of CaMV 35S Pro:: OsWRKY66 (DP0010) transgenic

under drought stress, wild-type (Columbia), vector control plants (DP0009), andthree DP0010 events were planted in planting soil to grow for 4 weeks under normal watering condition. The planting soils were watered to saturation before drought treatment, and the Arabidopsis plants grew without watering for about 12 days. When the relative water content of the soil decreased to about 3%, the Arabidopsis plants were re-watered for 3 days. Three measurements were performedand 12 plants were used. During drought treatment, the wilting levels of wild-type plants and vector control plants were more apparent than those of the DP0010 events. After re-watering, more than 50% of transgenic plants survived, whereas the corresponding survival rates were less than 13% for wild-type plants and vector control plants.

These results demonstrated that overexpression of OsWRKY66 gene enhanced drought tolerancein a dicot Arabidopsis. In addition, these results further showed that a monocot gene (OsWRKY66 from rice) enhanced drought tolerance in a dicot plant (Arabidopsis).

Claims

CLAIMS What is claimed is:

1 . An isolated polynucleotide comprising:

(a) the polynucleotide sequence of SEQ ID NO: 3;

(b) the polynucleotide sequence of SEQ ID NO: 4;

(c) a polynucleotide sequence encoding the polypeptide of SEQ ID NO: 5;

(d) a polynucleotide sequence having at least 85% sequence identity with the full length polynucleotide sequence of (a) or (b) or (c);

(e) a polynucleotide sequence that encodes a polypeptide having at least 85% sequence identity with the amino acid sequence of SEQ ID NO: 5; or

(f) a polynucleotide sequence that is complementary to the full length

polynucleotide sequence nucleic acid of (a), (b), (c),(d) or (e) above.

2. The polynucleotide of Claim 1 , wherein the amino acid sequence of the encoded polypeptide comprises SEQ ID NO: 5.

3.The polynucleotide of Claim 1 , wherein the nucleotide sequence comprises

SEQ ID NO:3.

4. The polynucleotide of Claim 1 , wherein the nucleotide sequence comprises SEQ ID NO:4.

5. A recombinant DNA construct comprising the isolated polynucleotide of Claim 1 operably linked to at least one regulatory sequence.

6. A plant or seed comprising a recombinant DNA construct, wherein the recombinant DNA construct comprises the polynucleotide of Claim 1 operably linked to at least one regulatory sequence.

7. A plant comprising in its genome a recombinant DNA construct comprising a polynucleotide operably linked to at least one regulatory element, wherein said polynucleotide encodes a polypeptide having an amino acid sequence of at least 85% sequence identity, based on the GAP method of alignment, to SEQ ID NO: 5, and wherein said plant exhibits increased drought tolerance when compared to a control plant.

8.A plant comprising in its genome a recombinant DNA construct comprising a polynucleotide operably linked to at least one regulatory element, wherein said polynucleotide encodes a polypeptide having an amino acid sequence of at least 90% sequence identity, based on the GAP method of alignment, to SEQ ID NO: 5, and wherein said plant exhibits an increase in seed yield, biomass, or both, when compared to a control plant.

9. The plant of Claim 7or 8, wherein said plant exhibits said increase in seed yield, biomass, or both when compared, under water limiting conditions, to said control plant.

10. The plant of Claim 7or8, wherein said plant is selected from the group consisting of rice, maize, soybean, sunflower, sorghum, canola, wheat, alfalfa, cotton, barley, millet, sugar cane and switchgrass.

1 1 .Seed of the plant of Claim 7or 8, wherein said seed comprises in its genome a recombinant DNA construct comprising a polynucleotide operably linked to at least one regulatory element, wherein said polynucleotide encodes a polypeptide having an amino acid sequence of at least 90% sequence identity, based on the GAP method of alignment, to SEQ ID NO: 5, and wherein a plant produced from said seed exhibits an increase in at least one trait selected from the group consisting of drought tolerance, seed yield and biomass, when compared to a control plant.

12. A method of increasing drought tolerance in a plant, comprising:

(a) introducing into a regenerable plant cell a recombinant DNA construct comprising a polynucleotide operably linked to at least one regulatory sequence, wherein the polynucleotide encodes a polypeptide having an amino acid sequence of at least 90% sequence identity, based on the GAP method of alignment, to SEQ ID NO: 5;

(b) regenerating a transgenic plant from the regenerable plant cell after step (a), wherein the transgenic plant comprises in its genome the recombinant DNA

construct; and (c)obtaining a progeny plant derived from the transgenic plant of step (b), wherein said progeny plant comprises in its genome the recombinant DNA construct and exhibits increased drought tolerance when compared to a control plant.

13. A method of improving drought tolerance also comprising: (a) crossing the plant of claim 7 or claim 8 with a second plant to produce progeny seed;(b)

harvesting and planting the progeny seed to produce at least one progeny plant of a subsequent generation; (c) crossing the progeny plant with the second plant to produce at least one backcross progeny seed; and optionally; (d) repeating steps (b) and (c) for additional generations to produce a plant with improved drought tolerance when compared to the second plant.

14.A method of evaluating drought tolerance in a plant, comprising: (a)obtaining a transgenic plant, wherein the transgenic plant comprises in its genome a

recombinant DNA construct comprising a polynucleotide operably linked to at least one regulatory element, wherein said polynucleotide encodes a polypeptide having an amino acid sequence of at least 90% sequence identity, based on the GAP method of alignment, to SEQ ID NO: 5; (b)obtaining a progeny plant derived from the transgenic plant, wherein the progeny plant comprises in its genome the

recombinant DNA construct; and (c)evaluating the progeny plant for drought tolerance compared to a control plant not comprising the recombinant DNA construct.

15.A method of determining an alteration of seed yield, biomass, or both in a plant, comprising: (a)obtaining a transgenic plant, wherein the transgenic plant comprises in its genome a recombinant DNA construct comprising a polynucleotide operably linked to at least one regulatory element, wherein said polynucleotide encodes a polypeptide having an amino acid sequence of at least 90% sequence identity, based on the GAP method of alignment, to SEQ ID NO:5; (b) obtaining a progeny plant derived from the transgenic plant, wherein the progeny plant

comprises in its genome the recombinant DNA construct; and (c) measuring the seed yield and/or biomass of the progeny plant and comparing said measurement to the seed yield and/or biomass of a control plant.

16.The method of Claim 15, wherein seed yield and/or biomass of the progeny plant and control plant are measured under water-limiting conditions.

17. The method of claim 15or claim 16, wherein said seed yield and/or biomass of the progeny plant is increased relative to that of the control plant.

18. The method of any one of Claim 12to 16, wherein said plant is selected from the group consisting of rice, maize, soybean, sunflower, sorghum, canola, wheat, alfalfa, cotton, barley, millet, sugarcane and switchgrass.

19. A rice plant comprising a recombinant transcriptional activator element enhancing the expression of an endogenous polynucleotide, wherein the

polynucleotide encodes an amino acid sequence that is 90% identical to SEQ ID NO: 5.

20. A method of increasing drought tolerance of a rice plant in a field, the method comprising (a) expressing a recombinant nucleic acid encoding a rice WRKY transcription factor in a rice plant; (b) growing the rice plant under crop growing conditions in the field, wherein the rice plant is exposed to drought conditions; and (c) increasing the drought tolerance of the rice plant.

21 . A method of increasing yield of a rice plant in a field, the method comprising (a) expressing a recombinant nucleic acid encoding a rice WRKY transcription factor in a rice plant; (b) growing the rice plant under crop growing conditions in the field, wherein the rice plant is exposed to drought conditions; and (c) increasing the grain yield of the rice plant.

22. A method of identifying an allele of OsWRKY66 that results in an increased expression or activity of the OsWRKY66 polypeptide, the method comprising the steps of: (a) performing a genetic screen on a population of mutant plants; (b) identifying one or more mutant plants that exhibit the increased expression or activity of the OsWRKY66 polypeptide or a homolog thereof; and (c) identifying the

OsWRKY66 allele or a homolog thereof from the mutant plant.

23. A method of screening for alleles of OsWRKY66, the method comprising (a) sequencing one or more genomic DNA fragments isolated from one or more rice populations with a oligonucleotide primer targeted to the OsWRKY66 gene; (b) analyzing the differences of the DNA sequence in the regulatory or the coding region of the OsWRKY66 gene; and (c) correlating an allele of OsWRKY66 with increased drought tolerance or yield.

24. A rice plant, comprising in its genome a recombinant construct that results in an increased expression of OsWRKY66 polypeptide, wherein the polypeptide comprises SEQ ID NO:5.

25. A method of obtaining rice plants with increased drought tolerance, the method comprising obtaining a rice plant that has an increased expression of

OsWRKY66 compared to a population of control plants and growing the rice plant with increased expression of OsWRKY66 under drought conditions.