CN112778408A

CN112778408A - Rubber tree transcription factor HbICE2 and coding gene and application thereof

Info

Publication number: CN112778408A
Application number: CN202110232197.1A
Authority: CN
Inventors: 李言; 田维敏; 全彩虹; 杨署光; 吴绍华
Original assignee: Rubber Research Institute Chinese Academy Tropical Agricultural Sciences
Current assignee: Rubber Research Institute Chinese Academy Tropical Agricultural Sciences
Priority date: 2021-03-02
Filing date: 2021-03-02
Publication date: 2021-05-11
Anticipated expiration: 2041-03-02
Also published as: CN112778408B

Abstract

The invention provides a rubber tree transcription factor HbICE2, and an amino acid sequence of the rubber tree transcription factor HbICE2 is shown in SEQ ID NO. 1. The invention also provides a coding gene of the rubber tree transcription factor HbICE2 and application thereof. The gene expression analysis shows that the HbICE2 gene is up-regulated and expressed in response to low-temperature stress, the expression quantity of the HbICE2 gene in a rubber tree variety with strong cold tolerance is obviously higher than that of a rubber tree variety with weak cold tolerance, and the HbICE2 gene is verified to be capable of enhancing the cold tolerance, the drought tolerance, the salt tolerance and the like of a transgenic plant through transgenosis, so that the gene has important theoretical significance and practical application value for recognizing the resistance mechanism of the plant to low-temperature stress, salt stress, drought stress and the like under the non-dormancy condition and directionally improving the low-temperature stress, salt stress, drought stress and the like of a high-yield variety through a transgenic technology, and can be used as an important gene resource and applied to stress-resistant gene engineering of the rubber tree and other plants.

Description

Rubber tree transcription factor HbICE2 and coding gene and application thereof

Technical Field

The invention belongs to the technical field of biology, and particularly relates to a hevea brasiliensis transcription factor HbICE2, and a coding gene and application thereof.

Background

ICE (inducer of CBF expression) is a transcription activator of CBF-induced expression. In addition to the canonical bHLH domain, the ICE structure in plants also existed in the S-rich, NLS, and transmembrane regions, and the bHLH domains all contained 19 conserved KMDRASILGDAI (D/E) amino acids for YLKELL. The genes are respectively found in different plants such as tomatoes, cucumbers, tobaccos, bananas and the like, and the cold resistance of the plants can be improved. Research shows that AtICE belongs to a constitutive expression gene, and the MYC (MYC-like transcription factors) family members encoding the MYC-like transcription activators MYC (Myelocytomatosis) containing bHLH can respond to various plant hormones and play a very important transcription regulation role in mediated plant environmental stress response.

Rubber trees (Hevea brasiliensis muell. arg.) native south american amazon river basin, a typical tropical rainforest tree species. The glue planting area in China is located in the northern margin of the tropical zone, belongs to the non-traditional glue planting area and is frequently subjected to cold flow. Therefore, a new high-yield and cold-resistant variety is required in production, but the high-yield and cold-resistant variety is extremely deficient. The conventional breeding period of the rubber tree is long, the number of hybridization generations is small, and the high yield and cold-resistant characters are difficult to polymerize; the cold-resistant breeding of the rubber trees depends on the identification of the field and the sentinel nursery, so that the identification period is long, the efficiency is low, and a large amount of manpower, material resources and land resources are consumed. The project adopts a forward genetics research strategy, utilizes an established indoor identification experiment system for cold resistance of the rubber tree and a known clone of the rubber tree with strong and weak cold resistance as materials, reveals molecular mechanisms such as low-temperature stress resistance of the rubber tree and the like from the aspects of molecular biology and genetic transformation, identifies the functions of the ICE2 gene of the rubber tree, and has important theoretical significance and practical application value for understanding the resistance mechanism of plants to low-temperature stress under the non-dormancy condition and directionally improving the low-temperature stress resistance of high-yield varieties through a transgenic technology.

Disclosure of Invention

The invention aims to overcome the defects in the prior art and provides a rubber tree transcription factor HbICE2, and a coding gene and application thereof.

The first aspect of the invention provides a rubber tree transcription factor HbICE2, and the amino acid sequence of the rubber tree transcription factor HbICE2 is shown in SEQ ID NO. 1.

The second aspect of the invention provides a rubber tree transcription factor HbICE2 gene, the nucleotide sequence of which is shown in SEQ ID NO. 2.

In a third aspect of the invention, there is provided a recombinant vector comprising a primary vector and the hevea brasiliensis transcription factor HbICE2 gene according to the second aspect of the invention.

As the original vector, there can be used a vector commonly used in the field of gene recombination, such as a virus, a plasmid, etc. The invention is not limited in this regard. In one embodiment of the present invention, the original vector is the pCAMBIA1302 vector plasmid, but it is understood that other plasmids, viruses, etc., may be used.

Preferably, the original vector is pCAMBIA1302 vector plasmid, and the nucleotide sequence shown in SEQ ID NO. 2 is positioned between Spe I and BstEI restriction endonuclease sites of the pCAMBIA1302 vector plasmid.

In a fourth aspect, the invention provides the use of the hevea transcription factor HbICE2 according to the first aspect of the invention, or the hevea transcription factor HbICE2 gene according to the second aspect of the invention, or the recombinant vector according to the third aspect of the invention, for improving cold tolerance, and/or salt tolerance, and/or drought tolerance in plants.

Wherein the salt is sodium chloride.

In a fifth aspect of the present invention, there is provided a method for improving cold tolerance, salt tolerance and/or drought tolerance of a plant, wherein the hevea brasiliensis transcription factor HbICE2 gene according to the second aspect of the present invention or the recombinant vector according to the third aspect of the present invention is transfected into a plant.

The sixth aspect of the present invention is a primer set, the nucleotide sequence of which is shown in SEQ ID NO. 3 and SEQ ID NO. 4.

The seventh aspect of the present invention provides a primer pair, the nucleotide sequence of which is shown as SEQ ID NO. 5 and SEQ ID NO. 6.

The eighth aspect of the present invention provides a primer pair, the nucleotide sequence of which is shown as SEQ ID NO. 7 and SEQ ID NO. 8.

The invention discloses a molecular mechanism of low-temperature stress resistance of a rubber tree from the aspect of molecular biology and genetic transformation, identifies the function of a HbICE2 gene of the rubber tree, and gene expression analysis shows that the HbICE2 gene responds to low-temperature stress and is up-regulated, the expression quantity of the HbICE2 gene in a rubber tree variety with strong cold resistance is obviously higher than that of a variety with weak cold resistance, and the HbICE2 gene is verified to be capable of enhancing the cold resistance, the drought resistance, the salt resistance and the like of a transgenic plant through transgenosis.

Drawings

FIG. 1 shows the nucleotide sequence of HbICE2 gene and its encoded amino acid sequence.

FIG. 2 is a phylogenetic tree analysis of the HbICE2 gene.

FIG. 3 shows the expression analysis results of the HbICE2 gene in the cold-resistant variety and the cold-resistant variety of the rubber tree under the low temperature condition.

FIG. 4 shows the result of identifying cold tolerance of Arabidopsis plants overexpressing the HbICE2 gene, wherein WT: control, 35: HbICE 2: transgenic Arabidopsis with the HbICE2 gene.

FIG. 5 shows the results of the salt tolerance identification of Arabidopsis plants overexpressing the HbICE2 gene, wherein WT: control, 35: HbICE 2: transgenic Arabidopsis with the HbICE2 gene.

FIG. 6 shows the drought tolerance identification results of Arabidopsis plants overexpressing the HbICE2 gene, in which WT: control, 35: HbICE 2: transgenic Arabidopsis with the HbICE2 gene.

Detailed Description

The invention will be better understood from the following description of specific embodiments with reference to the accompanying drawings. The examples do not specify particular techniques or conditions, and are performed according to the techniques or conditions described in the literature in the art or according to the product specifications. The reagents or instruments used are not indicated by the manufacturer, and are all conventional products commercially available.

First, obtaining a Gene

The transcription factor HbICE2 gene is cloned from the bark of the Brazilian rubber tree varieties 93-114 by using the RT-PCR technology, and the specific embodiment is as follows:

the total RNA of the bark of the rubber tree is extracted according to the operation instruction of the kit for extracting the total RNA of the Tiangen RNAprep Pure polysaccharide polyphenol plant. First strand cDNA was synthesized according to the procedures of the reagents kit. According to the rubber tree genomic database, Unigene annotated as ICE is obtained and preliminarily identified as a complete gene sequence by means of search and comparison of NCBI database.

First strand cDNA as template, HbICE2-F (SEQ ID NO: 3): ATGCTATCTGGACTAAATGGCA and HbICE2-R (SEQ ID NO:4), CTATATCATTCCATGGAAGCCTG is used as a primer, a cDNA sequence of a transcription factor HbICE2 gene is obtained through PCR amplification reaction, and an amplification system: pyrobest DNA Polymerase (5U. mu.L)^-1)1μL，10×Pyrobest Buffer II 5μL，dNTP Mixture(2.5mmol·L^-1)4μL，HbICE2-F(10μmol·L^-1)1μL，HbICE2-R(10μmol·L^-1) mu.L, 1. mu.L of cDNA template, and sterile water to make up 50. mu.L. The amplification procedure was: pre-denaturation at 95 ℃ for 3 min; 30s at 95 ℃, 30s at 60 ℃ and 2min at 72 ℃ for 32 cycles; extension at 72 ℃ for 10 min.

0.2% agarose gel electrophoresis was performed to separate PCR amplification products, and the target band was recovered and purified, cloned into pEASY-Blunt Simple cloning vector, and E.coli competent cell DH 5. alpha. was transformed, and the positive clone was picked up and sent to Invitrogen for sequencing. Homology analysis using BLAST searches of the GenBank database revealed that a complete reading frame in the ICE family gene was cloned (fig. 1). Multiple alignment analysis was performed using MEGA5.10 software and phylogenetic trees were constructed. The results indicated that the cloned ICE gene belongs to the ICE family, is one of the 5 members of this family, and thus the gene was named HbICE2 (fig. 2).

Second, analysis of Gene expression Pattern

In long-term cold-resistant sentinel nursery and field practices, cold-resistant varieties rubber trees 93-114, rubber tree GT1 and rubber tree INA873, cold-intolerant varieties hot reclamation 501, sea reclamation 1 and hot reclamation 515 were identified. Thus, the six varieties were used as materials, and treated at low temperature (4 ℃), samples were collected at 0h, 4h, 8h and 24h of treatment, 5 strains each mixed sample, and 3 biological replicates. And analyzing the expression pattern of the transcription factor HbICE2 gene of the rubber tree by using a fluorescence quantitative technology. The fluorescent quantitative primer sequence of the HbICE2 gene is shown as HbICE2-Q-F (SEQ ID NO: 5): CGATCTTCCCTTTCCAACTACCT and HbICE2-Q-R (SEQ ID NO: 6): CAAAAATAGCGTATTCCCTGAGC, primer sequences of reference Gene ACTIN7a (Gene Bank accession number: HQ260674) such as ACTIN7a-F: GGCACTTTGGTACTCAAGTC and ACTIN7a-R: GAAGCATCCCAATCACTCTC. The fluorescent quantitative PCR was performed using a CFX-384 fluorescent quantitative PCR instrument from BioRad, and the reaction procedure was as follows: pre-denaturation at 95 ℃ for 30s, pre-denaturation at 94 ℃ for 5s, pre-denaturation at 60 ℃ for 20s, and pre-denaturation at 72 ℃ for 20s, performing 45 cycles, drawing a melting curve after amplification is finished, gradually heating from 50 ℃ to 95 ℃, wherein the heating speed is 0.2 ℃/s, and detecting a fluorescence signal in the whole process. And respectively detecting the expression conditions of the HbICE2 in the cold-resistant variety and the cold-resistant variety of the rubber tree. As a result, the background expression of HbICE2 in cold-resistant varieties 93-114, GT1 and INA873 of rubber trees is significantly higher than that of cold-resistant varieties such as hot reclamation 501, sea reclamation 1 and hot reclamation 515. Under low temperature stress, HbICE2 shows up-regulated expression tendency in both cold-resistant varieties and cold-resistant varieties, but the expression levels in the cold-resistant varieties 93-114, GT1 and INA873 are obviously higher than those in the cold-resistant varieties such as hot reclamation 501, sea reclamation 1 and hot reclamation 515, and particularly, the difference is extremely obvious when the low temperature treatment is carried out for 4h and 8 h. This indicates that the HbICE2 gene is associated with low temperature stress resistance in hevea brasiliensis (fig. 3).

Third, genetic transformation

Using the plasmid with sequencing verification as a template, and using HbICE2-TR-F (SEQ ID NO: 7): gACTAGTATGCTATCTGGACTAAATGG (underlined Spe I cleavage site) and HbICE2-TR-R (SEQ ID NO: 8): gGGTGACCCTATATCATTCCATGGAAGC (BstE II enzyme cutting site is underlined) is used as a primer, the ORF of the HbICE2 gene is amplified, the amplified product is connected to an expression vector pCAMBIA1302 after the same enzyme cutting through double enzyme cutting, the integrity of the target gene and the correctness of the connection sequence are identified through sequencing, and the plasmid with the HbICE2 gene ORF is transformed into the GV3101 strain through heat shock. Infecting an arabidopsis thaliana inflorescence by an agrobacterium-mediated method, transforming an HbICE2 gene into a seed to be formed for overexpression, identifying a transgenic positive plant, screening a T3 generation positive plant containing a target gene and identifying and analyzing cold resistance, and taking a normal plant without transgene as a control (WT), wherein the result shows that an arabidopsis thaliana strain of a transfer medium HbICE2 cultured for 4 weeks is treated for 15 hours at a low temperature of-5 ℃, and then is normally recovered and cultured for 2 weeks, the survival rate of the arabidopsis thaliana strain of the overexpression HbICE2 is higher than 60 percent, and the survival rate of the control WT is only 11 percent (figure 4). This indicates that HbICE2 can improve the low temperature stress resistance of transgenic plant lines. May have great regulation and control effect on the low temperature stress resistance of rubber trees.

Using a normal plant without transgenosis as a control (WT), carrying out water drenching on an arabidopsis thaliana strain and a WT plant which are cultured for 4 weeks and are transferred with HbICE2 by using a 300mM sodium chloride solution, carrying out water drenching once every 5 days, and carrying out salt stress culture for 2 weeks at the temperature of 23 ℃, wherein the result shows that the leaf of the control WT plant is dehydrated and dried up, part of the plant is dead, and the survival rate is 54%; however, the Arabidopsis line with the transferred HbICE2 did not show dead plants and had bolting and flowering fruit pods with a 100% survival rate (FIG. 5). The HbICE2 can improve the capability of the transgenic plant line to resist high salt stress.

Using a normal plant without transgene as a control (WT), Arabidopsis plants of transgenic HbICE2 were cultured under normal conditions for 4 weeks, then the water drenching was stopped, i.e., drought treatment for 2 weeks, and the results showed that the leaves of the WT plants were dehydrated and withered, the old leaves of the plants of transgenic HbICE2 were withered, the young leaves were also grown normally, and bolting, flowering and fruiting pods were performed. Drought-treated WT and transgenic HbICE2 arabidopsis plants were then watered and cultured normally for 8 days, and the results showed that the survival rate of WT was 63%, whereas transgenic HbICE2 arabidopsis plants did not die completely and both had bloomed and resulted in 100% survival (fig. 6). Therefore, HbICE2 can improve the drought stress resistance of the transgenic plant line.

The embodiments of the present invention have been described in detail, but the embodiments are merely examples, and the present invention is not limited to the embodiments described above. Any equivalent modifications and substitutions to those skilled in the art are also within the scope of the present invention. Accordingly, equivalent changes and modifications made without departing from the spirit and scope of the present invention should be covered by the present invention.

Sequence listing

<110> rubber institute of tropical agricultural academy of sciences of China

<120> rubber tree transcription factor HbICE2 and encoding gene and application thereof

<160> 8

<170> SIPOSequenceListing 1.0

<210> 1

<211> 530

<212> PRT

<213> Artificial

<400> 1

Met Leu Ser Gly Leu Asn Gly Thr Val Trp Met Glu Asp Lys Glu Ala

1 5 10 15

Arg Asp Ser Asn Thr Asn Asn Asn Ile Asn Asn Ser Cys Val Val Met

20 25 30

Glu Ser Lys Gln Glu Met Gly Ser Ile Ser Asn Phe Lys Ser Met Leu

35 40 45

Asp Val Glu Asp Asp Trp Tyr Val Thr Asn Thr Thr Ile His Asn His

50 55 60

His Asp Thr Ile Arg Asp Ile Thr Phe Ser Pro Asn Leu Ala Glu Pro

65 70 75 80

Asp Asn Leu Phe Leu His Ser Val Asp Ser Ser Ser Ser Cys Ser Pro

85 90 95

Thr Ser Ser Val Phe Asn Asn Leu Asp Pro Ser His Val His Tyr Phe

100 105 110

Met His Ser Lys Pro Thr Leu Ser Ser Leu Leu Asn Val Val Ser Asn

115 120 125

Asn Pro Leu Glu His Gly Phe Asp Leu Gly Glu Ile Gly Phe Leu Glu

130 135 140

Asn Gln Ala Thr Ala Pro Thr Thr Thr Thr Asn Ala Ser Pro Leu Leu

145 150 155 160

Asn Arg Gly Ala Gly Val Leu Gly Ser Tyr Ile Asp Phe Ser Ser Asn

165 170 175

Asn Gln Ile Ser Thr Ser Asn Leu Cys Ser Asp Leu Pro Phe Pro Thr

180 185 190

Thr Cys Met Leu Gln Leu Pro Glu Asn Gly Pro Gly Leu Thr Gly Phe

195 200 205

Arg Gly Ser Asp Glu Ser Ser Gly Asn Thr Leu Phe Leu Asn Arg Ser

210 215 220

Lys Leu Leu Arg Pro Leu Glu Thr Phe Pro Ser Met Gly Ala Gln Pro

225 230 235 240

Thr Leu Phe Gln Lys Arg Ala Ala Leu Arg Lys Asn Leu Gly Asp Leu

245 250 255

Ser Gly Ile Glu Ile Asp Lys Gly Lys Arg Glu Leu Thr Gln Leu Gly

260 265 270

Lys Glu Asn Glu Lys Lys Arg Lys Met Gly Asn Val Asp Asp Ile Val

275 280 285

Glu Asp Val Ser Ile Asp Gly Ser Gly Leu Asn Tyr Asp Ser Asp Glu

290 295 300

Leu Thr Glu Asn Thr Lys Met Glu Glu Ile Gly Lys Asn Gly Gly Asn

305 310 315 320

Ser Ser Asn Ala Asn Ser Ser Val Thr Gly Gly Gly Val Gly Asp Gln

325 330 335

Lys Gly Lys Lys Lys Gly Leu Pro Ala Lys Asn Leu Met Ala Glu Arg

340 345 350

Arg Arg Arg Lys Lys Leu Asn Asp Arg Leu Tyr Met Leu Arg Ser Val

355 360 365

Val Pro Lys Ile Ser Lys Met Asp Arg Ala Ser Ile Leu Gly Asp Ala

370 375 380

Ile Glu Tyr Leu Lys Glu Leu Leu Gln Arg Ile Asn Asp Leu His Asn

385 390 395 400

Glu Leu Glu Ser Thr Pro Pro Gly Ser Ser Leu Thr Pro Thr Ser Phe

405 410 415

His Pro Leu Thr Pro Thr Pro Ser Thr Leu Ser Ser Arg Ile Lys Asp

420 425 430

Lys Leu Cys Pro Ser Pro Leu Pro Ser Pro Asn Gly Gln Pro Ala Arg

435 440 445

Val Glu Val Arg Val Arg Glu Gly Arg Ala Val Asn Ile His Met Phe

450 455 460

Cys Gly Arg Arg Pro Gly Leu Leu Leu Ser Thr Ile Arg Ala Leu Asp

465 470 475 480

Asn Leu Gly Ile Asp Ile Glu Gln Ala Val Ile Ser Cys Phe Asn Gly

485 490 495

Phe Ala Met Asp Ile Phe Gln Ala Glu Gln Lys Gly Gln Asp Val His

500 505 510

Pro Glu Gln Ile Arg Ala Val Leu Leu Asp Ser Ala Gly Phe His Gly

515 520 525

Met Ile

530

<210> 2

<211> 1593

<212> DNA

<213> Artificial

<400> 2

atgctatctg gactaaatgg cactgtctgg atggaagata aagaagcacg agactccaac 60

acaaacaaca acattaacaa tagctgtgtt gtgatggaga gcaagcaaga gatgggttcg 120

atttctaact tcaaatccat gctcgatgta gaagacgact ggtacgtcac taatactact 180

atccataatc atcatgatac tatcagagac atcacatttt caccaaatct tgctgagcca 240

gataatctct ttcttcactc tgtggattcc tcctcttctt gctcaccaac ctcctctgtt 300

ttcaataatc tagacccttc tcacgtgcac tactttatgc actcgaagcc taccttatct 360

tcgctcctta acgttgtctc taacaaccct ttagagcatg gctttgattt gggcgaaatt 420

gggttccttg agaaccaggc aactgctcct acaacaacaa caaacgcctc gcctttgcta 480

aacaggggag ctggggtctt aggcagctac attgatttta gctcaaataa tcaaattagc 540

acttctaatt tatgctccga tcttcccttt ccaactacct gcatgctcca attgcccgaa 600

aatggtccag ggttaacagg atttaggggt tctgatgaga gctcagggaa tacgctattt 660

ttgaataggt ccaagttgtt gaggcctctt gaaacctttc cttcaatggg tgcacagcct 720

actttgtttc aaaagagagc agctttgagg aagaatttgg gggatttgag tgggattgag 780

attgataaag gaaagagaga attgactcag ttgggcaaag agaatgagaa gaagagaaaa 840

atgggtaacg tggatgacat tgtggaggat gtaagcattg atgggtcggg tttaaattat 900

gattctgatg agttaacgga gaatactaaa atggaggaga ttggtaaaaa tggagggaat 960

agctcaaatg caaatagcag tgtcactggc ggtggtgttg gggatcagaa gggaaagaag 1020

aaggggcttc ctgctaagaa tttgatggca gaaaggagac gccggaagaa gctcaatgat 1080

aggctataca tgctaaggtc tgtagttcca aagataagca agatggatag ggcatcaatc 1140

cttggggatg caattgagta cttgaaggaa cttctgcaaa ggatcaacga cctccataat 1200

gaattggagt caactcctcc tggctcttct ttgacgccta caagttttca ccctttgaca 1260

cccactccat caaccctgtc cagtcgtatc aaggataaac tctgccccag cccattgcca 1320

agtccaaatg gtcaaccagc aagggttgaa gtaagagtga gagaaggaag agctgtaaac 1380

attcacatgt tttgtggccg cagacctggt ctcctgctct ccaccatcag ggccttggat 1440

aaccttggca tagatatcga gcaagctgtc atcagttgtt tcaatggttt tgccatggat 1500

atcttccaag ctgagcaaaa agggcaggac gtgcatcctg agcaaattag agcagtactc 1560

ctggattcag caggcttcca tggaatgata tag 1593

<210> 3

<211> 22

<212> DNA

<213> Artificial

<400> 3

atgctatctg gactaaatgg ca 22

<210> 4

<211> 23

<212> DNA

<213> Artificial

<400> 4

ctatatcatt ccatggaagc ctg 23

<210> 5

<211> 23

<212> DNA

<213> Artificial

<400> 5

cgatcttccc tttccaacta cct 23

<210> 6

<211> 23

<212> DNA

<213> Artificial

<400> 6

caaaaatagc gtattccctg agc 23

<210> 7

<211> 27

<212> DNA

<213> Artificial

<400> 7

gactagtatg ctatctggac taaatgg 27

<210> 8

<211> 28

<212> DNA

<213> Artificial

<400> 8

gggtgaccct atatcattcc atggaagc 28

Claims

1. A rubber tree transcription factor HbICE2 is characterized in that an amino acid sequence of the rubber tree transcription factor HbICE2 is shown in SEQ ID NO. 1.

2. A hevea brasiliensis transcription factor HbICE2 gene is characterized in that the nucleotide sequence is shown in SEQ ID NO. 2.

3. A recombinant vector comprising a primary vector and the hevea brasiliensis transcription factor HbICE2 gene of claim 2.

4. The recombinant vector according to claim 3, wherein the original vector is pCAMBIA1302 vector plasmid, and the nucleotide sequence shown in SEQ ID NO. 2 is located between the two restriction enzyme sites SpeI and BstEII of the pCAMBIA1302 vector plasmid.

5. Use of the hevea brasiliensis transcription factor HbICE2 of claim 1, or the hevea brasiliensis transcription factor HbICE2 gene of claim 2, or the recombinant vector of claim 3 or 4 for increasing cold tolerance, and/or salt tolerance, and/or drought tolerance in a plant.

6. Use according to claim 5, wherein the salt is sodium chloride.

7. A method for improving cold tolerance, salt tolerance and/or drought tolerance of a plant, which comprises transfecting the plant with the Hevea brasiliensis transcription factor HbICE2 gene of claim 2 or the recombinant vector of claim 3 or 4.

8. A primer pair is characterized in that the nucleotide sequence is shown as SEQ ID NO. 3 and SEQ ID NO. 4.

9. A primer pair is characterized in that the nucleotide sequence is shown as SEQ ID NO. 5 and SEQ ID NO. 6.

10. A primer pair is characterized in that the nucleotide sequence is shown as SEQ ID NO. 7 and SEQ ID NO. 8.