CN108913629A - A kind of bacterium of cellulase-producing and the preparation method and application thereof - Google Patents
A kind of bacterium of cellulase-producing and the preparation method and application thereof Download PDFInfo
- Publication number
- CN108913629A CN108913629A CN201810854312.7A CN201810854312A CN108913629A CN 108913629 A CN108913629 A CN 108913629A CN 201810854312 A CN201810854312 A CN 201810854312A CN 108913629 A CN108913629 A CN 108913629A
- Authority
- CN
- China
- Prior art keywords
- bacterium
- sodium carboxymethylcellulose
- cellulase
- producing bacteria
- luteibacter
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N1/00—Microorganisms, e.g. protozoa; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
- C12N1/20—Bacteria; Culture media therefor
- C12N1/205—Bacterial isolates
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12R—INDEXING SCHEME ASSOCIATED WITH SUBCLASSES C12C - C12Q, RELATING TO MICROORGANISMS
- C12R2001/00—Microorganisms ; Processes using microorganisms
- C12R2001/01—Bacteria or Actinomycetales ; using bacteria or Actinomycetales
-
- C—CHEMISTRY; METALLURGY
- C05—FERTILISERS; MANUFACTURE THEREOF
- C05F—ORGANIC FERTILISERS NOT COVERED BY SUBCLASSES C05B, C05C, e.g. FERTILISERS FROM WASTE OR REFUSE
- C05F11/00—Other organic fertilisers
- C05F11/08—Organic fertilisers containing added bacterial cultures, mycelia or the like
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/14—Hydrolases (3)
- C12N9/24—Hydrolases (3) acting on glycosyl compounds (3.2)
- C12N9/2402—Hydrolases (3) acting on glycosyl compounds (3.2) hydrolysing O- and S- glycosyl compounds (3.2.1)
- C12N9/2405—Glucanases
- C12N9/2434—Glucanases acting on beta-1,4-glucosidic bonds
- C12N9/2437—Cellulases (3.2.1.4; 3.2.1.74; 3.2.1.91; 3.2.1.150)
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Organic Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Genetics & Genomics (AREA)
- Zoology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Wood Science & Technology (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- General Engineering & Computer Science (AREA)
- Microbiology (AREA)
- Biotechnology (AREA)
- Medicinal Chemistry (AREA)
- Biomedical Technology (AREA)
- Tropical Medicine & Parasitology (AREA)
- Virology (AREA)
- Molecular Biology (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The present invention relates to a kind of efficient Cellulase Producing Bacteria and its preparation method and application, bacteriums（Luteibactersp.）L43, is preserved in China Committee for Culture Collection of Microorganisms's common micro-organisms center on July 16th, 2018, and deposit number is CGMCC No.16107.Strain growth speed of the present invention is fast; cellulase activity is high; enzymatic productivity is strong; it will not have a negative impact to the carbon cycle of nature; it will not cause damages to environment, be applied to the decomposed production organic fertilizer of alcoholized tobacco, tabacco straw, straw-returning, promote ecological recovery and preserve the ecological environment, the good material of the industries such as feed processing.It can play a significant role during agriculture and forestry organic waste material recycles.
Description
Technical field
The present invention relates to field of biotechnology, specifically a kind of Cellulase Producing Bacteria and preparation method thereof with answer
With.
Background technique
Cellulose is that the most extensive, yield renewable resource the most abundant is distributed in nature, is widely present in plant
Root, stem and leaf in.China is large agricultural country, and annual stalk yield is about 700,000,000 tons or so, and the main component in stalk is cellulose.
The substances such as bio-fuel, high-quality feed can be converted into after cellulose degradation.However in nature, cellulose degradation is difficult, main
To be derived from its special structure.Cellulose is to pass through threadiness macromolecular polymeric made of β-(Isosorbide-5-Nitrae) glucosides key connection as glucose
Object.Cellulase is can be divided into three categories the general name for the class of enzymes that cellulose degradation is glucose according to its catalysis：
1) endoglucanase (Isosorbide-5-Nitrae-β-D-glucan glucanohydrolase)：The enzyme being capable of random cutting fibre element polysaccharide chain
Interior unformed area generates the oligosaccharides and new chain end of different length；2）1,4-BETA-D-glucancellobio-hydrolase (Isosorbide-5-Nitrae-β-D-glucan
cellobilhydrolase)：The end of the fibrination sugar chain of cellulose reproducibility and irreducibility is acted on, grape is generated
Sugar or cellobiose；3）Beta glucan glycosides enzyme (β-Isosorbide-5-Nitrae-glucosidase)：The enzyme function is that hydrolysis fiber disaccharides generates grape
Sugar.It is the oligosaccharides, double of low molecular weight by the cellulose degradation of macromolecular since three components of cellulase are by synergistic effect
Sugar or polysaccharide, and the industrial or agricultural field such as be widely used in food processing, brewing, papermaking, feed addictive, weaving, medicine.Make
Cellulase is obtained as a new growth point in Enzymes Industry.Cellulase is mainly generated by microorganism, is limited by fibre
Tieing up plain Enzymes Industry factor of production mainly has strain and enzyme activity and yield, thus the screening and producing enzyme of high enzyme activity microorganism
The optimization of condition is particularly important.
Summary of the invention
The object of the present invention is to provide a kind of efficient Cellulase Producing Bacterias and the preparation method and application thereof.
To achieve the above object, the technical solution adopted by the present invention is：
A kind of efficient Cellulase Producing Bacteria, bacterium（Luteibacter sp.）L43, classification naming be rattan bacillus flavus, in
On July 16th, 2018 is preserved in China Committee for Culture Collection of Microorganisms's common micro-organisms center（Abbreviation CGMCC, address
For：The institute 3 of BeiChen West Road, Chaoyang District, BeiJing City 1）, deposit number is CGMCC No. 16107.
The Cellulase Producing Bacteria is isolated from alcoholized tobacco sample, measurement and strain idenfication by cellulase activity
Show that the bacterium is one plant of bacterium that enzymatic productivity is strong, cellulase activity is high（Luteibacter sp.）.16S is carried out to the bacterium
RRNA gene sequencing, and being found by being compared in GenBank, the 16S rRNA sequence of bacterium amplification of the invention with
Luteibacter yeojuensis R2A16-10T（Accession number：NR043618）Similitude highest is 98%.To separate
Bacterium out is named as（Luteibacter sp.）L43.
The bacterium bacterial strain（Luteibacter sp.）The preparation method of L43：
It is shaken from choosing about 1 g sample in alcoholized tobacco sample and being added in sterile deionized water, then carries out gradient dilution,
From 10-1~10-8,100 μ L suspensions are drawn respectively and are coated to sodium carboxymethylcellulose solid medium, 28 DEG C of inversions
Culture 3-5 days, picks them separately single bacterium and drops down onto PDA culture medium plate, and scribing line is oblique up to being forwarded to PDA culture medium after purification repeatedly
Bacterial strain after purification is switched to sodium carboxymethylcellulose solid medium, cultivated 3 days by face, after measuring colony diameter, is used
The Congo red solution of 1 mg/ml dyes 1 h, discards dyestuff, and NaCl solution 1 h of decoloration of 1 mol/L is added, then uses deionization
Water rinses 3-5 and measures transparent loop diameter after, and hydrolysis circle and the ratio of bacterial strain diameter are bigger, and the ability of strains for degrading cellulose is got over
By force, therefore the qualitative test of ratio size, the ability of bacterium degraded cellulose is directly reflected.
The sodium carboxymethylcellulose solid medium：51 g, NaNO3 3 of g, KH2PO4 of sodium carboxymethylcellulose
G, 0.5 0.5 g of g, MgSO4 of KCl, distilled water l000 ml, 0.01 g of FeSO4 ﹒ 7H2O, 15 g of agar powder.（PH is adjusted to exist
5.5-6.0,30 min that sterilize under 121 DEG C, 0.11 Mpa are spare）.
The PDA culture medium：200 g of peeled potatoes, 20 g of glucose, 1000 ml of distilled water, 1.5% agar, from
Right pH value, 30 min that sterilize under 121 DEG C, 0.11 Mpa are spare.
The bacterium（Luteibacter sp.）Application of the L43 in production cellulase：By the bacterium
（Luteibacter sp.）L43 is cultivated in sodium carboxymethylcellulose culture medium obtains cellulase, in culture medium
Enzyme activity is most strong, and filter paper enzyme activity is up to 16.9 ± 1.61IU/mL, and excision enzyme enzyme activity is up to 39.62 ± 1.65 IU/mL.
Further, the bacterium（Luteibacter sp.）L43 is 12.5 in pH=6, sodium carboxymethylcellulose concentration
G/L, NaNO3 concentration are that culture obtains cellulase in the sodium carboxymethylcellulose culture medium of 5 g/L.
The bacterium（Luteibacter sp.）L43 is in tabacco straw compost, tabacco straw returning to the field, alcoholized tobacco and life
There is good application prospect in cellulase-producing.The specific method is as follows：
1）The bacterial strain is activated, cryopreservation tube is taken out from ultra low temperature freezer, is inoculated in PDA culture medium or carboxymethyl cellulose solid culture
Base, 28 DEG C are cultivated 2 days；
2）It is inoculated in PDA liquid or sodium carboxymethylcellulose fluid nutrient medium, 28 DEG C shake culture two days or so are to OD600
0.8；
3）Centrifugation thallus simultaneously suspended again with after sterile deionized water suspended centrifugal with deionized water, be adjusted to concentration be 108/
Milliliter；
4）It is uniformly sprayed to tabacco straw compost, the stalk surface of straw-returning, alcoholization tobacco surface with conventional nebulizers, goes forward side by side
Room temperature storage fermentation after row stirs uniformly.
The present invention is had the advantage that：
1. bacterium L43 of the invention has a cellulase-producing high characteristic living, which degrades circle/bacterium in cellulose screening flat board
It falls diameter and reaches 3.9, enzyme activity is higher in the fermentation medium, and filter paper enzyme activity is 8.53 ± 0.6 IU/mL, and restriction endonuclease enzyme activity is
2.02 ± 0.22 IU/mL, excision enzyme enzyme activity are 20.17 ± 0.25 IU/mL.
2. strain isolation of the present invention from the stalk that straw decomposing ferments, belongs to Luteibacter bacterial strain, thus nontoxic nothing
Evil, without genetic modification, can trust and be applied to decomposed straw compost, straw-returning, feed processing, cellulase engineering field
In.It is to promote ecological recovery and preserve the ecological environment, the good material of the industries such as feed processing.It was recycled in agriculture and forestry organic waste material
Cheng Zhongke plays a significant role.
Detailed description of the invention
Fig. 1 is the bacterium colony photo of bacterial strain L43 provided in an embodiment of the present invention.
Fig. 2 is the congo red staining photo of bacterial strain L43 cellulase-producing provided in an embodiment of the present invention.
Fig. 3 is the cellulose enzyme activity of bacterial strain L43 provided in an embodiment of the present invention.
Bacterium（Luteibacter sp.）L43 is preserved in Chinese microorganism strain preservation pipe on July 16th, 2018
Reason committee common micro-organisms center（Abbreviation CGMCC, address are：The institute 3 of BeiChen West Road, Chaoyang District, BeiJing City 1）.
Specific embodiment
Below with reference to embodiment, the invention will be further described.Embodiment is intended to carry out citing description to the present invention, and
It is non-to limit the invention in any form.In the examples where no specific technique or condition is specified, according to text in the art
It offers described technology or conditions or is carried out according to product description.Reagents or instruments used without specified manufacturer,
For the conventional products that can be obtained by purchase.
Embodiment 1：
The preparation method of bacterial strain L43：
It is shaken from choosing about 1 g sample in alcoholized tobacco sample and being added in sterile deionized water, then carries out gradient dilution,
From 10-1~10-8,100 μ L suspensions are drawn respectively and are coated to sodium carboxymethylcellulose solid medium, 28 DEG C of inversions
Culture 3-5 days, picks them separately single bacterium and drops down onto PDA culture medium plate, and scribing line until be forwarded to PDA culture medium inclined-plane after purification repeatedly
（Referring to Fig. 1）.Bacterial strain after purification is switched to sodium carboxymethylcellulose solid medium, is cultivated 3 days, measurement bacterium colony is straight
After diameter, 1 h is dyed with the Congo red solution of 1 mg/ml, discards dyestuff, NaCl solution 1 h of decoloration of 1 mol/L is added, then
Transparent loop diameter is measured after rinsing 3-5 times with deionized water.It is, in general, that the size of ratio and strains for degrading cellulose ability are big
It is small related.The ratio of hydrolysis circle and bacterial strain diameter is bigger, and the ability of strains for degrading cellulose is stronger, therefore ratio size is qualitative
Test, directly reflects the ability of bacterium degraded cellulose.Therefore, this research has chosen hydrolysis and encloses with the ratio of bacterial strain diameter most
Big bacterial strain L43 is as research object.
The sodium carboxymethylcellulose solid medium：513 g of g, NaNO3 of g, KH2PO4 of sodium carboxymethylcellulose,
0.5 0.5 g of g, MgSO4 of KCl, distilled water l000 ml, 0.01 g of FeSO4 ﹒ 7H2O, 15 g of agar powder.（Adjust pH 5.5-
6.0,30 min that sterilize under 121 DEG C, 0.11 Mpa are spare）.
The PDA culture medium：200 g of peeled potatoes, 20 g of glucose, 1000 ml of distilled water, 1.5% agar.（It is natural
PH value, 30 min that sterilize under 121 DEG C, 0.11 Mpa are spare）.
Bacterial strain identification：
The cellulase-producing that above-mentioned purifying is obtained high bacterial strain living carries out bacterium colony observation, on PDA solid medium, bacterium colony table
Face is wet, yellow green, is the phenotypic characteristic of typical bacteria.
Molecular Identification：In order to determine the phyletic evolution status of this implementation bacterium bacterial strain L43, to its 16S rRNA gene order
Measurement and Phylogenetic Analysis.
The genomic DNA of the bacterial strain is extracted first, and expands the gene order of its 16S rRNA, PCR primer 27F：
（AGA GTT TGA TCM TGG CTC AG）, 1492R：（AGA GTT TGA TCM TGG CTC AG）, PCR product is carried out
It is sequenced and is carried out sequence analysis, is shown and Luteibacter yeojuensis R2A16-10T（Accession number：NR043618）Phase
It is up to 98% like property.
The 16S rRNA gene order of Luteibacter sp.L43：
TTACACATGCAAGTCGAACGGCAGCACAGCAGAGCTTGCTCTGTGGGTGGCGAGTGGCGGACGGGTGAGTAAT
GCATCGGGACCTACCTAGACGTGGGGGATAACGTAGGGAAACTTACGCTAATACCGCATACGTCCTACGGGAGAAAG
CGGGGGATCGCAAGACCTCGCGCGGTTAGATGGACCGATGTGCGATTAGCTAGTTGGTAAGGTAACGGCTTACCAAG
GCGACGATCGCTAGCTGGTCTGAGAGGATGATCAGCCACACTGGGACTGAGACACGGCCCAGACTCCTACGGGAGGC
AGCAGTGGGGAATATTGGACAATGGGCGCAAGCCTGATCCAGCAATGCCGCGTGTGTGAAGAAGGCCCTCGGGTTGT
AAAGCACTTTTATCAGGAGCGAAATCTGCATGGCTAATACCCATGTAGTCTGACGGTACCTGAGGAATAAGCACCGG
CTAACTCCGTGCCAGCAGCCGCGGTAATACGGAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGTGCGTA
GGCGGTTCGTTAAGTCTGCTGTGAAAGCCCCGGGCTCAACCTGGGAATGGCAGTGGATACTGGCGAGCTAGAGTGTG
ATAGAGGATGGTGGAATTCCCGGTGTAGCGGTGAAATGCGTAGAGATCGGGAGGAACATCAGTGGCGAAGGCGGCCA
TCTGGATCAACACTGACGCTGAGGCACGAAA
In summary qualification result names bacterial strain L43 for Luteibacter sp.；In being preserved in on July 17th, 2018
State's Microbiological Culture Collection administration committee common micro-organisms center（Abbreviation CGMCC, address are：Chaoyang District, Beijing City North Star west
The institute 3 of road 1）, deposit number is CGMCC No. 16107.（Luteibacter sp.）L43, abbreviation bacterial strain L43.
Above-mentioned bacterium bacteria strain L43 degraded cellulose ability is strong, and enzyme activity is high, does not carry out genetic modification.When thallus is released
It is harmless to people, animals and plants after entering natural environment, it is free from environmental pollution, it can not promote straw-returning, the degradation of agriculture and forestry organic waste material,
Agriculturally there is potential application value.
The laboratory preservation mode of gained Luteibacter sp. L43 bacterium bacterial strain：
Short term storage mode is to be seeded to PDA solid slope, is preserved in 4 DEG C of refrigerators after bacterium colony is grown well, this preservation mode is used
In no more than 3 moon short term storage；
Long term storage mode is：Microorganism is added in final concentration of 20% glycerol and mixes simultaneously preservation into -80 DEG C of refrigerators, this
Preservation mode about can be preservation 10 years.
Application Example：
The bacterium（Luteibacter sp.）Application of the L43 in production cellulase：By the bacterium（Luteibacter
sp.）L43 is cultivated in sodium carboxymethylcellulose culture medium obtains cellulase, and enzyme activity is most strong in culture medium, filter paper
Enzyme activity is up to 16.9 ± 1.61IU/mL, and excision enzyme enzyme activity is up to 39.62 ± 1.65 IU/mL.
Further, the bacterium（Luteibacter sp.）L43 is 12.5 in pH=6, sodium carboxymethylcellulose concentration
G/L, NaNO3 concentration are that culture obtains cellulase in the sodium carboxymethylcellulose culture medium of 5 g/L.
Enzymatic productivity and other specificity analysis
1, the production cellulose ability of bacterial strain L43 just mesh analysis
The bacterium bacterial strain L43 point is connected on sodium carboxymethylcellulose culture medium solid plate, and 28 DEG C are cultivated 5 days, measures bacterium colony
After diameter, after dyeing 1 h with the Congo red solution of 1 mg/ml, dyestuff is discarded, 1 mol/L sodium chloride solution, 1 h of decoloration is added,
Measure transparent loop diameter.Transparent loop diameter/colony diameter is 3.9（Referring to picture 1,2）, therefore, which has very strong drop
Solve cellulose ability.
2, the cellulase activity measurement of bacterial strain L43
The measurement of enzyme activity is carried out to cellulase producing strain, the measurement of enzyme activity refers to the DNS method of Miller G.L, this side
Method can carry out bacterial strain cellulase-producing intensity living effectively quantitative.1 mL crude enzyme liquid is 1 under the conditions of enzyme activity is defined on 50 DEG C
Hydrolysis generates the glucose of 1.0 μ g, referred to as 1 cellulose enzyme unit of activity in min（μ g/min, IU）.Strain inoculated is arrived
50 ml（100 ml triangular flasks）In carboxymethyl cellulose sodium liquid fermentation culture medium, in 28 DEG C, 180 r/min shaking table cultures,
Bacterium solution is taken after 3 d, 6000 r/min are centrifuged 10 min, and supernatant is crude enzyme liquid.The measurement of three kinds of enzyme activity is carried out to crude enzyme liquid：
1. the measurement of filter paper enzyme activity.No. 1 filter paper (1cm × 3cm) of Xinhua is rolled into rouleau, is put into 15ml EP pipe, is added 1.75
ML HAc-NaAc buffer (pH=4.8) adds 0.25 mL crude enzyme liquid, gently shakes up, filter paper is made to be fully immersed in liquid
In, after 50 DEG C of 1 h of heat preservation, 3 ml DNS solution are added, is put in boiling water bath and boils 10 min, terminate reaction immediately with cold water.
Absorbance value (OD value) is measured in the case where wavelength is 540 nm.
2. inscribe enzyme activity determination.1.75 mL of acetate buffer solution containing 0.5% CMC-Na is pipetted in test tube, is added thick
Enzyme solution 0.25 mL, 50 DEG C of 30 min of heat preservation are added 3 ml DNS solution, are put in boiling water bath and boil 10 min, set in cold water eventually
Only react.Absorbance value (OD value) is measured in the case where wavelength is 540 nm.
3. circumscribed enzyme activity determination.1.75 mL of acetate buffer solution containing 0.5% microcrystalline cellulose is pipetted in test tube, is added
0.25 mL of enzyme solution is added 3 ml DNS solution, sets and boil 10 min in boiling water bath after 50 DEG C of 2 h of heat preservation, sets in cold water eventually
Only react.Absorbance value (OD value) is measured in the case where wavelength is 540 nm.Cold water cooling after control group selection 10 min of boiling water boiling
Bacterium solution.Each sample does three parallel laboratory tests.Measurement result shows that bacterial strain L43 has higher enzyme activity, filter paper enzyme activity 8.53
± 0.6 IU/mL, restriction endonuclease enzyme activity are 2.02 ± 0.22 IU/mL, and excision enzyme enzyme activity is 20.17 ± 0.25 IU/mL（Referring to figure
Piece 3）.
3, the optimization of bacterial strain L43 cellulase-producing condition of culture
The growth conditions and culture environment of the generation of cellulase and secretion capacity and bacterium（Such as carbon and nitrogen sources proportion, pH）Closely
Carbon and nitrogen sources proportion, pH during enzymatic production is optimized in correlation, the present invention, finally significantly improves enzymatic productivity.
The basal medium of optimization is sodium carboxymethylcellulose culture medium, since sodium carboxymethylcellulose culture medium has been prepared
At pH5.5-6.5 is required, this may not be the optimal pH of L43 cellulase-producing, and carbon source, the proportion of nitrogen source all affect production
The enzymatic productivity of enzyme bacterial strain, therefore, the present invention are respectively provided with pH=3,4,5,6,7,8 a series of pH condition of culture, carboxylic first
Base sodium cellulosate concentration is 0.25%, 0.5%, 0.75%, 1%, and a series of 1.25% carbon source concentrations and NaNO3 concentration are 0.25%,
0.5%, 1%, 1.5%, 2% a series of nitrogen concentration, and carried out orthogonal test, the results showed that pH=7, sodium carboxymethylcellulose
Cellulose restriction endonuclease enzyme activity highest when being 3 g/L that concentration is 3 g/L, NaNO3 concentration is 2.45 ± 0.05 IU/mL.PH=6, carboxylic
Methylcellulose na concn is 12.5 g/L, NaNO3 concentration filter paper enzyme activity when being 3 g/L, enzymatic productivity is most strong, and enzyme activity is up to 16.9
± 1.61 IU/mL.Excision enzyme producing enzyme when being 5 g/L that pH=6, sodium carboxymethylcellulose concentration are 12.5 g/L, NaNO3 concentration
Ability is most strong, and enzyme activity is up to 39.62 ± 1.65 IU/mL.After training systern, filter paper enzyme activity, excision enzyme enzyme activity are respectively than original
Enzyme activity increases 98.12% and 96.33%（Referring to picture 3）.
In tabacco straw compost, tabacco straw returning to the field, alcoholized tobacco concrete application method：
1）The bacterial strain is activated, takes out cryopreservation tube from ultra low temperature freezer, is inoculated in PDA culture medium or the training of sodium carboxymethylcellulose solid
Base is supported, 28 DEG C are cultivated 2 days or so；
2）It is inoculated in PDA liquid or sodium carboxymethylcellulose fluid nutrient medium（Sodium carboxymethylcellulose solid medium subtracts fine jade
Rouge is exactly fluid nutrient medium）, 28 DEG C shake culture two days or so to OD600 be 0.8 or so；
3）Centrifugation thallus simultaneously suspended again with after sterile deionized water suspended centrifugal with deionized water, be adjusted to concentration be 108/
Milliliter；
4）It is uniformly sprayed to tabacco straw compost, the stalk surface of straw-returning, alcoholization tobacco surface with conventional nebulizers, goes forward side by side
Room temperature storage fermentation can reach application purpose after row stirs uniformly.
The basic principles, main features and advantages of the present invention have been shown and described above.The technology of the industry
Personnel are it should be appreciated that the present invention is not limited to the above embodiments, and the above embodiments and description only describe this
The principle of invention, without departing from the spirit and scope of the present invention, various changes and improvements may be made to the invention, these changes
Change and improvement all fall within the protetion scope of the claimed invention.The claimed scope of the invention by appended claims and its
Equivalent thereof.
Sequence table
<110>Cigarette industry Co., Ltd in Yunnan
<120>A kind of efficient Cellulase Producing Bacteria and its preparation method and application
<160> 3
<170> SIPOSequenceListing 1.0
<210> 1
<211> 720
<212> DNA/RNA
<213>The 16S rRNA gene order of Luteibacter sp.L43：()
<400> 1
ttacacatgc aagtcgaacg gcagcacagc agagcttgct ctgtgggtgg cgagtggcgg 60
acgggtgagt aatgcatcgg gacctaccta gacgtggggg ataacgtagg gaaacttacg 120
ctaataccgc atacgtccta cgggagaaag cgggggatcg caagacctcg cgcggttaga 180
tggaccgatg tgcgattagc tagttggtaa ggtaacggct taccaaggcg acgatcgcta 240
gctggtctga gaggatgatc agccacactg ggactgagac acggcccaga ctcctacggg 300
aggcagcagt ggggaatatt ggacaatggg cgcaagcctg atccagcaat gccgcgtgtg 360
tgaagaaggc cctcgggttg taaagcactt ttatcaggag cgaaatctgc atggctaata 420
cccatgtagt ctgacggtac ctgaggaata agcaccggct aactccgtgc cagcagccgc 480
ggtaatacgg agggtgcaag cgttaatcgg aattactggg cgtaaagcgt gcgtaggcgg 540
ttcgttaagt ctgctgtgaa agccccgggc tcaacctggg aatggcagtg gatactggcg 600
agctagagtg tgatagagga tggtggaatt cccggtgtag cggtgaaatg cgtagagatc 660
gggaggaaca tcagtggcga aggcggccat ctggatcaac actgacgctg aggcacgaaa 720
<210> 2
<211> 20
<212> DNA/RNA
<213>Primer ()
<400> 2
agagtttgat cmtggctcag 20
<210> 3
<211> 20
<212> DNA/RNA
<213> 1492R
<400> 3
agagtttgat cmtggctcag 20
Claims (7)
1. a kind of efficient Cellulase Producing Bacteria, it is characterised in that：The bacterium（Luteibactersp.）L43, classification naming
For rattan bacillus flavus, it is preserved in China Committee for Culture Collection of Microorganisms's common micro-organisms center on July 16th, 2018,
Its deposit number is CGMCC No. 16107.
2. the preparation method of efficient Cellulase Producing Bacteria described in claim 1, which is characterized in that be carried out as follows：From cigarette
It chooses about 1 g sample in grass alcoholization sample and is added in sterile deionized water and shaken, gradient dilution is then carried out, from 10-1~
10-8, 100 μ L suspensions to be drawn respectively to be coated to sodium carboxymethylcellulose solid medium, 28 DEG C of inversions are cultivated 3-5 days,
It picks them separately single bacterium and drops down onto PDA culture medium plate, scribing line, will after purification up to being forwarded to PDA culture medium inclined-plane after purification repeatedly
Bacterial strain be switched to sodium carboxymethylcellulose solid medium, cultivate 3 days, it is rigid with 1 mg/ml after measuring colony diameter
Arnotto solution dyes 1 h, discards dyestuff, and NaCl solution 1 h of decoloration of 1 mol/L is added, is then rinsed 3-5 times with deionized water
After measure transparent loop diameter, the ratio of hydrolysis circle and bacterial strain diameter is bigger, and the ability of strains for degrading cellulose is stronger.
3. the preparation method of efficient Cellulase Producing Bacteria according to claim 2, which is characterized in that the carboxymethyl
Sodium cellulosate solid medium is：Sodium carboxymethylcellulose 5 g, KH2PO4 1 g、NaNO3 3 g、KCl 0.5 g、MgSO4 0.5
G, distilled water l000 ml, FeSO4﹒ 7H20.01 g of O, 15 g of agar powder adjust pH 5.5-6.0, under 121 DEG C, 0.11 Mpa
30 min that sterilize are spare.
4. the preparation method of efficient Cellulase Producing Bacteria according to claim 2, which is characterized in that the PDA training
Feeding base is：200 g of peeled potatoes, 20 g of glucose, 1000 ml of distilled water, 1.5% agar, natural ph, in 121 DEG C,
30 min that sterilize under 0.11 Mpa are spare.
5. the application of efficient Cellulase Producing Bacteria described in claim 1, it is characterised in that：By the bacterium（Luteibacter
sp.）L43 is cultivated in sodium carboxymethylcellulose culture medium obtains cellulase.
6. the application of efficient Cellulase Producing Bacteria according to claim 5, it is characterised in that：By the bacterium
（Luteibactersp.）L43 is 12.5 g/L, NaNO in pH=6, sodium carboxymethylcellulose concentration3Concentration is the carboxylic of 5 g/L
Culture obtains cellulase in sodium carboxymethylcellulose pyce culture medium.
7. the application of efficient Cellulase Producing Bacteria described in claim 1, it is characterised in that：Applied to tabacco straw compost, cigarette
Careless straw-returning, alcoholized tobacco, the specific method is as follows：
1）The bacterial strain is activated, cryopreservation tube is taken out from ultra low temperature freezer, is inoculated in PDA culture medium or carboxymethyl cellulose solid culture
Base, 28 DEG C are cultivated 2 days；
2）Be inoculated in PDA liquid or sodium carboxymethylcellulose fluid nutrient medium, 28 DEG C shake culture two days or so to OD600 be 0.8；
3）Centrifugation thallus is simultaneously suspended with after sterile deionized water suspended centrifugal with deionized water again, and being adjusted to concentration is 108A/
Milliliter；
It is uniformly sprayed to tabacco straw compost, the stalk surface of straw-returning, alcoholization tobacco surface with conventional nebulizers, and carries out
Room temperature storage fermentation after stirring uniformly.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810854312.7A CN108913629B (en) | 2018-07-30 | 2018-07-30 | Bacterium for producing cellulase, preparation method and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810854312.7A CN108913629B (en) | 2018-07-30 | 2018-07-30 | Bacterium for producing cellulase, preparation method and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN108913629A true CN108913629A (en) | 2018-11-30 |
| CN108913629B CN108913629B (en) | 2021-03-23 |
Family
ID=64416268
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201810854312.7A Active CN108913629B (en) | 2018-07-30 | 2018-07-30 | Bacterium for producing cellulase, preparation method and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN108913629B (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109626555A (en) * | 2019-01-21 | 2019-04-16 | 四川清和科技有限公司 | A kind of method of fast degradation water body withered fallen leaf |
| CN115247142A (en) * | 2022-08-16 | 2022-10-28 | 安徽农业大学 | Cellulose fiber micro-bacterium and application thereof in straw field compost |
Family Cites Families (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| MX2017013864A (en) * | 2015-05-01 | 2018-04-24 | Indigo Agriculture Inc | Isolated complex endophyte compositions and methods for improved plant traits. |
| CA2993188A1 (en) * | 2015-07-25 | 2017-02-02 | Bioconsortia, Inc. | Agriculturally beneficial microbes, microbial compositions, and consortia |
| CN108192944A (en) * | 2018-01-22 | 2018-06-22 | 协赛(上海)生物科技有限公司 | A kind of production method of microbial biomass |
-
2018
- 2018-07-30 CN CN201810854312.7A patent/CN108913629B/en active Active
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109626555A (en) * | 2019-01-21 | 2019-04-16 | 四川清和科技有限公司 | A kind of method of fast degradation water body withered fallen leaf |
| CN115247142A (en) * | 2022-08-16 | 2022-10-28 | 安徽农业大学 | Cellulose fiber micro-bacterium and application thereof in straw field compost |
| CN115247142B (en) * | 2022-08-16 | 2023-05-12 | 安徽农业大学 | Fiber-based fiber micro-bacteria and application thereof in straw field composting |
Also Published As
| Publication number | Publication date |
|---|---|
| CN108913629B (en) | 2021-03-23 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN101555461B (en) | Bacterial strain LT3 producing alkalescence cellulase and breeding method and initial optimization of cellulase production conditions thereof | |
| CN106350469B (en) | High-temperature-resistant bacillus with cellulose degradation capability and application thereof | |
| CN105624066B (en) | Cellulase-producing actinomyces and application | |
| CN104560816B (en) | Bacillus licheniformis with biomass hydrolase activity and application thereof | |
| CN110331109B (en) | Bacillus subtilis and culture method and application thereof | |
| CN111363684B (en) | Composite microbial inoculum for efficiently degrading wood fibers and application thereof in composting | |
| CN112251376B (en) | Thermophilic aerophilic thiamine decomposing bacillus, microbial inoculum and application thereof | |
| CN102586134B (en) | Marine streptomyces viridochromogenes strain for producing alkali-tolerant and salt-tolerant xylanase and application of marine streptomyces viridochromogenes strain | |
| CN111019865A (en) | Pseudomonas graminis strain capable of degrading cellulose at low temperature and application thereof | |
| CN111518731B (en) | Bacillus subtilis with antagonistic effect for degrading cellulose at low temperature and application thereof | |
| CN104498407A (en) | Bacillus licheniformis UTM107 producing high-temperature-resistant keratinase and application thereof | |
| CN109439585B (en) | Katy bacteria adipate and application thereof in cellulose degradation | |
| CN108865927B (en) | Bacterial strain for low-temperature glycolysis of corn straw and fermentation culture method and application thereof | |
| CN104357364A (en) | Streptomycete strain and method for preparing alkali-resistant salt-resistant xylanase by using same | |
| CN108913629A (en) | A kind of bacterium of cellulase-producing and the preparation method and application thereof | |
| CN101864366A (en) | Penicillium citrinum bacterial strain and application thereof | |
| CN103146776B (en) | Method for producing indigo pigment with bacillus subtilis | |
| CN102690773B (en) | Enterobacteria strain FY-07 and method thereof for producing bacterial cellulose by static liquid submerged fermentation | |
| CN104611270A (en) | Streptomyces strain and application thereof | |
| Sadhu et al. | Characterization of a Bosea sp. strain SF5 (MTCC 10045) isolated from compost soil capable of producing cellulase | |
| CN104560815A (en) | Bacillus licheniformis with azo compound degradation activity and application thereof | |
| CN105969689B (en) | Cellulase Producing Bacteria and application | |
| Nguyen et al. | Screening of Cellulolytic Actinomycetes for Decomposition of Agricultural Waste. | |
| CN104560818A (en) | Bacillus licheniformis UTM118 for producing high-temperature-resistant acid alpha-amylase and application of bacillus licheniformis UTM118 | |
| CN114657073B (en) | Penicillium citrinum strain for high cellobiase production and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |