CN114410483A - Trichoderma harzianum and application thereof in degradation of waste orchard branches - Google Patents

Abstract

The invention discloses trichoderma harzianum and application thereof in degrading waste branches in orchards, and relates to the technical field of microorganisms. The Trichoderma harzianum SDAU-H disclosed by the invention is preserved in the China general microbiological culture Collection center of the China Committee for culture Collection of microorganisms with the preservation number of CGMCC No.23810, the preservation date of 2021 year, 11 month and 17 days, and the preservation address of No. 3 Hospital No. 1 Hospital of North West Chen in the sunward area of Beijing. The trichoderma harzianum provided by the invention has the capacity of degrading lignin and cellulose, can improve the activity of degrading enzymes in waste piles, can play a degrading role to promote the nitrate nitrogen content of piles to be increased, and can improve the degradation efficiency of waste branches in orchards.

Description

Trichoderma harzianum and application thereof in degradation of waste orchard branches

Technical Field

The invention relates to the technical field of microorganisms, in particular to trichoderma harzianum and application thereof in degrading waste orchard branches.

Background

A large amount of wastes such as dead branches and fallen leaves are generated in an orchard every year, waste fruit tree branches are directly discarded in the orchard or are simply burnt due to unreasonable treatment, the appearance of the orchard is affected, resources are wasted, the discarded branches provide habitat for orchard pests, the discarded branches are easy to become infection sources of orchard diseases and insect pests, and the burnt branches directly cause harm to the environment.

The part of the orchard waste which is difficult to degrade is mainly orchard waste branches, and the main component of the branches is lignocellulose. Under natural conditions, lignocellulose is water-insoluble and biologically resistant due to the particularity of its own physical structure and chemical composition, and thus is difficult to hydrolyze or directly metabolized by microorganisms, thereby preventing its rapid degradation and recycling. The lignocellulose comprises 40-50% of cellulose, 20-35% of hemicellulose and 15-30% of lignin, wherein the cellulose is macromolecular polysaccharide formed by D-glucose through beta-1, 4 glycosidic bonds and exists in a plurality of tightly arranged micro-silks to form a skeleton of a cell wall. Before the microorganisms use the cellulose, it must be released from the lignin and hemicellulose coating, resulting in low cellulose utilization and slow actual operation time. Hemicellulose has a more complex structure than cellulose, and not only comprises a main chain skeleton, but also comprises a series of different side chain substituents and the like. Hemicellulose permeates into the matrix material in an amorphous state, is connected with lignin formed only at the last stage of cell differentiation through chemical bonds, and is then wrapped outside fibers so as to increase the rigidity of cell walls. Lignin is a natural organic high molecular compound with an extremely complex structure and is also one of the most difficult biodegradable organic compounds. Lignin is a phenolic polymer, and monomers are connected with each other through ether bonds and carbon-carbon bonds, so that the lignin is difficult to hydrolyze. Lignin plays a supporting and protective role for plants. But also the difficult-to-degrade lignin is tightly combined with the cell wall, so that the plant wood fiber structure is stable and is not easy to biodegrade.

Disclosure of Invention

The invention aims to provide trichoderma harzianum and application thereof in degrading waste orchard branches so as to solve the problems in the prior art.

In order to achieve the purpose, the invention provides the following scheme:

the invention provides a Trichoderma harzianum (Trichoderma harzianum) SDAU-H which is preserved in the China general microbiological culture Collection center of the China Committee for culture Collection of microorganisms, wherein the preservation number is CGMCC No.23810, the preservation date is 2021 year, 11 month and 17 days, and the preservation address is No. 3 Hospital No. 1 Hospital of North Kogyo area in Beijing.

The invention also provides a microbial agent, which comprises the trichoderma harzianum.

The invention also provides a preparation method of the microbial agent, which comprises the following steps: and uniformly mixing the wood chips of the branches of the fruit trees, the locust manure and the corncobs, sterilizing, then inoculating the trichoderma harzianum, and culturing to obtain the microbial agent.

Further, the fruit tree branch wood chips are apple tree branch wood chips or peach tree branch wood chips.

Further, the mass ratio of the fruit tree branch wood chips to the locust manure to the corncobs is 3:1: 1.

Further, the culture is carried out for 20-30 days at 25 ℃.

The invention also provides application of the trichoderma harzianum or the microbial agent in degradation of waste branches in orchards.

Further, the waste branches are apple tree branches or peach tree branches.

The invention also provides a method for degrading the abandoned branches in the orchard garden, which comprises the following steps:

(1) preparing the microbial agent according to the method;

(2) uniformly mixing the wood chips of the branches of the fruit trees, the locust manure and the corncobs, sterilizing, inoculating the microbial agent prepared in the step (1), and performing composting degradation.

Further, in the step (2), the inoculation amount of the microbial agent is 50-70% of the total weight of the fruit tree branch wood chips, the locust manure and the corncobs.

The invention discloses the following technical effects:

(1) the Trichoderma harzianum provided by the invention has the capacity of degrading lignin and cellulose, wherein the lignin has higher degradation efficiency, and the degradation rate of the Trichoderma harzianum to lignin in waste stacking materials reaches 32%.

(2) The trichoderma harzianum provided by the invention can improve the activity of degrading enzymes in waste stacking materials.

(3) The trichoderma harzianum provided by the invention can play a role in degradation and promote the increase of the nitrate nitrogen content of the heap.

Drawings

In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings needed in the embodiments will be briefly described below, and it is obvious that the drawings in the following description are only some embodiments of the present invention, and it is obvious for those skilled in the art to obtain other drawings without creative efforts.

FIG. 1 is a graph of a sample of degraded peach tree branch waste from test group 0 of Table 2 of example 2;

FIG. 2 is a graph of a sample of degraded peach tree branch waste from test group 1 of Table 2 of example 2;

FIG. 3 is a graph of a sample of degraded peach tree branch waste of test group 2 of Table 2 of example 2;

FIG. 4 is a graph of a sample of degraded peach tree branch waste of test group 3 of Table 2 of example 2;

FIG. 5 is a graph of a sample of degraded peach tree branch waste from test group 4 of Table 2 of example 2;

FIG. 6 is a graph of a sample of degraded peach branch waste from test group 5 of Table 2 of example 2;

FIG. 7 is a graph of a sample of degraded peach tree branch waste from test group 6 of Table 2 of example 2;

FIG. 8 is a graph of a sample of degraded apple tree branch waste from test group 7 of Table 2 of example 2;

FIG. 9 is a graph of a sample of degraded apple tree branch waste from test group 8 of Table 2 of example 2;

FIG. 10 is a graph of a sample of degraded apple tree branch waste from test group 9 of Table 2 of example 2;

FIG. 11 is a graph of a sample of degraded apple branch waste from test group 10 of Table 2 of example 2;

FIG. 12 is a graph of a sample of degraded apple tree branch waste from test group 11 of Table 2 of example 2;

FIG. 13 is a graph of a sample of degraded apple tree branch waste from test group 12 of Table 2 of example 2;

FIG. 14 is a graph showing the temperature change of the waste peach branch stockpile when the inoculation amount is 50%, wherein T50% HC represents the addition of the decomposing agent, and T50% HC does not represent the addition of the decomposing agent;

FIG. 15 is a graph showing the temperature change of the waste peach branch stockpile when the inoculation amount is 60%, wherein T60% HC represents the addition of the decomposing agent, and T60% HC does not represent the addition of the decomposing agent;

FIG. 16 is a graph showing the temperature change of the waste peach branch stockpile when the inoculation amount is 70%, wherein T70% HC represents the addition of the decomposing agent, and T70% HC does not represent the addition of the decomposing agent;

FIG. 17 is a graph showing the temperature change of the waste compost of apple branches when the inoculation amount is 50%, wherein PG 50% HC represents the addition of a decomposing agent, and PG 50% HC does not represent the addition of no decomposing agent;

FIG. 18 is a graph showing the temperature change of the waste compost of apple branches when the inoculation amount is 60%, wherein PG 60% HC represents the addition of a decomposing agent, and PG 60% HC does not represent the addition of no decomposing agent;

FIG. 19 is a graph showing the temperature change of the waste compost of apple branches when the inoculation amount is 70%, wherein PG 70% HC represents the addition of a decomposing agent, and PG 70% HC does not represent the addition of no decomposing agent;

FIG. 20 is a graph of xylanase activity in peach tree waste from Trichoderma harzianum SDAU-H, where "+" represents a decomposing agent;

FIG. 21 is a CMC enzyme map of Trichoderma harzianum SDAU-H in peach tree waste, where "+" represents a decomposing agent;

FIG. 22 is a graph of xylanase activity in apple tree waste of Trichoderma harzianum SDAU-H, wherein "+" represents the presence of a maturing agent;

FIG. 23 is a CMC enzyme map of Trichoderma harzianum SDAU-H in apple tree waste, wherein "+" represents a decomposing agent;

FIG. 24 is a graph of the reduction in weight of peach branch waste by Trichoderma harzianum SDAU-H, where "+" represents the presence of a maturing agent;

FIG. 25 is a graph of the reduction in weight of apple tree branch waste by Trichoderma harzianum SDAU-H, where "+" represents the presence of a maturing agent;

FIG. 26 shows the degradation rate of Trichoderma harzianum SDAU-H on cellulose, hemicellulose and lignin in waste;

FIG. 27 is a graph of potassium content changes in peach branch compost, where "plus" indicates the presence of a decomposing agent and "not plus" indicates the absence of a decomposing agent;

FIG. 28 is a graph of potassium content changes in apple branch compost, where "plus" indicates the presence of a decomposing agent and "not plus" indicates the absence of a decomposing agent;

FIG. 29 is a graph showing the variation of phosphorus content in peach branch compost, wherein "plus" indicates the presence of a decomposing agent and "not plus" indicates the absence of a decomposing agent;

FIG. 30 is a graph of the change in phosphorus content in apple branch compost, wherein "plus" indicates the presence of a decomposing agent and "not plus" indicates the absence of a decomposing agent;

FIG. 31 is a graph showing the change of nitrate nitrogen content in peach branch compost, wherein "plus" represents the presence of a decomposing agent and "not plus" represents the absence of a decomposing agent;

FIG. 32 is a graph of the change in nitrate nitrogen content in apple branch compost, wherein "plus" indicates the presence of a decomposing agent and "not plus" indicates the absence of a decomposing agent;

FIG. 33 is a graph showing the variation of ammonium nitrogen content in peach branch compost, wherein "add" indicates the presence of a decomposing agent and "not add" indicates the absence of a decomposing agent;

FIG. 34 is a graph of the change in ammonium nitrogen content in apple branch compost, where "add" indicates the presence of a decomposing agent and "not add" indicates the absence of a decomposing agent.

Detailed Description

Reference will now be made in detail to various exemplary embodiments of the invention, the detailed description should not be construed as limiting the invention but as a more detailed description of certain aspects, features and embodiments of the invention.

It is to be understood that the terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting of the invention. Further, for numerical ranges in this disclosure, it is understood that each intervening value, between the upper and lower limit of that range, is also specifically disclosed. Every intervening value, to the extent any stated value or intervening value in a stated range, and any other stated or intervening value in a stated range, is encompassed within the invention. The upper and lower limits of these smaller ranges may independently be included or excluded in the range.

Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Although only preferred methods and materials are described herein, any methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention. All documents mentioned in this specification are incorporated by reference herein for the purpose of disclosing and describing the methods and/or materials associated with the documents. In case of conflict with any incorporated document, the present specification will control.

It will be apparent to those skilled in the art that various modifications and variations can be made in the specific embodiments of the present disclosure without departing from the scope or spirit of the disclosure. Other embodiments will be apparent to those skilled in the art from consideration of the specification. The description and examples are intended to be illustrative only.

As used herein, the terms "comprising," "including," "having," "containing," and the like are open-ended terms that mean including, but not limited to.

In the following examples, the media, reagents, test materials and instruments used are as follows:

culture medium:

potato dextrose agar medium (PDA): 200g/L of potato, 20g/L of glucose and 20g/L of agar.

Congo red cellulose agar: k₂HPO₄1.0g，MgSO₄`7H₂0.5g of O, 20g of agar, 0.5g of NaCl, (NH)₄)₂SO₄2.0g, CMC-Na 2.0g, Congo red 0.2g, 1000mL of water, and natural pH.

PDA-guaiacol medium: 0.02% guaiacol was added to PDA medium.

Reagents and test materials:

birch xylan (birchwood xylan, Sigma), Congo red dye liquor, NaCl aqueous solution, and decomposing agent (Yuanduba brand).

DNS reagent: 18.2g of sodium potassium tartrate (CMC-Na) was dissolved in 50mL of distilled water and heated. 0.03g of 3, 5-dinitrosalicylic acid, 2.1g of NaOH and 0.5g of phenol are sequentially added into the hot solution, stirred until the mixture is completely dissolved, cooled, and then added with distilled water to a constant volume of 100mL, and the mixture is stored in a brown bottle.

1% CMC buffer: 1g of CMC was weighed out and dissolved in 100mL of 50mol/L citric acid and 100mmol of disodium hydrogen phosphate buffer solution (pH 6.0).

1% xylan solution: prepared with 50mmol/LpH ═ 10 glycine-sodium hydroxide buffer.

1mg/mL xylose standard solution: putting the anhydrous xylose into an oven at 80 ℃ for drying operation until the weight of the xylose is constant, accurately measuring 0.1g of xylose solid, adding a proper amount of distilled water for fully dissolving, and fixing the volume to 100 mL.

1mg/mL glucose standard solution: accurately weighing 100mg of glucose, adding a proper amount of distilled water to fully dissolve the glucose, metering the volume to 100mL, and storing at 4 ℃ for later use.

0.16mmol/L cotton blue lactate staining solution: 0.01223g of AzureB dye was added to 200mL of distilled water and dissolved sufficiently, and the volume was set to 250mL with distilled water.

72% sulfuric acid solution: 665mL of 98% concentrated H is accurately measured₂S0₄Slowly add to 300mL distilled water, and continue to make up to 1L with distilled water.

Neutral detergents: accurately weighing 18.61g of EDTA and 6.18g of sodium tetraborate, placing the EDTA and the sodium tetraborate in a beaker, adding a small amount of distilled water, heating to fully dissolve the EDTA and the sodium tetraborate, adding 30g of sodium dodecyl sulfate, 4.56g of disodium hydrogen phosphate and 10mL of ethoxyethanol, adding distilled water, heating the beaker to dissolve and mix all solids, continuously adding the distilled water to a constant volume of 1L, and adjusting the pH of the detergent to be neutral by using a 75% sulfuric acid solution.

Acid detergents: accurately weighing 27.2mL of concentrated sulfuric acid, placing the concentrated sulfuric acid in 900mL of distilled water, fully and uniformly mixing, adding 20g of hexadecyl trimethyl desertification amine, fully and uniformly mixing, and adding distilled water to reach a constant volume of 1L.

The sources of the abandoned branches in the orchard are as follows: peach branches with the diameter of 20mm are from peach gardens of Shandong-sourced ecological agriculture development Limited liability company, and apple branches with the diameter of 20mm are from apple gardens of Shandong-Taian-Yangyu. And respectively crushing the peach branches and the apple branches into wood chips for later use.

A decomposing inoculant: the main components are bacillus subtilis, bacillus licheniformis, bacillus amyloliquefaciens, cellulose, ligninase, hemicellulase and vitamins.

Other materials: locust manure is sourced from Shandong-Yuan ecological agriculture development Limited liability company, and corncobs are purchased from farmers in Shandong Tai Annan school areas.

The instrument comprises the following steps: see table 1.

Table 1 list of main experimental instruments

Example 1 isolation, identification, and preservation of strains

First, separate

A strain is obtained by separating a collected specimen of a trunk of a pear tree in a bacterial base of southern school district of Shandong agricultural university and named as SDAU-H.

II, identification

1. Morphological identification

The SDAU-H bacterial colony is villous and white in the early growth stage, the color changes from light green to dark green along with the aging of hyphae, spores are dark green spherical, and the spore yield is large.

2. Molecular biological identification

ITS sequencing is carried out on the SDAU-H, the SDAU-H is identified as Trichoderma harzianum, and the ITS sequence (SEQ ID NO: 1) is as follows:

TGGGGCTTCACTCCCAACCCAATGTGAACGTTACCAAACTGTTGCCTCGGCGGGATCTCTGCCCCGGGTGCGTCGCAGCCCCGGACCAAGGCGCCCGCCGGAGGACCAACCAAAACTCTTTTTGTATACCCCCTCGCGGGTTTTTTATAATCTGAGCCTTCTCGGCGCCTCTCGTAGGCGTTTCGAAAATGAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGTATTCTGGCGGGCATGCCTGTCCGAGCGTCATTTCAACCCTCGAACCCCTCCGGGGGGTCGGCGTTGGGGATCGGCCCTGCCTCTTGGCGGTGGCCGTCTCCGAAATACAGTGGCGGTCTCGCCGCAGCCTCTCCTGCGCAGTAGTTTGCACACTCGCATCGGGAGCGCGGCGCGTCCACAGCCGTTAAACACCCAACTTCTGAAATGTTGACCTCGGATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAAAAGCCGGAGGAA。

III, preservation

The strain SDAU-H is preserved in the China general microbiological culture Collection center (CGMCC) with the preservation number of CGMCC No.23810, the preservation date of 2021, 11 months and 17 days, and the preservation address of No. 3 Siro No. 1 of Beijing, Chaoyang, and North Cheng, respectively.

Example 2

First, test method

1.1 determination of the ability to degrade lignocellulose

CMC culture medium Congo red staining test: inoculating the strain SDAU-H to a CMC culture medium, culturing at 25 ℃ for 5 days, pouring a Congo red color developing agent into a plate containing bacterial colonies, carrying out color development reaction for 15min, pouring the color developing agent, then putting the plate into a 1mol/L sodium chloride solution for 15min, eluting the Congo red of the degraded part of cellulose to form a transparent ring, indicating that the corresponding bacterial strains can secrete cellulase and degrade the cellulose, measuring the diameter (D, cm) of the bacterial colonies and the diameter (D, cm) of a hydrolysis ring, and expressing the hydrolysis capacity Dp as (D/D)2 by adopting Dp. If the ratio of the diameter of the transparent ring to the diameter of the bacterial colony is larger, the cellulose degradation capability of the bacteria is stronger.

PDA-guaiacol color development test: after the strain SDAU-H is inoculated into a PDA-guaiacol culture medium and cultured for 5D at 25 ℃, whether colorless guaiacol can be oxidized into reddish brown by laccase is observed, if reddish brown oxidation rings are generated, three fungi can generate laccase, the colony diameter (D, cm) and the hydrolysis ring diameter (D, cm) are measured, and the hydrolysis capacity Dp is expressed as (D/D)2 by Dp. If the ratio of the diameter of the oxidation ring to the diameter of the bacterial colony is larger, the level of laccase production activity of the corresponding bacterial strain is judged, and then whether the bacterial strain can remove lignin is qualitatively detected.

1.2 degradation effect on orchard waste

1.2.1 preparation of solid microbial Agents

Taking SDAU-H strain stored in laboratory from 4 deg.C refrigerator, selecting small amount of hypha, inoculating to PDA culture medium, culturing at 25 deg.C in incubator for 3-5 days, taking the place where colony edge grows vigorously, inoculating to PDA culture medium again, culturing at 25 deg.C for 5 days, and making use of punch to obtain bacterial cake with 7mm edge diameter and 2mm thickness in PDA culture medium plate. Pre-wetting and uniformly mixing the apple branch/peach branch sawdust, locust manure and corncobs which are crushed into 20mm in diameter according to the mass ratio of 3:1:1, adjusting the water content to be about 60%, then putting the mixture into polypropylene fungus bags (the specification is 12cm multiplied by 24cm), sterilizing the mixture at 125 ℃ for 120min, cooling the mixture, inoculating 8 fungus cakes of a fungus into each fungus bag, and culturing the fungus cakes at 25 ℃ for 20-30 d to obtain the solid microbial inoculum.

1.2.2 degradation of orchard waste

Setting each pile of degradation material to weigh 5kg, adding 1kg of locust manure and 1kg of corncob into each pile, adding 3kg of sawdust of apple branches or peach branches, uniformly stirring, sterilizing at the temperature of 121 ℃ for 30min, respectively inoculating 50 wt%, 60 wt% and 70 wt% of solid microbial inoculum prepared by 1.2.1 with different microbial doses to the orchard waste degradation material mixed with a plurality of apples or peach branches according to the table 2, and setting a sample without any fungi as a blank control according to whether a decomposition agent is added or not as another variable, and setting 3 groups of samples in each group to repeat.

And placing the prepared orchard waste experimental group and the control group in a constant-temperature 25 ℃ constant-humidity 60% air-conditioning room, continuously degrading for 30 days, observing the degradation process change of the sample, and recording the observed physical property change of the sample.

TABLE 2 solid inoculum size and sample composition design table

Note: HC means Trichoderma harzianum SDAU-H, "/" means no decomposing agent and "+" means decomposing agent.

1.2.3 determination of pile temperature in orchard waste degradation

Detecting the central temperature change of each group of the compost samples, measuring the temperature of the compost samples at 12 pm every day by using a thermometer at intervals of 5d, and repeating three times for each group of samples by taking three sample measuring points and processing the samples to obtain the average temperature measurement value as a sample temperature value.

1.2.4 determination of waste weight before and after degradation of orchard waste

All experimental and blank samples were weighed accurately using an electronic balance after completion of inoculation and addition of the decomposing agent (noted as initial weight) at the beginning of the experiment, and the sample weight was weighed accurately after 30 days of degradation culture (noted as final weight) to obtain 3 sets of parallel experimental data for all experimental samples.

1.2.5 determination of lignocellulose content before and after degradation of orchard waste

And (3) measuring the contents of cellulose, lignin and hemicellulose of the samples at the beginning of degradation and after the degradation is finished, wherein the measuring method comprises the following steps:

(1) accurately weighing 0.500g of sample weight, placing the sample in an oven at 80 ℃ to fully dry the sample until the weight is constant, transferring the sample into a triangular flask with the specification of 150mL, adding 50mL of neutral detergent, and then placing the sample in a pressure cooker to keep the sample at the high temperature of 100 ℃ for 1 hour.

(2) Using a flat-bottomed glass sand core soil (weight of which is weighed in advance and recorded as W)₀) The filtration operation was performed, and the residue obtained by the filtration was further washed with hot water until the pH of the washing water became about 7.0. Continuously washing with anhydrous ethanol and acetone twice, transferring into oven, drying at 80 deg.C until the weight of the sample is constant, weighing the total weight of the filter soil and the sample, and recording as W₁。

(3) And (3) transferring the sample with the filtering sand core soil in the step (2) into a 150mL beaker, continuously adding 50mL of an acidic detergent, transferring to a pressure cooker, keeping the temperature of the pressure cooker at 100 ℃ for 50min, taking out the sample, and washing the sample with warm water until the pH value of the washing water is about 7.0. Washing with 95% ethanol, anhydrous ethanol and acetone twice, oven drying at 80 deg.C until the weight of the sample is constant, weighing the total weight of the filter soil and the sample, and recording as W₂。

(4) Continuously transferring the sample with the filtering sand core soil completed in the step (3) into a 150mL beaker, adding 5mL of 75% sulfuric acid solution which is pre-refrigerated, placing the sample at room temperature for hydrolysis reaction for 3h, then continuously adding 45mL of distilled water, placing the sample at room temperature for overnight, washing the sample with distilled water the next day until the pH value of washing water is about 7.0, transferring the sample into an oven at 80 ℃ for drying operation until the weight of the sample is kept constant, and weighing the total weight of the filtering sand core soil and the sample and taking the total weight as W₃。

(5) Finally transferring the sample with the filtering sand core soil, which is finished in the step (4), to a muffle furnace, setting the temperature to be 550 ℃ for ashing for 4 hours, then cooling a dryer, weighing the sample, and recording the weight of the sample as W₄。

The calculation method comprises the following steps:

percentage of celluloseContent C1 (%) ═ (W)₂-W₀)-(W₃-W₀)-(W₄–W₀)]/0.500×100％；

Lignin percentage C2 (%) - (W)₃-W₄)/0.500×100％

Percent hemicellulose C3 (%) - (W)₂-W₃)/0.500×100％

Cellulose degradation rate (%) - (C1 at the start of degradation-sample C1 after 30 days of degradation)/C1X 100% before the start of degradation

Lignin degradation rate (%) - (C2 at the beginning of degradation-sample C2 after 30 days of degradation)/C2X 100% before the beginning of degradation

Hemicellulose degradation rate (%) - (C3 at the start of degradation-sample C3 after 30 days of degradation)/C3 × 100% before the start of degradation

1.2.6 determination of Activity of degrading enzymes in orchard waste

Extracting strains from the sample after degradation culture, inoculating the strains into a PDB culture medium for culture at 28 ℃, culturing at 120rmp, and centrifuging at 12000rmp for 10min after culture to obtain a crude enzyme solution.

(1) And (3) xylanase activity detection:

measuring 10mL of a 1% xylan solution as a substrate, preheating at 50 ℃ for 3min, adding 1mL of a crude enzyme solution, fully mixing, fully hydrolyzing in a constant-temperature water bath at 50 ℃ for 50min, continuously adding 1.5mL of a DNS reagent, mixing, carrying out a boiling water bath for 10min, cooling, then fixing the volume of the reaction solution to 20mL, and placing the sample at a position with the wavelength of 540nm to determine the absorbance value.

Drawing a standard curve: taking 6 colorimetric tubes of 20mL, numbering 1-6, sequentially adding xylose standard solution of 1mg/mL of 0, 0.2, 0.4, 0.6, 0.8 and 1.0mL, distilled water of 2.0, 1.8, 1.6, 1.4, 1.2 and 1.0mL, adding DNS reagent of 1.5mL, fully cooking in boiling water for 5mL, cooling, adding distilled water to a constant volume of 20mL, shaking up, standing for 20min, and measuring the absorbance value at a wavelength lambda of 540 nm.

(2) And (3) cellulase activity determination:

the cellulase measured in the experiment is glycosidase (CMC), a substrate 1% glucose solution is measured in 10mL, the solution is preheated for 3min at 50 ℃, a mixed solution of 1mL crude enzyme solution and CMC buffer solution is added, the solution is fully hydrolyzed for 60min at 40 ℃ in a constant temperature water bath, 1.5mL LDNS reagent is continuously added for mixing, the solution is boiled in the water bath for 10min, the reaction solution is metered to 20mL after being cooled, and the absorbance value is measured by placing a sample at the position where the wavelength lambda is 540 nm.

Drawing a standard curve: taking 8 colorimetric tubes of 20mL, numbering 1-8, sequentially adding 0, 0.2, 0.4, 0.6, 0.8, 1.0, 1.2 and 1.4mL of 1mg/mL glucose standard solution, 2.0, 1.8, 1.6, 1.4, 1.2, 1.0, 0.8 and 0.6mL of distilled water, adding 1.5mL of DNS reagent, fully cooking in boiling water for 5mL, cooling, adding distilled water to reach a constant volume of 20mL, shaking uniformly, standing for 20min, and measuring the absorbance value at a wavelength lambda of 540 nm.

1.2.7 determination of content of related nutrient elements before and after degradation of orchard waste

The method comprises the steps of measuring potassium element by using a flame photometer, measuring phosphorus element by using a spectrophotometer, measuring nitrate nitrogen by using a spectrophotometer and measuring ammonium nitrogen by using a spectrophotometer.

1.2.7.1 flame photometer method for determining potassium element

(1)1mol/L neutral NH₄OAc solution: weighing chemically pure CH₃COONH₄77.09 g, dissolved in distilled water and transferred to a 1L volumetric flask to a volume of approximately 1L. With HOAc and NH₄OH adjusted pH 7.0 and then diluted to 1L.

(2) Potassium standard solution: 1.9068g of dried analytical pure KCl is accurately weighed and dissolved in water, the volume is constant to 1L, and the mixture is shaken up to 1000mg/L of potassium. Sucking 25mL of the solution, and shaking up in a 250mL volumetric flask with constant volume to obtain a standard solution containing 100mg/L of potassium.

(3) And (3) determination of a sample: weighing 5g of soil sample by a hundredth balance, putting the soil sample into a 150mL plastic leaching bottle, and adding 50mL of neutral NH by a pipette₄And (3) vibrating the OAc solution on a vibrator for 30 minutes after a bottle cap is covered, taking out the solution, carrying out dry filtration, putting the filtrate in a small triangular flask, measuring the filtrate and a potassium standard series on a flame photometer, recording the reading of a galvanometer, checking out the corresponding concentration on a standard curve, and calculating the quick-acting potassium content of the soil according to a formula.

(4) Drawing a standard curve: preparing 5, 10, 20, 30 and 50mg/L K standard series solutions by using 100mg/L K standard solutions in a 100mL volumetric flask respectively, and fixing the volume by using 1mol/L neutral ammonium acetate solution. Firstly, 50mg/LK standard solution is used for flame photometer spray combustion, the grating is adjusted to make the scale of galvanometer have maximum reading, and then all levels of standard solution are measured in sequence. And recording the reading of the galvanometer, and finally drawing a standard curve by taking the concentration as an abscissa and the reading of the galvanometer as an ordinate on the checkered paper.

1.2.7.2 Spectrophotometer method for determining phosphorus element

(1)0.5mol/L sodium bicarbonate solution: 42g of chemically pure sodium bicarbonate was weighed and dissolved in 800mL of distilled water. After cooling, the pH value is adjusted to 8.5 by 0.5mol/L sodium hydroxide solution, the solution is washed into a 1000mL volumetric flask, the volume is fixed to the scale, and the solution is stored in a reagent bottle.

(2)7.5mol/L 1/2H₂SO₄Molybdenum antimony stock solution: about 400mL of distilled water was taken and placed in a 1000mL beaker, the beaker was immersed in cold water, and then 208.3mL of analytically pure concentrated sulfuric acid was slowly injected, with continuous stirring, and cooled to room temperature. Separately, 20g of analytically pure ammonium molybdate was weighed, dissolved in 200mL of distilled water at 50 ℃ and cooled. Then slowly pouring the sulfuric acid solution into the ammonium molybdate solution, continuously stirring, adding 100mL of 0.5% antimony potassium tartrate solution, diluting to 1000mL with distilled water, shaking up, and storing in a brown reagent bottle.

(3) Molybdenum antimony anti-mixed color developing agent: 1.5g of L-ascorbic acid is added into 100mL of molybdenum-antimony stock solution, the mixture is shaken up and stored in a reagent bottle, and the solution is prepared as before.

(4) Phosphorus (P) standard solution: accurately weighing 0.2197g of analytically pure monopotassium phosphate which is dried for 4-8 hours at the temperature of 45 ℃ in a small beaker, dissolving with a small amount of distilled water, completely washing the solution into a 1000mL volumetric flask, fixing the volume to the scale with the distilled water, and fully shaking up to obtain the solution, namely the standard solution containing 50mg/L phosphorus. Accurately sucking 50mL of the solution, diluting with distilled water to a constant volume of 500mL, shaking up to obtain a 5mg/L phosphorus standard solution (the solution cannot be stored for a long time), and preparing according to a standard curve system during color comparison.

(5)0.5mol/L sodium hydroxide solution: 20g of sodium hydroxide was dissolved in 1000mL of distilled water, shaken up, and left to stand for use.

(6) Soil leaching: weighing 5g of air-dried soil which passes through 1mm sieve pores by using a hundredth balance, placing the air-dried soil into a 250mL plastic leaching bottle, accurately adding 100mL of 0.5mol/L sodium carbonate solution, adding one spoon of phosphorus-free activated carbon, covering, oscillating on an oscillator for 30 minutes, filtering by using dry phosphorus-free filter paper, and taking the filtrate into a 100mL dry triangular flask.

(7) And (3) measuring phosphorus in the solution to be measured: sucking 10mL of filtrate into a 50mL volumetric flask, then slowly adding 5mL of molybdenum antimony sulfate anti-mixing color development agent along the wall of the volumetric flask, fully shaking up, discharging carbon dioxide, adding distilled water to the scale, and fully shaking up again. After 30 minutes of standing, the colorimetric determination was carried out on a spectrophotometer using light having a wavelength of 660nm and 1cm through a cuvette. The color stabilization time was 24 hours. Colorimetric determination was performed while performing a blank test (i.e., using 0.5mol/L sodium bicarbonate reagent instead of the test solution, and the other steps were the same as above). And (4) finding out the content of phosphorus in the solution to be detected according to the measured extinction value and a standard curve, and then calculating the content of available phosphorus in the soil.

(8) Drawing a standard curve: 0, 1, 2, 3, 4 and 5mL of the phosphorus standard solution of 5mg/L are respectively sucked into a 50mL volumetric flask, and 10mL of sodium bicarbonate solution of 0.5mol/L are respectively added. Slowly adding 5mL of molybdenum antimony sulfate anti-mixed color developing agent along the wall of the volumetric flask, fully shaking up, discharging CO₂Then, adding distilled water to a constant volume to scale, and fully shaking up. The phosphorus concentration of the series of solutions is 0, 0.1, 0.2, 0.3, 0.4 and 0.5mg/L respectively. Standing for 30 minutes, and then carrying out color comparison with the same to-be-detected solution. And drawing a standard curve on the paper grid by taking the solution concentration as the horizontal coordinate and the reading of the optical density as the vertical coordinate.

Determination of nitrogen element-nitrate nitrogen by 1.2.7.3 spectrophotometer method

(1) Nitrate standard stock solution, 0.1 mg/mL: 0.1631g of potassium nitrate which had been dried at 105 ℃ to 110 ℃ for 1 hour were weighed out and dissolved in distilled water. Transfer into 1000mL volumetric flask and dilute to the mark and shake well. This solution 1.00mL contained 0.10mg nitrate.

(2) Nitrate standard solution, 10.0 μ g/mL: 10.00mL of the nitrate standard stock solution (100. mu.g/mL) was pipetted into a 100mL volumetric flask, diluted to the mark with distilled water and shaken well. This solution 1.00mL contained 10.0. mu.g nitrate.

(3) Drawing a standard curve: accurately, 0, 10.0, 20.0, 50.0, 100, 200, 400, 600, 800, 1000. mu.g of nitrate standard solution was dispensed into a series of 100mL volumetric flasks, diluted to 50mL with distilled water, and colorimetric.

(4) A fresh soil sample corresponding to 10.00g of dry soil is weighed to be accurate to 0.01g, placed in a 200mL triangular flask, added with 100mL of potassium chloride solution, plugged, and shaken on a shaker for 1 h. The suspension was taken out and allowed to stand (about 30min), and the suspension was filtered with filter paper to extract a certain amount of supernatant for analysis. The filtrate was stored in a refrigerator for future use.

Measuring absorbance A of the leaching solution at 220nm and 275nm₂₂₀And A₂₇₅. The corrected absorbance a was calculated as follows:

A＝A₂₂₀-fA₂₇₅(f is 2.0)

The nitrate nitrogen in the leach liquor was removed by the method of the publication "Norman R J, Edberg J C, Stucki J W. determination of nitrate in Soil extract by dual-wave ultra violet spectrometry [ J ]. Soil Science Society of American Journal Abstract,1985,49(5): 1182-1185", and the absorbance of the treated solution at 220nm and 275nm was measured and the ratio of the two was calculated as f. After a correlation curve between the A value and the nitrate nitrogen concentration is established, the nitrate nitrogen concentration in the leaching liquor can be calculated.

1.2.7.4 determination of Nitrogen element-ammonium Nitrogen by Spectrophotometer method

(1)2mol/LKCl solution: 149.1g of KCl was weighed and dissolved in 1L of water.

(2) Phenol solution. 10g of phenol and 100mg of sodium nitroprusside are weighed and diluted to 1L. The reagent was unstable and stored in brown bottles in a refrigerator at 4 ℃. Note that sodium nitroprusside is extremely toxic!

(3) Sodium hypochlorite alkaline solution: 10g of NaOH, 7.06g of disodium hydrogen phosphate, 31.8g of sodium phosphate and 10mL of sodium hypochlorite (52.5 g/L) were weighed out, dissolved in water, diluted to 1L, stored in a brown bottle and stored in a refrigerator at 4 ℃.

(4) Masking agent: 400g/L of potassium sodium tartrate was mixed in equal volumes with 100g/L of disodium EDTA salt solution. 0.5mL of 10mol/L sodium hydroxide solution was added to 100mL of the mixture.

(5) 2.50. mu.g/mL ammonium Nitrogen (NH)₄ ⁺-N) standard solution: 0.4717g of dried ammonium sulfate is weighed and dissolved in water, washed into a volumetric flask and dissolved to 1L to prepare a storage solution containing 100 mu g/mL of ammonium nitrogen, and the storage solution is diluted by 20 times by adding water before use to prepare a standard solution containing 5 mu g/mL of ammonium nitrogen (N) for later use.

(6) And (4) leaching. A fresh soil sample corresponding to 10.00g of dry soil is weighed to be accurate to 0.01g, placed in a 200mL triangular flask, added with 100mL of potassium chloride solution, plugged, and shaken on a shaker for 1 h. Taking out and standing for about 30min, and sucking a certain amount of supernatant for analysis after the suspension of the soil and the potassium chloride is clarified.

(7) And (5) measuring the absorbance. Absorbing 2-10 mL of soil leachate, putting the soil leachate into a 50mL volumetric flask, supplementing 10mL of soil leachate with potassium chloride solution, then sequentially adding 5mL of phenol solution and 5mL of sodium hypochlorite alkaline solution, and shaking up. After standing at room temperature of about 20 ℃ for 1 hour, 1mL of masking agent was added to dissolve a precipitate which may be generated, and then the precipitate was dissolved to the scale with water. The absorbance was read by colorimetric analysis using a 1cm cuvette at a wavelength of 625 nm.

(8) Working curve. 0.00mL, 0.50mL, 1.00mL, 2.00mL, 3.00mL, 4.00mL, 5.00mL of NH were aspirated₄ ⁺The standard solutions of-N were added to 10mL portions of potassium chloride solution in 50mL volumetric flasks and then measured colorimetrically. The concentration of each bottle of standard solution is 0mg/L, 0.05mg/L, 0.1mg/L, 0.2mg/L, 0.3mg/L, 0.4mg/L and 0.5mg/L in ammonium state.

1.3 data processing

All experiments were set up with 3 sets of parallel experiments, data were averaged using software SPSS 22.0 and standard deviations were calculated, and Duncan's were used to analyze the significance of differences between treatments. All data plots were made with Origin 8.5 software.

Second, test results

2.1 degradation ability of lignocellulose

2.1.1 ability to degrade cellulose

The results of the determination of the cellulose degrading ability of Trichoderma harzianum SDAU-H are shown in Table 3, and it can be seen that Trichoderma harzianum SDAU-H has the ability to degrade cellulose.

TABLE 3 degradation ability of cellulose

2.1.2 Lignin-degrading ability

The results of the determination of the degradation ability of Trichoderma harzianum SDAU-H to cellulose are shown in Table 4, and it can be seen that Trichoderma harzianum SDAU-H has the ability to degrade lignin.

TABLE 4 degradation ability of lignin

Note: the different lower case letter representations after the same column of values differ significantly at a P <0.05 level

2.2 degradation of orchard waste

2.2.1 degradation results of peach Branch waste

The results of observing the degradation change of peach tree branch waste after 30 days of degradation by each test group designed according to table 2 are shown in fig. 1.

In the blank control group (figure 1) without any bacteria, obvious white colonies can be observed when the samples are degraded and cultured for 25 days, mainly because peach branches are rotten and changed along with the degradation time of fermentation to show degradation physical properties.

As can be seen from fig. 2 to 7, the growth of colonies on the sample after degradation for 20 days was significant in the case of the inoculated 50% sample with the addition of the decomposing agent. When the decomposing inoculant exists, the Trichoderma harzianum grows most vigorously on the peach tree branch waste, and the growth state of the Trichoderma harzianum is not obviously influenced by the inoculation amount of the Trichoderma harzianum. With the increase of the inoculation degree, the trichoderma harzianum does not show a remarkable increase trend of the growth process.

2.2.2 degradation results on apple Branch waste

Compared with other samples inoculated with fungi, the degradation process of the apple branch waste is obviously slower under the condition that strains are not inoculated, and obvious bacterial colonies do not appear until 25 days (figure 8), the reason for the degradation process is mainly analyzed because the apple branch is not easy to generate the fungi for degrading cellulase, and the currently shown bacterial colony condition is the result of competitive growth of various floras in the waste after the apple branch is fermented for a period of time.

From FIGS. 9 to 13, it can be seen that in the sample inoculated with 50%, the sample inoculated with Trichoderma harzianum showed significant colonies on the 20 th day of culture after addition of the decomposing agent, while the sample without the decomposing agent showed significant colonies on the 11 th day of degradation, indicating that the addition of the decomposing agent did not significantly promote the growth of 50% Trichoderma harzianum inoculated in apple tree branch waste. For inoculation of 60% trichoderma harzianum, the degradation of the sample tends to be the same as that of 50% inoculation, and the growth of the strain is not promoted by the addition of the decomposing agent. 70% of the inoculated samples show no remarkable degradation promoting phenomenon due to the addition of the decomposing agent, and on the contrary, the colony growth state of the samples without the addition of the decomposing agent is more remarkable. With the increase of the inoculation amount, the colony growth of the trichoderma harzianum shows a descending trend, namely the growth of the trichoderma harzianum is more vigorous when the inoculation amount is less, which indicates that the colony growth is more favorable when the inoculation amount is less in the apple branch waste environment.

2.3 Effect on orchard waste degradation temperature

2.3.1 Effect on degradation temperature of peach Branch waste

The effect of Trichoderma harzianum SDAU-H on the degradation temperature of peach branch waste is shown in FIGS. 14-16. The material inoculated with the Trichoderma harzianum SDAU-H is subjected to microbial metabolism intensity reduction along with consumption of easily decomposed substances at the high-temperature composting stage, so that the temperature is reduced.

2.3.2 Effect on Stacking temperature of apple Branch waste

The effect of Trichoderma harzianum SDAU-H on the stacking temperature of apple tree branch waste is shown in FIGS. 17-19. In the apple branch waste material pile added with the decomposing agent, after degradation culture for one week, the temperature fluctuation of the material pile inoculated with the trichoderma harzianum is more remarkable than that of the trichoderma harzianum apple branch material pile not added with the decomposing agent, when the inoculation amount is 50%, the growth quantity of colonies of the trichoderma harzianum in the apple branch waste material reaches saturation, the colonies are in the process of rapidly degrading organic matters after being cultured for one week, the reduction of surrounding nutrient substances can lead the trichoderma harzianum to compete with necessary nutrient substances for growth, so that the quantity of moulds is reduced, when the quantity of the moulds reaches saturation again, the colonies continue to carry out vigorous degradation reaction, and the circulation is repeated, so that the condition of large fluctuation range of the temperature of the material pile is generated. Compared with a material pile without the decomposing agent, the trichoderma harzianum material pile added with the decomposing agent can aggravate organic matter degradation reaction of other microbial colonies due to the existence of the decomposing agent, and the nutrient consumption in the waste material pile is more obvious, so that the colony saturation of trichoderma harzianum is in a changing state, the organic matter degradation exothermic reaction process is disturbed, and the temperature fluctuation is large.

2.4 degrading enzyme Activity

2.4.1 degrading enzyme Activity of Trichoderma harzianum SDAU-H in peach Branch waste

The enzyme activities of xylanase and CMC in peach tree branch waste of Trichoderma harzianum SDAU-H are shown in figures 20 and 21 respectively, and Trichoderma harzianum can improve the enzyme activity of degrading enzyme.

2.4.2 degrading enzyme Activity of Trichoderma harzianum SDAU-H in apple Branch waste

The enzyme activities of xylanase and CMC in apple tree branch waste of Trichoderma harzianum SDAU-H are shown in figure 22 and figure 23 respectively, and Trichoderma harzianum can improve the enzyme activity of degrading enzyme.

2.5 quality Change before and after degradation of waste orchard Branch

2.5.1 Mass Change before and after degradation of peach Branch waste

By weighing the weight of all samples before and after degradation, the degradation degree of trichoderma harzianum SDAU-H on the stock can be analyzed from the mass reduction of the peach branch waste stock. As can be seen from fig. 24, when the inoculation amount was 60%, the amount of the compost to which the decomposing agent was added was reduced by more than 10%.

2.5.2 quality Change before and after degradation of apple Branch waste

Analyzing the quality reduction of the apple tree branch waste stack, and further analyzing the degradation of the stack by trichoderma harzianum SDAU-H. As can be seen from fig. 25, the weight reduction rate gradually increased with the increase in the inoculation amount, and the weight reduction rate of the stockpile to which the decomposing agent was added was high as a whole.

2.6 Change in lignocellulose content in Branch waste

As can be seen from fig. 26, the degradation rates of cellulose, hemicellulose and lignin by trichoderma harzianum were 32%, 21% and 28%, respectively, and trichoderma harzianum exhibited stronger degradation effects on cellulose.

2.7 determination of content of relevant nutrient elements before and after degradation of orchard waste by Trichoderma harzianum SDAU-H

2.7.1 Effect of Trichoderma harzianum SDAU-H on Potassium content in compost

The content change of potassium element in peach branch compost and apple branch compost is respectively shown in fig. 27 and fig. 28, the content of potassium basically has no change trend, the content of potassium in the branch compost is always between 58.6 and 58.7, the change is very slight, and the trichoderma harzianum SDAU-H and the presence or absence of a decomposing agent are proved to have no effect on the content of potassium in the branch compost of peach trees and apple trees.

2.7.2 Effect of Trichoderma harzianum SDAU-H on phosphorus content in compost

The content of phosphorus in peach branch compost and apple branch compost is changed as shown in fig. 29 and fig. 30, and the content of phosphorus is in a rising trend.

2.7.3 influence of Trichoderma harzianum SDAU-H on nitrate nitrogen content in compost

The content change of nitrate nitrogen in peach branch compost and apple branch compost is shown in figure 31 and figure 32 respectively, nitrate nitrogen is basically not contained in the compost, the content of nitrate nitrogen treated by trichoderma harzianum and a decomposing agent is a positive value, and trichoderma harzianum can play a role of degradation to influence the content of nitrate nitrogen.

2.7.4 Effect of Trichoderma harzianum SDAU-H on ammonium Nitrogen content in compost

The content of ammonium nitrogen in peach branch compost and apple branch compost is shown in fig. 33 and 34, respectively, and the peach branch compost treated by trichoderma harzianum is basically free of ammonium nitrogen before and after the compost.

In conclusion, trichoderma harzianum shows higher degradation efficiency on fibers, and the degradation rate of trichoderma harzianum on fibers in waste stacking materials reaches 32%; the addition of the decomposition maturing agent can obviously improve the growth speed of the colony inoculated with the trichoderma harzianum, and the decomposition maturing agent has a certain promotion effect on the trichoderma harzianum when degrading to generate nitrogen elements.

The above-described embodiments are merely illustrative of the preferred embodiments of the present invention, and do not limit the scope of the present invention, and various modifications and improvements of the technical solutions of the present invention can be made by those skilled in the art without departing from the spirit of the present invention, and the technical solutions of the present invention are within the scope of the present invention defined by the claims.

Sequence listing

<110> Shandong university of agriculture

<120> Trichoderma harzianum strain and application thereof in degradation of waste orchard branches

<160> 1

<170> SIPOSequenceListing 1.0

<210> 1

<211> 587

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

tggggcttca ctcccaaccc aatgtgaacg ttaccaaact gttgcctcgg cgggatctct 60

gccccgggtg cgtcgcagcc ccggaccaag gcgcccgccg gaggaccaac caaaactctt 120

tttgtatacc ccctcgcggg ttttttataa tctgagcctt ctcggcgcct ctcgtaggcg 180

tttcgaaaat gaatcaaaac tttcaacaac ggatctcttg gttctggcat cgatgaagaa 240

cgcagcgaaa tgcgataagt aatgtgaatt gcagaattca gtgaatcatc gaatctttga 300

acgcacattg cgcccgccag tattctggcg ggcatgcctg tccgagcgtc atttcaaccc 360

tcgaacccct ccggggggtc ggcgttgggg atcggccctg cctcttggcg gtggccgtct 420

ccgaaataca gtggcggtct cgccgcagcc tctcctgcgc agtagtttgc acactcgcat 480

cgggagcgcg gcgcgtccac agccgttaaa cacccaactt ctgaaatgtt gacctcggat 540

caggtaggaa tacccgctga acttaagcat atcaaaagcc ggaggaa 587

Claims (10)

1. Trichoderma harzianum (Trichoderma harzianum) SDAU-H is characterized in that the Trichoderma harzianum is preserved in the China general microbiological culture Collection center (CGMCC No. 23810), the preservation date is 2021 years, 11 months and 17 days, and the preservation address is No. 3 of Xilu No. 1 Beijing Hokko sunward area north Chen.

2. A microbial agent comprising the trichoderma harzianum of claim 1.

3. A method for preparing a microbial agent according to claim 2, comprising the steps of: uniformly mixing the wood chips of the branches of the fruit trees, the locust manure and the corncobs, sterilizing, then inoculating the trichoderma harzianum of claim 1, and culturing to obtain the microbial agent.

4. The method according to claim 3, wherein the fruit tree branch chips are apple tree branch chips or peach tree branch chips.

5. The preparation method according to claim 3, wherein the mass ratio of the fruit tree branch wood chips, the locust manure and the corncobs is 3:1: 1.

6. The method according to claim 3, wherein the culturing is performed at 25 ℃ for 20-30 days.

7. Use of trichoderma harzianum according to claim 1 or a microbial agent according to claim 2 for degrading waste branches of orchards.

8. Use according to claim 7, wherein the waste branches are apple tree branches or peach tree branches.

9. A method for degrading abandoned branches in an orchard is characterized by comprising the following steps:

(1) preparing a microbial agent according to the method of any one of claims 3-6;

(2) uniformly mixing the wood chips of the branches of the fruit trees, the locust manure and the corncobs, sterilizing, inoculating the microbial agent prepared in the step (1), and performing composting degradation.

10. The method for degrading waste branches in orchards according to claim 9, wherein in the step (2), the inoculation amount of the microbial agent is 50-70% of the total weight of the fruit tree branch wood chips, the locust manure and the corncobs.

Images