CN114196554B - Schizophyllum commune and application thereof in degradation of waste branches of orchard - Google Patents

Abstract

The invention discloses a Schizophyllum commune and application thereof in degradation of waste branches in orchards, and relates to the technical field of microorganisms. The Schizophyllum commune SDAU-L disclosed by the invention is preserved in the China general microbiological culture Collection center (CGMCC) with the preservation number of CGMCC No.23854, the preservation date of 2021, 11 and 17 days, and the preservation address of No. 3 Hospital No. 1 West Chen of the facing-Yang district in Beijing. The schizophyllum commune provided by the invention has the capacity of degrading lignin and cellulose, can improve the activity of degrading enzymes in waste piles, can play a role in degrading to promote the nitrate nitrogen content of piles to be increased, and can improve the degradation efficiency of waste branches in orchards.

Description

Schizophyllum commune and application thereof in degradation of waste branches of orchard

Technical Field

The invention relates to the technical field of microorganisms, in particular to a schizophyllum commune and application thereof in degrading waste branches in orchards.

Background

A large amount of wastes such as dead branches and fallen leaves are generated in an orchard every year, waste fruit tree branches are directly discarded in the orchard or simply incinerated due to unreasonable treatment, the appearance of the orchard is influenced, resources are wasted, the discarded branches provide habitat for orchard pests and are easy to become infection sources of orchard diseases and pests, and the environment is directly harmed by burning the branches.

The parts of the orchard waste which are difficult to degrade are mainly abandoned branches of the orchard, and the main component of the branches is lignocellulose. Under natural conditions, lignocellulose is water-insoluble and biologically resistant due to the particularity of its own physical structure and chemical composition, and thus is difficult to hydrolyze or directly metabolized by microorganisms, thereby preventing its rapid degradation and recycling. The lignocellulose comprises 40-50% of cellulose, 20-35% of hemicellulose and 15-30% of lignin, wherein the cellulose is macromolecular polysaccharide formed by D-glucose through beta-1, 4 glycosidic bonds and exists in a plurality of tightly arranged micro-silks to form a skeleton of a cell wall. Before the microorganisms use the cellulose, it must be released from the lignin and hemicellulose coating, resulting in low cellulose utilization and slow actual operation time. Hemicellulose has a more complex structure than cellulose, and not only comprises a main chain skeleton, but also comprises a series of different side chain substituents and the like. Hemicellulose permeates into the matrix material in an amorphous state, is connected with lignin formed only at the last stage of cell differentiation through chemical bonds, and is then wrapped outside fibers so as to increase the rigidity of cell walls. Lignin is a natural organic high molecular compound with an extremely complex structure and is also one of the most difficult biodegradable organic compounds. Lignin is a phenolic polymer, and the monomers are connected with each other through ether bonds and carbon-carbon bonds, so that the lignin is difficult to hydrolyze. Lignin plays a supporting and protective role for plants. But also the hard-to-degrade lignin is tightly combined with the cell wall, so that the plant wood fiber structure is stable and is not easy to biodegrade.

Disclosure of Invention

The invention aims to provide a schizophyllum commune and application thereof in degrading waste orchard branches, so as to solve the problems in the prior art.

In order to achieve the purpose, the invention provides the following scheme:

the invention provides a Schizophyllum commune (Schizophyllum commune) SDAU-L which is preserved in the common microorganism center of China Committee for culture Collection of microorganisms, wherein the preservation number is CGMCC No.23854, the preservation date is 11 months and 17 days in 2021, and the preservation address is No. 3 of No. 1 Hospital of West Lu in the morning district of Beijing City.

The invention also provides a microbial agent which comprises the Schizophyllum commune.

The invention also provides a preparation method of the microbial agent, which comprises the following steps: and uniformly mixing the wood chips of the branches of the fruit trees, the locust manure and the corncobs, sterilizing, inoculating the Schizophyllum commune, and culturing to obtain the microbial agent.

Furthermore, the fruit tree branch wood chips are apple tree branch wood chips or peach tree branch wood chips.

Further, the mass ratio of the fruit tree branch wood chips, the locust manure and the corncobs is 3.

Further, the culture is carried out for 20-30 days at 25 ℃.

The invention also provides application of the Schizophyllum commune or the microbial agent in degradation of waste branches in orchards.

Further, the waste branches are apple tree branches or peach tree branches.

The invention also provides a method for degrading the abandoned branches in the orchard garden, which comprises the following steps:

(1) Preparing the microbial agent according to the method;

(2) Uniformly mixing the wood chips of the branches of the fruit trees, the locust manure and the corncobs, sterilizing, inoculating the microbial agent prepared in the step (1), and performing composting degradation.

Further, in the step (2), the inoculation amount of the microbial agent is 50-70% of the total weight of the fruit tree branch wood chips, the locust manure and the corncobs.

The invention discloses the following technical effects:

(1) The Schizophyllum commune provided by the invention has the capacity of degrading lignin and cellulose, wherein the capacity of degrading lignin is high in lignin degradation efficiency, and the lignin degradation rate in waste piles is as high as 41%.

(2) The Schizophyllum commune provided by the invention can improve the activity of degrading enzymes in waste piles.

(3) The schizophyllum commune provided by the invention can play a role in degradation and promote the increase of nitrate nitrogen content in the compost.

Drawings

In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings needed in the embodiments will be briefly described below, and it is obvious that the drawings in the following description are only some embodiments of the present invention, and it is obvious for those skilled in the art to obtain other drawings without creative efforts.

FIG. 1 is a graph of a sample of degraded peach tree branch waste from test group 0 of Table 2 of example 2;

FIG. 2 is a graph of a sample of degraded peach tree branch waste of test group 1 in Table 2 of example 2;

FIG. 3 is a graph of a sample of degraded peach tree branch waste of test group 2 in Table 2 of example 2;

FIG. 4 is a graph of a sample of degraded peach tree branch waste of test group 3 of Table 2 of example 2;

FIG. 5 is a graph of a sample of degraded peach tree branch waste from test group 4 of Table 2 of example 2;

fig. 6 is a graph of a sample of degraded peach branch waste of test group 5 in table 2 of example 2;

FIG. 7 is a graph of a sample of degraded peach tree branch waste from test group 6 of Table 2 of example 2;

FIG. 8 is a graph of a sample of degraded apple tree branch waste from test group 7 of Table 2 of example 2;

FIG. 9 is a graph of a sample of degraded apple tree branch waste from test group 8 of Table 2 of example 2;

FIG. 10 is a graph of a sample of degraded apple tree branch waste from test group 9 of Table 2 of example 2;

FIG. 11 is a graph of a sample of degraded apple branch waste from test group 10 of Table 2 of example 2;

FIG. 12 is a graph of a sample of degraded apple tree branch waste from test group 11 of Table 2 of example 2;

FIG. 13 is a graph of a sample of degraded apple tree branch waste from test group 12 of Table 2 of example 2;

FIG. 14 is a graph showing the temperature change of the waste peach branch stockpile when the inoculation amount is 50%, wherein T50% LZ plus indicates addition of the decomposing agent, and T50% LZ minus indicates no addition of the decomposing agent;

FIG. 15 is a graph showing the temperature change of the waste peach branch stockpile when the inoculation amount is 60%, wherein T60% LZ plus indicates addition of the decomposing agent, and T60% LZ minus indicates no addition of the decomposing agent;

FIG. 16 is a graph showing the temperature change of the waste peach branch stockpile when the inoculation amount is 70%, wherein T70% by LZ plus indicates addition of the decomposing agent, and T70% by LZ minus indicates no addition of the decomposing agent;

FIG. 17 is a graph showing the temperature change of the waste heap of apple branches when the inoculation amount is 50%, wherein PG 50% by LZ plus represents addition of a decomposing agent, and PG 50% by LZ minus represents no addition of a decomposing agent;

FIG. 18 is a graph showing the temperature change of the waste heap of apple branches when the inoculation amount is 60%, wherein PG 60% LZ plus represents addition of a decomposing agent, and PG 60% LZ minus represents no addition of a decomposing agent;

FIG. 19 is a graph showing the temperature change of the waste heap of apple branches when the inoculation amount is 70%, wherein PG 70% by LZ plus represents addition of a decomposing agent, and PG 70% by LZ minus represents no addition of a decomposing agent;

FIG. 20 is a graph of xylanase activity of SDAU-L strain in peach tree waste, wherein "+" represents a decomposing agent;

FIG. 21 is a diagram of CMC enzyme activity of SDAU-L strain in peach tree waste, wherein "+" represents decomposing agent;

FIG. 22 is a graph of xylanase activity of SDAU-L strain in apple tree waste, wherein "+" represents the presence of a decomposing agent;

FIG. 23 is a CMC enzyme map of SDAU-L strain in apple tree waste, where "+" represents the presence of a decomposing agent;

FIG. 24 shows the reduction of weight of peach tree branch waste by SDAU-L strain, wherein "+" represents decomposing agent;

FIG. 25 is a graph of the reduction in weight of apple tree branch waste by SDAU-L strains, where "+" represents the presence of a decomposing agent;

FIG. 26 shows the degradation rate of SDAU-L strain on cellulose, hemicellulose and lignin in waste;

FIG. 27 is a graph of potassium content changes in peach branch compost, where "plus" indicates the presence of a decomposing agent and "not plus" indicates the absence of a decomposing agent;

FIG. 28 is a graph of potassium content changes in apple branch compost, where "plus" indicates the presence of a decomposing agent and "not plus" indicates the absence of a decomposing agent;

FIG. 29 is a graph showing the variation of phosphorus content in peach branch compost, wherein "plus" indicates the presence of a decomposing agent and "not plus" indicates the absence of a decomposing agent;

FIG. 30 is a graph of the change in phosphorus content in apple branch compost, wherein "plus" indicates the presence of a decomposing agent and "not plus" indicates the absence of a decomposing agent;

FIG. 31 is a graph showing the change of nitrate nitrogen content in peach branch compost, wherein "plus" represents the presence of a decomposing agent and "not plus" represents the absence of a decomposing agent;

FIG. 32 is a graph of the change in nitrate nitrogen content in apple branch compost, wherein "plus" indicates the presence of a decomposing agent and "not plus" indicates the absence of a decomposing agent;

FIG. 33 is a graph showing the variation of ammonium nitrogen content in peach branch compost, wherein "add" indicates the presence of a decomposing agent and "not add" indicates the absence of a decomposing agent;

FIG. 34 is a graph of the change in ammonium nitrogen content in apple branch compost, where "add" indicates the presence of a decomposing agent and "not add" indicates the absence of a decomposing agent.

Detailed Description

Reference will now be made in detail to various exemplary embodiments of the invention, the detailed description should not be construed as limiting the invention but as a more detailed description of certain aspects, features and embodiments of the invention.

It is to be understood that the terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting of the invention. Further, for numerical ranges in this disclosure, it is understood that each intervening value, between the upper and lower limit of that range, is also specifically disclosed. Every intervening value, to the extent any stated value or intervening value in a stated range, and any other stated or intervening value in a stated range, is encompassed within the invention. The upper and lower limits of these smaller ranges may independently be included or excluded in the range.

Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Although only preferred methods and materials are described herein, any methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention. All documents mentioned in this specification are incorporated by reference herein for the purpose of disclosing and describing the methods and/or materials associated with the documents. In case of conflict with any incorporated document, the present specification will control.

It will be apparent to those skilled in the art that various modifications and variations can be made in the specific embodiments of the present disclosure without departing from the scope or spirit of the disclosure. Other embodiments will be apparent to those skilled in the art from consideration of the specification. The description and examples are intended to be illustrative only.

As used herein, the terms "comprising," "including," "having," "containing," and the like are open-ended terms that mean including, but not limited to.

In the following examples, the media, reagents, test materials and instruments used are as follows:

culture medium:

potato dextrose agar medium (PDA): 200g/L of potato, 20g/L of glucose and 20g/L of agar.

Congo red cellulose agar: k is ₂ HPO ₄ 1.0g，MgSO _4` 7H ₂ O0.5 g, agar 20g, nacl 0.5g, (NH) ₄ ) ₂ SO ₄ 2.0g, CMC-Na 2.0g, congo red 0.2g, water 1000mL, pH natural.

PDA-guaiacol medium: 0.02% guaiacol was added to PDA medium.

Reagents and test materials:

birch xylan (birchwood xylan, sigma), congo red dye liquor, naCl water solution and decomposing inoculant (Brandy brand).

DNS reagent: 18.2g of sodium potassium tartrate (CMC-Na) was dissolved in 50mL of distilled water and heated. Adding 0.03g of 3, 5-dinitrosalicylic acid, 2.1g of NaOH and 0.5g of phenol into the hot solution in sequence, stirring until the mixture is completely dissolved, cooling, adding distilled water to a constant volume of 100mL, and storing in a brown bottle.

1% CMC buffer: 1g of CMC was weighed out and dissolved in 100mL of 50mol/L citric acid and 100mmol of disodium hydrogen phosphate buffer solution (pH 6.0).

1% xylan solution: formulated with 50mmol/LpH =10 glycine-sodium hydroxide buffer.

1mg/mL xylose standard solution: putting the anhydrous xylose into an oven at 80 ℃ for drying operation until the weight of the xylose is constant, accurately measuring 0.1g of xylose solid, adding a proper amount of distilled water for fully dissolving, and fixing the volume to 100mL.

1mg/mL glucose standard solution: accurately weighing 100mg of glucose, adding a proper amount of distilled water to fully dissolve the glucose, metering the volume to 100mL, and storing at 4 ℃ for later use.

0.16mmol/L cotton blue lactate staining solution: 0.01223g of AzureB dye was taken, and 200mL of distilled water was added thereto to dissolve the dye sufficiently, and the volume was made 250mL with distilled water.

72% sulfuric acid solution: accurately measure 665mL 98% concentrated H ₂ S0 ₄ Slowly add to 300mL distilled water, and continue to make up to 1L with distilled water.

Neutral detergents: accurately weighing 18.61g of EDTA and 6.18g of sodium tetraborate, placing the EDTA and the sodium tetraborate in a beaker, adding a small amount of distilled water, heating to fully dissolve the EDTA and the sodium tetraborate, adding 30g of sodium dodecyl sulfate, 4.56g of disodium hydrogen phosphate and 10mL of ethoxyethanol, adding distilled water, heating the beaker to dissolve and mix all solids, continuously adding the distilled water to a constant volume of 1L, and adjusting the pH of the detergent to be neutral by using a 75% sulfuric acid solution.

Acid detergents: accurately weighing 27.2mL of concentrated sulfuric acid, placing the concentrated sulfuric acid in 900mL of distilled water, fully and uniformly mixing, adding 20g of hexadecyl trimethyl desertification amine, fully and uniformly mixing, and adding distilled water to reach a constant volume of 1L.

The sources of the abandoned branches in the orchard are as follows: peach branches with the diameter of 20mm are from peach gardens of Shandong-sourced ecological agriculture development Limited liability company, and apple branches with the diameter of 20mm are from apple gardens of Shandong-Taian-Yangyu. And respectively crushing the peach branches and the apple branches into wood chips for later use.

A decomposing inoculant: the main components are bacillus subtilis, bacillus licheniformis, bacillus amyloliquefaciens, cellulose, ligninase, hemicellulase and vitamins.

Other materials: locust manure is sourced from Shandong-Yuan ecological agriculture development Limited liability company, and corncobs are purchased from farmers in Shandong Tai Annan school areas.

The instrument comprises: see table 1.

TABLE 1 list of main laboratory instruments

Example 1 isolation, identification, and preservation of strains

1. Separation of

A strain is obtained by collecting and separating a specimen from a pear branch beside a bacterial base in a southern school district of Shandong agricultural university and is named as SDAU-L.

2. Identification

1. Morphological identification

The strain SDAU-L has extremely fine aerial hyphae, extremely thin and white villiform.

2. Molecular biological assay

The SDAU-L is subjected to ITS sequencing, and is identified as Schizophyllum commune, and the ITS sequence (SEQ ID NO: 1) is as follows:

AGGAAATCAAACAAGTTCATCTTGTTCTGATCCTGTGCACCTTATGTAGTCCCAAAGCCTTCACGGGCGGCGGTTGACTACGCCTACCTCACACCTTAAAGTATGTTAACGAATGTAATCATGGTCTTGACAGACCCTAAAAAGTTAATACAACTTTCGACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCTTTGGTATTCCGAGGGGCATGCCTGTTTGAGTGTCATTAAATACCCTCAACCCTCTTTTGACTTCGGTCTCGAGAGTGGCTTGGAAGTGGAGGTCTGCTGGAGCCTAACGGAGCCAGCTCCTCTTAAATGTATTAGCGGATTTCCCTTGCGGGATCGCGTCTCCGATGTGATAATTTCTACGTCGTTGACCATCTCGGGGCTGACCTAGTCAGTTTCAATAGGAGTCTGCTTCTAACCGTCTCTTGACCGAGACTAGCGACTTGTGCGCTAACTTTTGACTTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAG。

3. preservation of

The strain SDAU-L is preserved in the China general microbiological culture Collection center (CGMCC) with the preservation number of CGMCC No.23854, the preservation date of 2021, 11 months and 17 days, and the preservation address of No. 3 Siro No. 1 of Beijing city, chaoyang district, beicheng.

Example 2

1. Test method

1.1 determination of the ability to degrade lignocellulose

CMC culture medium Congo red staining test: inoculating the strain SDAU-L into a CMC culture medium, culturing at 25 ℃ for 5 days, pouring a Congo red color developing agent into a plate containing bacterial colonies, carrying out color development reaction for 15min, pouring the color developing agent, then putting the plate into a 1mol/L sodium chloride solution for 15min, eluting Congo red of a degraded part of cellulose to form a transparent ring, indicating that the corresponding bacterial strains can secrete cellulase and degrade the cellulose, measuring the diameter (D, cm) of the bacterial colonies and the diameter (D, cm) of a hydrolysis ring, and adopting Dp to represent the hydrolysis capacity Dp = (D/D) 2. If the ratio of the diameter of the transparent ring to the diameter of the bacterial colony is larger, the cellulose degradation capability of the bacteria is stronger.

PDA-guaiacol color development test: inoculating the strain SDAU-L into a PDA-guaiacol culture medium, culturing at 25 ℃ for 5 days, observing whether colorless guaiacol can be oxidized into reddish brown by laccase, if reddish brown oxidation rings are generated, three fungi can generate laccase, measuring the colony diameter (D, cm) and the hydrolysis ring diameter (D, cm), and expressing the hydrolysis capacity Dp = (D/D) 2 by adopting Dp. If the ratio of the diameter of the oxidation ring to the diameter of the bacterial colony is larger, the level of laccase activity generated by the corresponding bacterial strain is judged, and whether the bacterial strain can remove lignin is qualitatively detected.

1.2 degradation effect on orchard waste

1.2.1 preparation of solid microbial Agents

Taking SDAU-L strain stored in laboratory from 4 deg.C refrigerator, selecting small amount of hypha, inoculating to PDA culture medium, culturing at 25 deg.C in incubator for 3-5 days, taking the place where colony edge grows vigorously, inoculating to PDA culture medium again, culturing at 25 deg.C for 5 days, and making use of punch to obtain bacterial cake with 7mm edge diameter and 2mm thickness in PDA culture medium plate. Pre-wetting and uniformly mixing apple branch/peach branch sawdust crushed into 20mm in diameter, locust manure and corncobs according to the mass ratio of 3.

1.2.2 degradation of orchard waste

Setting each pile of degradation material to weigh 5kg, adding 1kg of locust manure and 1kg of corncob into each pile, adding 3kg of sawdust of apple branches or peach branches, uniformly stirring, sterilizing at the temperature of 121 ℃ for 30min, respectively inoculating 50wt%, 60wt% and 70wt% of solid microbial inoculum prepared by 1.2.1 with different microbial doses to the orchard waste degradation material mixed with a plurality of apples or peach branches according to the table 2, and setting a sample without any fungi as a blank control according to whether a decomposition agent is added or not as another variable, and setting 3 groups of samples in each group to repeat.

And placing the prepared orchard waste experimental group and the control group in a constant-temperature 25 ℃ constant-humidity 60% air-conditioning room, continuously degrading for 30 days, observing the degradation process change of the sample, and recording the observed physical property change of the sample.

TABLE 2 solid inoculum size and sample composition design table

Note: LZ represents Schizophyllum commune SDAU-L, "/" represents no addition of a decomposing agent, and "+" represents addition of a decomposing agent.

1.2.3 determination of Stacking temperature in degradation of orchard waste

Detecting the central temperature change of each group of the compost samples, measuring the temperature of the compost samples at 12 pm every day by using a thermometer at intervals of 5d, and repeating three times for each group of samples by taking three sample measuring points and processing the samples to obtain the average temperature measurement value as a sample temperature value.

1.2.4 determination of waste weight before and after degradation of orchard waste

All experimental and blank samples were weighed accurately using an electronic balance after completion of inoculation and addition of the decomposing agent (noted as initial weight) at the start of the experiment, and the sample weights were weighed accurately after 30 days of degradation culture (noted as final weight) to obtain 3 sets of parallel experimental data for all experimental samples.

1.2.5 determination of lignocellulose content before and after degradation of orchard waste

And (3) measuring the contents of cellulose, lignin and hemicellulose of the samples at the beginning of degradation and after the degradation is finished, wherein the measuring method comprises the following steps:

(1) Accurately weighing 0.500g of sample weight, placing the sample in an oven at 80 ℃ to fully dry the sample until the weight is constant, transferring the sample into a triangular flask with the specification of 150mL, adding 50mL of neutral detergent, and then placing the sample in a pressure cooker to keep the sample at the high temperature of 100 ℃ for 1 hour.

(2) Using a flat-bottomed glass sand core soil (weight of which is weighed in advance and recorded as W) ₀ ) The filtration operation was performed, and the residue obtained by the filtration was further washed with hot water until the pH of the washing water =7.0 or so. Continuously washing with anhydrous ethanol and acetone twice, transferring into oven, drying at 80 deg.C until the weight of the sample is constant, weighing the total weight of the filter soil and the sample, and recording as W ₁ 。

(3) And (3) transferring the sample with the filtering sand core soil in the step (2) into a 150mL beaker, continuously adding 50mL of an acidic detergent, transferring to a high-pressure cooker, keeping the high-temperature condition of 100 ℃ for 50min, taking out, and then washing with warm water until the pH of washing water is = 7.0. Washing with 95% ethanol, anhydrous ethanol and acetone twice, oven drying at 80 deg.C until the weight of the sample is constant, weighing the total weight of the filter soil and the sample, and recording as W ₂ 。

(4) Continuously transferring the sample with the filtering sand core soil, which is finished in the step (3), into a 150mL beaker, adding 5mL of 75% sulfuric acid solution which is pre-refrigerated, placing the sample at room temperature for hydrolysis reaction for 3h, and then continuously adding 45m of distilled waterL, standing at room temperature overnight, washing the sample with distilled water the next day until the pH of the washing water is =7.0, transferring the sample into an oven at 80 ℃ for drying until the weight of the sample is constant, and weighing the total weight of the filtered soil and the sample as W ₃ 。

(5) Finally, transferring the sample with the filtering sand core soil, which is finished in the step (4), to a muffle furnace, setting the temperature to be 550 ℃ for ashing, taking 4 hours, then cooling a dryer, weighing the sample, and recording the weight as W ₄ 。

The calculation method comprises the following steps:

cellulose percentage C1 (%) = (W) ₂ -W ₀ )-(W ₃ -W ₀ )-(W ₄ –W ₀ )]/0.500×100％；

Lignin percentage C2 (%) = (W) ₃ -W ₄ )/0.500×100％

Hemicellulose percentage content C3 (%) = (W) ₂ -W ₃ )/0.500×100％

Cellulose degradation rate (%) = (C1 at the start of degradation-sample C1 after 30 days of degradation)/C1X 100% before the start of degradation

Lignin degradation rate (%) = (C2 at the beginning of degradation-sample C2 after 30 days of degradation)/C2 × 100% before the beginning of degradation

Hemicellulose degradation rate (%) = (C3 at the start of degradation-sample C3 after 30 days of degradation)/C3 × 100% before the start of degradation

1.2.6 determination of Activity of degrading enzymes in orchard waste

Extracting strains from the sample after degradation culture, inoculating the strains into a PDB culture medium for culture at 28 ℃, culturing at 120rmp, and centrifuging at 12000rmp for 10min to obtain a crude enzyme solution after the culture is finished.

(1) And (3) xylanase activity detection:

measuring 1% xylan solution of a substrate by 10mL, preheating at 50 ℃ for 3min, adding 1mL of crude enzyme solution, fully mixing, fully hydrolyzing in a constant-temperature water bath at 50 ℃ for 50min, continuously adding 1.5mL of DNS reagent, mixing, boiling the mixture in the water bath for 10min, cooling, metering the volume of the reaction solution to 20mL, and placing the sample at a position with the wavelength of lambda =540nm to measure the absorbance value.

Drawing a standard curve: taking 6 colorimetric tubes of 20mL, numbering 1-6, sequentially adding 0, 0.2, 0.4, 0.6, 0.8 and 1.0mL of xylose standard solution of 1mg/mL, 2.0, 1.8, 1.6, 1.4, 1.2 and 1.0mL of distilled water, adding 1.5mL of DNS reagent, fully cooking in boiling water for 5mL, cooling, adding distilled water to a constant volume of 20mL, shaking uniformly, standing for 20min, and measuring the absorbance value at the position of wavelength lambda =540 nm.

(2) And (3) cellulase activity determination:

the cellulase measured in the experiment is glycosidase (CMC), a substrate 1% glucose solution is measured and taken in 10mL, preheating is carried out for 3min at 50 ℃, 1mL of mixed solution of crude enzyme solution and CMC buffer solution is added, the mixed solution is fully hydrolyzed for 60min at 40 ℃ in constant-temperature water bath, 1.5mL of LDNS reagent is continuously added for mixing, boiling water bath is carried out for 10min, the reaction solution is subjected to constant volume to 20mL after cooling, and the sample is placed at the position with the wavelength of lambda =540nm to measure the absorbance value.

Drawing a standard curve: taking 8 colorimetric tubes of 20mL, numbering 1-8, sequentially adding glucose standard solution of 1mg/mL of 0, 0.2, 0.4, 0.6, 0.8, 1.0, 1.2 and 1.4mL, distilled water of 2.0, 1.8, 1.6, 1.4, 1.2, 1.0, 0.8 and 0.6mL, adding DNS reagent of 1.5mL, fully cooking in boiling water for 5mL, cooling, adding distilled water to reach a constant volume of 20mL, shaking uniformly, standing for 20min, and measuring the absorbance value at the wavelength of lambda =540 nm.

1.2.7 determination of content of related nutrient elements before and after degradation of orchard waste

The method comprises the steps of measuring potassium element by using a flame photometer, measuring phosphorus element by using a spectrophotometer, measuring nitrate nitrogen by using a spectrophotometer and measuring ammonium nitrogen by using a spectrophotometer.

1.2.7.1 flame photometer method for determining potassium element

(1) 1mol/L neutral NH ₄ OAc solution: weighing chemically pure CH ₃ COONH ₄ 77.09 And g, dissolving the product with distilled water, and transferring the product into a 1L volumetric flask to reach a volume of approximately 1L. With HOAc and NH ₄ OH adjusted pH =7.0, then diluted to 1L.

(2) Potassium standard solution: accurately weighing 1.9068g of dried analytical pure KCl, dissolving in water, fixing the volume to 1L, and shaking up to obtain the product containing 1000mg/L of potassium. Sucking 25mL of the solution, and shaking up in a 250mL volumetric flask with constant volume to obtain a standard solution containing 100mg/L of potassium.

(3) And (3) determination of a sample: weighing 5g of soil sample by a hundredth balance, putting the soil sample into a 150mL plastic leaching bottle, and adding 50mL of neutral NH by a pipette ₄ And (3) vibrating the OAc solution on a vibrator for 30 minutes after a bottle cover is covered, taking out the solution for dry filtration, putting the filtrate into a small triangular bottle, measuring the filtrate and a potassium standard series on a flame photometer, recording the reading of a galvanometer, checking out the corresponding concentration on a standard curve, and calculating the quick-acting potassium content of the soil according to a formula.

(4) Drawing a standard curve: preparing standard solutions of 5, 10, 20, 30 and 50mg/L K in 100mL volumetric flasks by using 100mg/LK standard solutions respectively, and fixing the volume by using a neutral ammonium acetate solution of 1 mol/L. Firstly, 50mg/LK standard solution is used for flame photometer spray combustion, the grating is adjusted to make the scale of galvanometer have maximum reading, and then all levels of standard solution are measured in sequence. And (4) recording the reading of the galvanometer, and finally drawing a standard curve by taking the concentration as a horizontal coordinate and the reading of the galvanometer as a vertical coordinate on the square paper.

1.2.7.2 Spectrophotometer method for determining phosphorus element

(1) 0.5mol/L sodium bicarbonate solution: 42g of chemically pure sodium bicarbonate was weighed and dissolved in 800mL of distilled water. After cooling, the pH value is adjusted to 8.5 by 0.5mol/L sodium hydroxide solution, the solution is washed into a 1000mL volumetric flask, the volume is fixed to the scale, and the solution is stored in a reagent bottle.

(2)7.5mol/L 1/2H ₂ SO ₄ Molybdenum antimony stock solution: about 400mL of distilled water was taken and placed in a 1000mL beaker, the beaker was immersed in cold water, and then 208.3mL of analytically pure concentrated sulfuric acid was slowly injected, stirred continuously, and cooled to room temperature. Separately, 20g of analytically pure ammonium molybdate was weighed, dissolved in 200mL of distilled water at 50 ℃ and cooled. Then slowly pouring the sulfuric acid solution into the ammonium molybdate solution, continuously stirring, then adding 100mL of 0.5% antimony potassium tartrate solution, diluting to 1000mL by using distilled water, shaking up, and storing in a brown reagent bottle.

(3) Molybdenum antimony anti-mixed color developing agent: 1.5g of L-ascorbic acid is added into 100mL of molybdenum-antimony stock solution, the mixture is shaken up and stored in a reagent bottle, and the solution is prepared as before.

(4) Phosphorus (P) standard solution: accurately weighing 0.2197g of analytically pure monopotassium phosphate dried for 4-8 hours at 45 ℃ into a small beaker, dissolving with a small amount of distilled water, completely washing the solution into a 1000mL volumetric flask, fixing the volume to the scale with the distilled water, and fully shaking up to obtain the solution, namely the standard solution containing 50mg/L phosphorus. Accurately sucking 50mL of the solution, diluting with distilled water to a constant volume of 500mL, shaking up to obtain a 5mg/L phosphorus standard solution (the solution cannot be stored for a long time), and preparing according to a standard curve system during color comparison.

(5) 0.5mol/L sodium hydroxide solution: 20g of sodium hydroxide was dissolved in 1000mL of distilled water, shaken up, and left to stand for use.

(6) Soil leaching: weighing 5g of air-dried soil which passes through 1mm sieve pores by using a hundredth balance, placing the air-dried soil into a 250mL plastic leaching bottle, accurately adding 100mL of 0.5mol/L sodium carbonate solution, adding one spoon of phosphorus-free activated carbon, covering, oscillating on an oscillator for 30 minutes, filtering by using dry phosphorus-free filter paper, and taking the filtrate into a 100mL dry triangular flask.

(7) And (3) measuring phosphorus in the solution to be measured: sucking 10mL of filtrate into a 50mL volumetric flask, then slowly adding 5mL of molybdenum antimony sulfate anti-mixing color development agent along the wall of the volumetric flask, fully shaking up, discharging carbon dioxide, adding distilled water to the scale, and fully shaking up again. After 30 minutes of standing, colorimetric determination was carried out on a spectrophotometer using light having a wavelength of 660nm and 1cm light through a cuvette. The color stabilization time was 24 hours. The colorimetric assay was performed in parallel with a blank test (i.e., the test solution was replaced with 0.5mol/L sodium bicarbonate reagent, and the other steps were the same as above). And (4) finding out the content of phosphorus in the solution to be detected by contrasting the standard curve from the measured extinction value, and then calculating the content of available phosphorus in the soil.

(8) Drawing a standard curve: 0, 1, 2, 3, 4 and 5mL of the phosphorus standard solution of 5mg/L are respectively sucked into a 50mL volumetric flask, and 10mL of sodium bicarbonate solution of 0.5mol/L are respectively added. Slowly adding 5mL of molybdenum antimony sulfate anti-mixed color developing agent along the wall of the capacity bottle, fully shaking up, discharging CO ₂ Then, adding distilled water to a constant volume to scale, and fully shaking up. The phosphorus concentration of the series of solutions is 0, 0.1, 0.2, 0.3, 0.4 and 0.5mg/L respectively. Standing for 30 minutes, and then carrying out color comparison with the same to-be-detected solution. The solution concentration is used as the horizontal coordinate, and the optical density reading is used as the vertical coordinateCoordinates, standard curve is drawn on the paper of the square.

Determination of nitrogen element-nitrate nitrogen by 1.2.7.3 spectrophotometer method

(1) Nitrate standard stock solution, 0.1mg/mL: 0.1631g of potassium nitrate dried at 105-110 ℃ for 1 hour is weighed and dissolved by distilled water. Transfer into 1000mL volumetric flask and dilute to the mark and shake well. This solution 1.00mL contained 0.10mg nitrate.

(2) Nitrate standard solution, 10.0 μ g/mL: 10.00mL of the nitrate standard stock solution (100. Mu.g/mL) was pipetted into a 100mL volumetric flask, diluted to the mark with distilled water and shaken well. This solution 1.00mL contained 10.0. Mu.g nitrate.

(3) Drawing a standard curve: accurately, 0, 10.0, 20.0, 50.0, 100, 200, 400, 600, 800, 1000. Mu.g of nitrate standard solution was dispensed into a series of 100mL volumetric flasks, diluted to 50mL with distilled water, and colorimetric.

(4) A fresh soil sample corresponding to 10.00g of dry soil is weighed to be accurate to 0.01g, placed in a 200mL triangular flask, added with 100mL of potassium chloride solution, plugged, and shaken on a shaker for 1h. The suspension was taken out and allowed to stand (about 30 min), and the suspension was filtered with filter paper to extract a certain amount of supernatant for analysis. The filtrate was stored in a refrigerator for future use.

Measuring absorbance A of the leaching solution at 220nm and 275nm ₂₂₀ And A ₂₇₅ . The corrected absorbance a was calculated as follows:

A＝A ₂₂₀ -fA ₂₇₅ (f is 2.0)

The nitrate nitrogen in the leach liquor was removed by the method of the literature "Norman R J, edberg J C, stucki J W. Determination of the nitrate in the Soil extract by dual-wavelength ultra violet spectrometry [ J ]. Soil Science Society of America Journal Abstract,1985,49 (5): 1182-1185", and the ratio of the two was calculated as f. After a correlation curve between the A value and the nitrate nitrogen concentration is established, the nitrate nitrogen concentration in the leaching liquor can be calculated.

1.2.7.4 determination of Nitrogen element-ammonium Nitrogen by Spectrophotometer method

(1) 2mol/LKCl solution: 149.1g of KCl was weighed and dissolved in 1L of water.

(2) Phenol solution. 10g of phenol and 100mg of sodium nitroprusside are weighed and diluted to 1L. The reagent was unstable and stored in brown bottles in a refrigerator at 4 ℃. Note that sodium nitroprusside is extremely toxic!

(3) Sodium hypochlorite alkaline solution: 10g of NaOH, 7.06g of disodium hydrogen phosphate, 31.8g of sodium phosphate and 10mL of sodium hypochlorite (52.5 g/L) are weighed, dissolved in water, diluted to 1L, stored in a brown bottle and stored in a refrigerator at 4 ℃.

(4) Masking agent: 400g/L of potassium sodium tartrate was mixed in equal volumes with 100g/L of disodium EDTA salt solution. 0.5mL of 10mol/L sodium hydroxide solution was added to 100mL of the mixture.

(5) 2.50. Mu.g/mL ammonium Nitrogen (NH) ₄ ⁺ -N) standard solution: 0.4717g of dried ammonium sulfate is weighed, dissolved in water, washed into a volumetric flask and dissolved to 1L to prepare a storage solution containing 100 mu g/mL of ammonium nitrogen, and the storage solution is diluted by 20 times by adding water before use to prepare a standard solution containing 5 mu g/mL of ammonium nitrogen (N) for later use.

(6) And (4) leaching. A fresh soil sample corresponding to 10.00g of dry soil is weighed to be accurate to 0.01g, placed in a 200mL triangular flask, added with 100mL of potassium chloride solution, plugged, and shaken on a shaker for 1h. Taking out and standing (about 30 min), and sucking a certain amount of supernatant for analysis after the soil-potassium chloride suspension is clarified.

(7) And (5) measuring the absorbance. Absorbing 2-10 mL of soil leachate, putting the soil leachate into a 50mL volumetric flask, supplementing 10mL with potassium chloride solution, then sequentially adding 5mL of phenol solution and 5mL of sodium hypochlorite alkaline solution, and shaking up. After standing at room temperature of about 20 ℃ for 1 hour, 1mL of masking agent was added to dissolve a precipitate which may be generated, and then the precipitate was dissolved to the scale with water. The absorbance was read by colorimetry using a 1cm cell at a wavelength of 625 nm.

(8) Working curve. Respectively suck 0.00mL,0.50mL,1.00mL,2.00mL,3.00mL,4.00mL and 5.00mLNH ₄ ⁺ The standard solutions of-N were added to 10mL portions of potassium chloride solution in 50mL volumetric flasks and then measured colorimetrically. The concentration of each bottle of standard solution is 0mg/L,0.05mg/L,0.1mg/L,0.2mg/L,0.3mg/L,0.4mg/L and 0.5mg/L in ammonium state.

1.3 data processing

All experiments were set up with 3 sets of parallel experiments, data were averaged using software SPSS 22.0 and standard deviations were calculated, and Duncan's were used to analyze the significance of differences between treatments. All data plots were made with Origin 8.5 software.

2. Test results

2.1 degradation ability of lignocellulose

2.1.1 ability to degrade cellulose

The results of the determination of the cellulose degrading ability of the SDAU-L strain are shown in Table 3, and it can be seen that the SDAU-L strain has the cellulose degrading ability.

TABLE 3 degradation ability of cellulose

2.1.2 Lignin-degrading ability

The results of the measurement of lignin-degrading ability of SDAU-L strain are shown in Table 4, and it can be seen that SDAU-L strain has lignin-degrading ability.

TABLE 4 degradation ability of lignin

Note: the different lower case letter representations after the same column of values differ significantly at the P <0.05 level

2.2 degradation of orchard waste

2.2.1 degradation results on peach Branch waste

The results of observing the degradation change of peach tree branch waste after 30 days of degradation by each test group designed according to table 2 are shown in fig. 1.

In the blank control group (figure 1) without any bacteria, obvious white colonies can be observed when the samples are degraded and cultured for 25 days, mainly because peach branches are rotten and changed along with the degradation time of fermentation to show degradation physical properties.

2-7, the situation that the growth of the schizophyllum commune on the peach branch waste is gradually improved along with the increase of the inoculation amount is shown, and the situation that the growth of the schizophyllum commune on the peach branch waste is the most vigorous when the inoculation amount reaches 70% and the corrosion-free agent assists in degradation; the sample inoculated with the schizophyllum commune is not obviously influenced in the degradation physical property by adding the decomposing agent.

2.2.2 degradation results on apple Branch waste

From FIGS. 9 to 13, it can be seen that the addition of the decomposing agent also slightly inhibits the growth of Schizophyllum commune in the sample inoculated at 50%. Compared with the sample without the decomposing agent, the sample inoculated with 60% of schizophyllum commune and added with the decomposing agent has quicker colony growth, which indicates that the addition of the decomposing agent has remarkable promotion effect on the growth of fungi for the apple branch waste inoculated with 60% of schizophyllum commune. The samples with the inoculation amount of 70% show no remarkable degradation promoting phenomenon due to the addition of the decomposing agent, and on the contrary, the colony growth state of the samples without the addition of the decomposing agent is more remarkable.

2.3 Effect on orchard waste degradation temperature

2.3.1 Effect on degradation temperature of peach Branch waste

The effect of SDAU-L on the degradation temperature of peach branch waste is shown in FIGS. 14-16. When the material inoculated with SDAU-B is in a composting high-temperature stage, along with consumption of easily decomposed substances, the microbial metabolic strength is reduced, and the temperature is reduced.

2.3.2 Effect on Stacking temperature of apple Branch waste

The effect of SDAU-L on the stacking temperature of apple branch waste is shown in FIGS. 17-19. The influence of SDAU-L on the temperature in the apple branch waste stacking material and the temperature change of the peach branch waste stacking material shows that the temperature of the waste stacking material of the apple branches is increased along with the lapse of the degradation culture time, and the temperature increase speed is gradually increased. In the stacking of apple tree branch waste, the temperature of the stacking of samples with 70% of inoculation amount is reduced at 20 days, and is more than that of peach tree branches. The reason for this analysis is: the degradation reaction in the apple branch waste material pile is more violent than that in the peach branch material pile, the degradation activity of aerobic fungi is more vigorous, so that the oxygen consumption in the material pile is faster, the humus generated by degradation enables the material density of the apple branch waste material pile to be higher, the oxygen deficiency in the material pile and unsmooth ventilation cause the growth and degradation of aerobes, and the temperature is more obvious than that of the peach branch waste material pile. The problem is found in time in the experimental process and is solved through turning and ventilating operation. Does not affect the degradation reaction of the subsequent fungi.

2.4 degrading enzyme Activity

2.4.1SDAU-L degrading enzyme activity in peach branch waste

The enzyme activities of xylanase and CMC in peach tree branch waste of SDAU-L are respectively shown in figure 20 and figure 21, and Schizophyllum commune can improve the enzyme activity of degrading enzyme.

2.4.2SDAU-L degrading enzyme activity in apple tree branch waste

The enzyme activities of xylanase and CMC in apple tree branch waste of SDAU-L are respectively shown in figure 22 and figure 23, and Schizophyllum commune can improve the enzyme activity of degrading enzyme.

2.5 quality Change before and after degradation of waste orchard Branch

2.5.1 Mass Change before and after degradation of peach Branch waste

The degradation degree of the SDAU-L strain to the compost can be analyzed from the mass reduction condition of the peach branch waste compost by weighing the weight of all samples before and after degradation. As can be seen from fig. 24, the degradation rate of the compost to which the decomposing agent was added was higher than that to which the decomposing agent was not added, indicating that the addition of the decomposing agent did exert the effect of promoting degradation. Schizophyllum commune shows a weight loss of more than 15% without addition of a decomposing agent and with an inoculum size of 70%.

2.5.2 quality Change before and after degradation of apple Branch waste

Analysis of the mass reduction of the apple tree branch waste pile further analyzes the degradation of the pile by the SDAU-L strain. As can be seen from FIG. 25, the weight loss rate of Schizophyllum commune SDAU-L after the action on the apple branch stockpile is about 10%.

2.6 Change in lignocellulose content in Branch waste

As can be seen from fig. 26, the degradation rates of the schizophyllum commune on cellulose, hemicellulose and lignin are 26%, 41% and 33%, respectively, and the schizophyllum commune has stronger degradation capability on hemicellulose.

2.7 determination of content of related nutrient elements before and after degradation of orchard waste by SDAU-L strain

Influence of 2.7.1SDAU-L Strain on Potassium content in compost

The content change of potassium element in peach branch compost and apple branch compost is respectively shown in fig. 27 and fig. 28, the content of potassium basically has no change trend, the content of potassium in the branch compost is always between 58.6 and 58.7 percent, the change is very slight, and the SDAU-L strain and the presence or absence of a decomposing agent are proved to have no effect on the content of potassium in the branch compost of peach trees and apple trees.

2.7.2SDAU-L Strain influence on phosphorus content in compost

The content of phosphorus in peach branch compost and apple branch compost is changed as shown in fig. 29 and fig. 30, and the content of phosphorus is in a rising trend.

2.7.3 influence of SDAU-L Strain on nitrate Nitrogen content in compost

The content change of nitrate nitrogen in peach branch compost and apple branch compost is shown in fig. 31 and fig. 32 respectively, the compost body basically does not contain nitrate nitrogen, the content of the nitrate nitrogen treated by schizophyllum commune and a decomposing agent is a positive value, and the schizophyllum commune can play a degradation role to influence the content of the nitrate nitrogen.

Influence of 2.7.4SDAU-L strain on ammonium nitrogen content in compost

The content of ammonium nitrogen in peach branch compost and apple branch compost is changed as shown in fig. 33 and fig. 34, and the peach branch compost treated by the schizophyllum commune is basically free of ammonium nitrogen before and after the compost body.

In conclusion, the schizophyllum commune shows higher degradation efficiency on the semi-fibers, and the degradation rate of the schizophyllum commune on the semi-fibers in waste stacking materials is as high as 41 percent; the addition of the decomposing inoculant can obviously improve the degradation effect of the waste sample inoculated with the schizophyllum commune, the decomposing inoculant has a certain promotion effect on the schizophyllum commune when generating nitrogen elements during degradation, and the influence possibly generated by different internal microbial mechanisms is analyzed.

The above-described embodiments are only intended to illustrate the preferred embodiments of the present invention, and not to limit the scope of the present invention, and various modifications and improvements made to the technical solution of the present invention by those skilled in the art without departing from the spirit of the present invention should fall within the protection scope defined by the claims of the present invention.

Sequence listing

<110> Shandong university of agriculture

<120> Schizophyllum commune and application thereof in degradation of waste branches of orchard

<160> 1

<170> SIPOSequenceListing 1.0

<210> 1

<211> 609

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

aggaaatcaa acaagttcat cttgttctga tcctgtgcac cttatgtagt cccaaagcct 60

tcacgggcgg cggttgacta cgcctacctc acaccttaaa gtatgttaac gaatgtaatc 120

atggtcttga cagaccctaa aaagttaata caactttcga caacggatct cttggctctc 180

gcatcgatga agaacgcagc gaaatgcgat aagtaatgtg aattgcagaa ttcagtgaat 240

catcgaatct ttgaacgcac cttgcgccct ttggtattcc gaggggcatg cctgtttgag 300

tgtcattaaa taccctcaac cctcttttga cttcggtctc gagagtggct tggaagtgga 360

ggtctgctgg agcctaacgg agccagctcc tcttaaatgt attagcggat ttcccttgcg 420

ggatcgcgtc tccgatgtga taatttctac gtcgttgacc atctcggggc tgacctagtc 480

agtttcaata ggagtctgct tctaaccgtc tcttgaccga gactagcgac ttgtgcgcta 540

acttttgact tgacctcaaa tcaggtagga ctacccgctg aacttaagca tatcaataag 600

cggaggaag 609

Claims (10)

1. A Schizophyllum commune SDAU-L is characterized in that the Schizophyllum commune is preserved in China general microbiological culture Collection center (CGMCC) with the preservation number of CGMCC No.23854, the preservation date of 2021 years, 11 months and 17 days, and the preservation address of No. 3 Hakken West No. 1 Hospital on the sunward area of Beijing.

2. A microbial agent comprising the Schizophyllum commune of claim 1.

3. The preparation method of the microbial agent according to claim 2, comprising the following steps: uniformly mixing fruit tree branch wood chips, locust manure and corncobs, sterilizing, inoculating the Schizophyllum commune of claim 1, and culturing to obtain the microbial agent.

4. The method according to claim 3, wherein the fruit tree branch chips are apple tree branch chips or peach tree branch chips.

5. The preparation method according to claim 3, wherein the mass ratio of the fruit tree branch wood chips, the locust manure and the corncobs is 3.

6. The method according to claim 3, wherein the culturing is carried out at 25 ℃ for 20 to 30 days.

7. Use of the Schizophyllum commune of claim 1 or the microbial inoculant of claim 2 for degrading waste branches of an orchard.

8. Use according to claim 7, wherein the waste branches are apple or peach branches.

9. A method for degrading abandoned branches in an orchard is characterized by comprising the following steps:

(1) Preparing a microbial agent according to the method of any one of claims 3-6;

(2) Uniformly mixing the wood chips of the branches of the fruit trees, the locust manure and the corncobs, sterilizing, inoculating the microbial agent prepared in the step (1), and performing composting degradation.

10. The method for degrading waste branches in orchards according to claim 9, wherein in the step (2), the inoculation amount of the microbial inoculum is 50-70% of the total weight of the fruit tree branch wood chips, the locust manure and the corncobs.

Images