CN114410483B - Trichoderma harzianum and application thereof in degrading waste orchard branches - Google Patents

Abstract

The invention discloses trichoderma harzianum and application thereof in degrading waste branches in orchards, and relates to the technical field of microorganisms. The Trichoderma harzianum SDAU-H disclosed by the invention is preserved in the China general microbiological culture Collection center of the China Committee for culture Collection of microorganisms with the preservation number of CGMCC No.23810, the preservation date of 2021 year, 11 month and 17 days, and the preservation address of No. 3 Hospital No. 1 Hospital of North West Chen in the sunward area of Beijing. The trichoderma harzianum provided by the invention has the capacity of degrading lignin and cellulose, can improve the activity of degrading enzymes in waste piles, can play a degrading role to promote the nitrate nitrogen content of piles to be increased, and can improve the degradation efficiency of waste branches in orchards.

Description

Trichoderma harzianum and application thereof in degradation of waste orchard branches

Technical Field

The invention relates to the technical field of microorganisms, in particular to trichoderma harzianum and application thereof in degrading waste orchard branches.

Background

A large amount of wastes such as dead branches and fallen leaves are generated in an orchard every year, waste fruit tree branches are directly discarded in the orchard or are simply burnt due to unreasonable treatment, the appearance of the orchard is affected, resources are wasted, the discarded branches provide habitat for orchard pests, the discarded branches are easy to become infection sources of orchard diseases and insect pests, and the burnt branches directly cause harm to the environment.

The part of the orchard waste which is difficult to degrade is mainly orchard waste branches, and the main component of the branches is lignocellulose. Under natural conditions, lignocellulose is water-insoluble and biologically resistant due to the particularity of its own physical structure and chemical composition, and thus is difficult to hydrolyze or directly metabolized by microorganisms, thereby preventing its rapid degradation and recycling. The lignocellulose comprises 40-50% of cellulose, 20-35% of hemicellulose and 15-30% of lignin, wherein the cellulose is macromolecular polysaccharide formed by D-glucose through beta-1,4 glycosidic bonds, exists in a plurality of tightly arranged micro-silks and forms a skeleton of a cell wall. Before the microorganisms can utilize the cellulose, it must be released from the lignin and hemicellulose coating, resulting in low cellulose utilization and slow actual operation time. Hemicellulose has a more complex structure than cellulose, and not only comprises a main chain skeleton, but also comprises a series of different side chain substituents and the like. Hemicellulose permeates into the matrix material in an amorphous state, is connected with lignin formed only at the last stage of cell differentiation through chemical bonds, and is then wrapped outside fibers so as to increase the rigidity of cell walls. Lignin is a natural organic high molecular compound with an extremely complex structure and is also one of the most difficult biodegradable organic compounds. Lignin is a phenolic polymer, and the monomers are connected with each other through ether bonds and carbon-carbon bonds, so that the lignin is difficult to hydrolyze. Lignin plays a supporting and protective role for plants. But also the difficult-to-degrade lignin is tightly combined with the cell wall, so that the plant wood fiber structure is stable and is not easy to biodegrade.

Disclosure of Invention

The invention aims to provide trichoderma harzianum and application thereof in degrading waste orchard branches so as to solve the problems in the prior art.

In order to achieve the purpose, the invention provides the following scheme:

the invention provides a Trichoderma harzianum (Trichoderma harzianum) SDAU-H which is preserved in the China general microbiological culture Collection center of the China Committee for culture Collection of microorganisms, wherein the preservation number is CGMCC No.23810, the preservation date is 2021 year, 11 month and 17 days, and the preservation address is No. 3 Hospital No. 1 Hospital of North Kogyo area in Beijing.

The invention also provides a microbial agent, which comprises the trichoderma harzianum.

The invention also provides a preparation method of the microbial agent, which comprises the following steps: and uniformly mixing the wood chips of the branches of the fruit trees, the locust manure and the corncobs, sterilizing, then inoculating the trichoderma harzianum, and culturing to obtain the microbial agent.

Further, the fruit tree branch wood chips are apple tree branch wood chips or peach tree branch wood chips.

Further, the mass ratio of the fruit tree branch wood chips, the locust manure and the corncobs is 3.

Further, the culture is carried out for 20-30 days at 25 ℃.

The invention also provides application of the trichoderma harzianum or the microbial agent in degradation of waste branches in orchards.

Further, the waste branches are apple tree branches or peach tree branches.

The invention also provides a method for degrading the abandoned branches in the orchard garden, which comprises the following steps:

(1) Preparing the microbial agent according to the method;

(2) Uniformly mixing the wood chips of the branches of the fruit trees, the locust manure and the corncobs, sterilizing, inoculating the microbial agent prepared in the step (1), and performing composting degradation.

Further, in the step (2), the inoculation amount of the microbial agent is 50-70% of the total weight of the fruit tree branch wood chips, the locust manure and the corncobs.

The invention discloses the following technical effects:

(1) The Trichoderma harzianum provided by the invention has the capacity of degrading lignin and cellulose, wherein the lignin has higher degradation efficiency, and the degradation rate of the Trichoderma harzianum to lignin in waste stacking materials reaches 32%.

(2) The trichoderma harzianum provided by the invention can improve the activity of degrading enzymes in waste stacking materials.

(3) The trichoderma harzianum provided by the invention can play a role in degradation and promote the increase of the nitrate nitrogen content of the heap.

Drawings

In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings needed in the embodiments will be briefly described below, and it is obvious that the drawings in the following description are only some embodiments of the present invention, and it is obvious for those skilled in the art to obtain other drawings without creative efforts.

FIG. 1 is a graph of a sample of degraded peach tree branch waste from test group 0 of Table 2 of example 2;

FIG. 2 is a graph of a sample of degraded peach tree branch waste of test group 1 in Table 2 of example 2;

FIG. 3 is a graph of a sample of degraded peach tree branch waste of test group 2 in Table 2 of example 2;

FIG. 4 is a graph of a sample of degraded peach tree branch waste of test group 3 of Table 2 of example 2;

FIG. 5 is a graph of a sample of degraded peach tree branch waste from test group 4 of Table 2 of example 2;

FIG. 6 is a graph of a sample of degraded peach branch waste from test group 5 of Table 2 of example 2;

FIG. 7 is a graph of a sample of degraded peach tree branch waste from test group 6 of Table 2 of example 2;

FIG. 8 is a graph of a sample of degraded apple tree branch waste from test group 7 of Table 2 of example 2;

FIG. 9 is a graph of a sample of degraded apple tree branch waste from test group 8 of Table 2 of example 2;

FIG. 10 is a graph of a sample of degraded apple tree branch waste from test group 9 of Table 2 of example 2;

figure 11 is a graph of a sample of degraded apple tree branch waste from test group 10 in table 2 of example 2;

FIG. 12 is a graph of a sample of degraded apple tree branch waste from test group 11 of Table 2 in example 2;

FIG. 13 is a graph of a sample of degraded apple tree branch waste from test group 12 of Table 2 of example 2;

FIG. 14 is a graph of the temperature change of a waste peach branch compost when the inoculation amount is 50%, wherein T50% HC + represents addition of the decomposition agent, and T50% HC-off represents no addition of the decomposition agent;

FIG. 15 is a graph of the temperature change of a waste peach branch compost when the inoculation amount is 60%, wherein T60% HC + represents addition of a decomposition agent, and T60% HC-off represents non-addition of a decomposition agent;

FIG. 16 is a graph of the temperature change of a waste peach branch compost when the inoculation amount is 70%, wherein T70% HC + represents addition of a decomposition agent, and T70% HC-off represents non-addition of a decomposition agent;

FIG. 17 is a graph of temperature change of a waste heap of apple branches when the inoculum size is 50%, wherein PG 50% HC plus represents addition of a decomposition agent, PG 50% HC minus represents no addition of a decomposition agent;

FIG. 18 is a graph of temperature change of a waste heap of apple branches when the inoculation amount is 60%, wherein PG 60% HC plus represents addition of a decomposition agent, and PG 60% HC minus represents no addition of a decomposition agent;

FIG. 19 is a graph of temperature change of a waste heap of apple branches when the inoculum size is 70%, wherein PG 70% HC plus represents addition of a decomposition agent, PG 70% HC minus represents no addition of a decomposition agent;

FIG. 20 is a graph of xylanase activity in peach tree waste from Trichoderma harzianum SDAU-H, where "+" represents a decomposing agent;

FIG. 21 is a CMC enzyme map of Trichoderma harzianum SDAU-H in peach tree waste, where "+" represents a decomposing agent;

FIG. 22 is a graph of xylanase activity in apple tree waste of Trichoderma harzianum SDAU-H, wherein "+" represents the presence of a maturing agent;

FIG. 23 is a CMC enzyme map of Trichoderma harzianum SDAU-H in apple tree waste, wherein "+" represents a decomposing agent;

FIG. 24 is a graph of the reduction in weight of peach branch waste by Trichoderma harzianum SDAU-H, where "+" represents the presence of a maturing agent;

FIG. 25 is a graph of the reduction of weight of apple tree branch waste by Trichoderma harzianum SDAU-H, wherein "+" represents the presence of a maturing agent;

FIG. 26 shows the degradation rate of Trichoderma harzianum SDAU-H on cellulose, hemicellulose and lignin in waste;

FIG. 27 is a graph of potassium content changes in peach branch compost, where "plus" indicates the presence of a decomposing agent and "not plus" indicates the absence of a decomposing agent;

FIG. 28 is a graph of potassium content changes in apple branch compost, where "plus" indicates the presence of a decomposing agent and "not plus" indicates the absence of a decomposing agent;

FIG. 29 is a graph showing the variation of phosphorus content in peach branch compost, wherein "plus" indicates the presence of a decomposing agent and "not plus" indicates the absence of a decomposing agent;

FIG. 30 is a graph of the change in phosphorus content in apple branch compost, wherein "plus" indicates the presence of a decomposing agent and "not plus" indicates the absence of a decomposing agent;

FIG. 31 is a graph showing the change of nitrate nitrogen content in peach branch compost, wherein "plus" represents the presence of a decomposing agent and "not plus" represents the absence of a decomposing agent;

FIG. 32 is a graph of the change in nitrate nitrogen content in apple branch compost, wherein "plus" indicates the presence of a decomposing agent and "not plus" indicates the absence of a decomposing agent;

FIG. 33 is a graph showing the variation of ammonium nitrogen content in peach branch compost, wherein "add" indicates the presence of a decomposing agent and "not add" indicates the absence of a decomposing agent;

FIG. 34 is a graph of the change in ammonium nitrogen content in apple branch compost, where "add" indicates the presence of a decomposing agent and "not add" indicates the absence of a decomposing agent.

Detailed Description

Reference will now be made in detail to various exemplary embodiments of the invention, the detailed description should not be construed as limiting the invention but as a more detailed description of certain aspects, features and embodiments of the invention.

It is to be understood that the terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting of the invention. Further, for numerical ranges in this disclosure, it is understood that each intervening value, between the upper and lower limit of that range, is also specifically disclosed. Every intervening value, to the extent any stated value or intervening value in a stated range, and any other stated or intervening value in a stated range, is encompassed within the invention. The upper and lower limits of these smaller ranges may independently be included or excluded in the range.

Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Although only preferred methods and materials are described herein, any methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention. All documents mentioned in this specification are incorporated herein by reference to disclose and describe the methods and/or materials in connection with which the documents are cited. In case of conflict with any incorporated document, the present specification will control.

It will be apparent to those skilled in the art that various modifications and variations can be made in the specific embodiments of the present disclosure without departing from the scope or spirit of the disclosure. Other embodiments will be apparent to those skilled in the art from consideration of the specification. The description and examples are intended to be illustrative only.

As used herein, the terms "comprising," "including," "having," "containing," and the like are open-ended terms that mean including, but not limited to.

In the following examples, the media, reagents, test materials and instruments used are as follows:

culture medium:

potato dextrose agar medium (PDA): 200g/L of potatoes, 20g/L of glucose and 20g/L of agar.

Congo red cellulose agar: k is ₂ HPO ₄ 1.0g，MgSO _4` 7H ₂ O0.5 g, agar 20g, naCl 0.5g, (NH) ₄ ) ₂ SO ₄ 2.0g, CMC-Na 2.0g, congo red 0.2g, 1000mL of water, natural pH.

PDA-guaiacol medium: 0.02% guaiacol was added to PDA medium.

Reagents and test materials:

birch xylan (birchwood xylan, sigma), congo red dye liquor, naCl aqueous solution, and decomposing agent (Brand of backer).

DNS reagent: sodium potassium tartrate (CMC-Na) 18.2g was dissolved in 50mL of distilled water and heated. 3,5-dinitrosalicylic acid 0.03g, naOH 2.1g and phenol 0.5g are added into the hot solution in sequence, stirred until completely dissolved, cooled, and then added with distilled water to a constant volume of 100mL, and stored in a brown bottle.

1% CMC buffer: 1g of CMC was weighed out and dissolved in 100mL of 50mol/L citric acid and 100mmol of disodium hydrogen phosphate buffer solution (pH 6.0).

1% xylan solution: formulated with 50mmol/LpH =10 glycine-sodium hydroxide buffer.

1mg/mL xylose standard solution: and (3) putting the anhydrous xylose into an oven at 80 ℃ for drying operation until the weight of the xylose is constant, accurately measuring 0.1g of xylose solid, adding a proper amount of distilled water to fully dissolve the xylose solid, and metering the volume to 100mL.

1mg/mL glucose standard solution: accurately weighing 100mg of glucose, adding a proper amount of distilled water to fully dissolve the glucose, metering the volume to 100mL, and storing at 4 ℃ for later use.

0.16mmol/L cotton blue lactate staining solution: the azureB dye 0.01223g was taken, added with 200mL of distilled water and dissolved sufficiently, and the volume was adjusted to 250mL with distilled water.

72% sulfuric acid solution: accurately measure 665mL 98% concentrated H ₂ S0 ₄ Slowly add to 300mL distilled water, and continue to make up to 1L with distilled water.

Neutral detergent: accurately weighing 18.61g of EDTA and 6.18g of sodium tetraborate, placing the EDTA and the sodium tetraborate in a beaker, adding a small amount of distilled water, heating the mixture to fully dissolve the EDTA and the sodium tetraborate, adding 30g of sodium dodecyl sulfate, 4.56g of disodium hydrogen phosphate and 10mL of ethoxyethanol, adding distilled water, heating the beaker to dissolve and mix all solids, continuously adding distilled water to a constant volume of 1L, and adjusting the pH of the detergent to be neutral by using a 75% sulfuric acid solution.

Acid detergents: accurately weighing 27.2mL of concentrated sulfuric acid, placing the concentrated sulfuric acid in 900mL of distilled water, fully and uniformly mixing, adding 20g of hexadecyl trimethyl desertification amine, fully and uniformly mixing, and adding distilled water to reach a constant volume of 1L.

The sources of the abandoned branches in the orchard are as follows: peach branches with the diameter of 20mm are from peach gardens of Shandong-sourced ecological agriculture development Limited liability company, and apple branches with the diameter of 20mm are from apple gardens of Shandong-Taian-Yangyu. And respectively crushing the peach branches and the apple branches into wood chips for later use.

A decomposing inoculant: the main components are bacillus subtilis, bacillus licheniformis, bacillus amyloliquefaciens, cellulase, ligninase, hemicellulase and vitamins.

Other materials: locust manure is sourced from Shandong-Yuan ecological agriculture development Limited liability company, and corncobs are purchased from farmers in Shandong Tai Annan school areas.

The instrument comprises the following steps: see table 1.

TABLE 1 list of main laboratory instruments

EXAMPLE 1 isolation, identification, preservation of the Strain

1. Separation of

A strain is obtained by separating a collected specimen of a trunk of a pear tree in a bacterial base of southern school district of Shandong agricultural university and named as SDAU-H.

2. Identification

1. Morphological identification

The SDAU-H bacterial colony is villous and white in the early growth stage, the color changes from light green to dark green along with the aging of hyphae, spores are dark green spherical, and the spore yield is large.

2. Molecular biological identification

ITS sequencing is carried out on the SDAU-H, the SDAU-H is identified as Trichoderma harzianum, and the ITS sequence (SEQ ID NO: 1) is as follows:

TGGGGCTTCACTCCCAACCCAATGTGAACGTTACCAAACTGTTGCCTCGGCGGGATCTCTGCCCCGGGTGCGTCGCAGCCCCGGACCAAGGCGCCCGCCGGAGGACCAACCAAAACTCTTTTTGTATACCCCCTCGCGGGTTTTTTATAATCTGAGCCTTCTCGGCGCCTCTCGTAGGCGTTTCGAAAATGAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGTATTCTGGCGGGCATGCCTGTCCGAGCGTCATTTCAACCCTCGAACCCCTCCGGGGGGTCGGCGTTGGGGATCGGCCCTGCCTCTTGGCGGTGGCCGTCTCCGAAATACAGTGGCGGTCTCGCCGCAGCCTCTCCTGCGCAGTAGTTTGCACACTCGCATCGGGAGCGCGGCGCGTCCACAGCCGTTAAACACCCAACTTCTGAAATGTTGACCTCGGATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAAAAGCCGGAGGAA。

3. preservation of

The strain SDAU-H is preserved in the China general microbiological culture Collection center (CGMCC) with the preservation number of CGMCC No.23810, the preservation date of 2021, 11 and 17 days, and the preservation address of No. 3 Hospital No. 1 Xilu Beijing of Chaoyang district, beijing.

Example 2

1. Test method

1.1 determination of the ability to degrade lignocellulose

CMC culture medium Congo red staining test: inoculating the strain SDAU-H to a CMC culture medium, culturing at 25 ℃ for 5 days, pouring a Congo red color developing agent into a plate containing bacterial colonies, carrying out color development reaction for 15min, pouring the color developing agent, then putting the plate into 1mol/L sodium chloride solution for 15min, eluting Congo red of a degraded part of cellulose to form a transparent ring, indicating that the corresponding bacterial strains can secrete cellulase and degrade the cellulose, measuring the diameter (D, cm) of the bacterial colonies and the diameter (D, cm) of a hydrolysis ring, and adopting Dp to represent the hydrolysis capacity Dp = (D/D) 2. If the ratio of the diameter of the transparent ring to the diameter of the bacterial colony is larger, the cellulose degradation capability of the bacteria is stronger.

PDA-guaiacol colour development test: inoculating the strain SDAU-H into a PDA-guaiacol culture medium, culturing at 25 ℃ for 5 days, observing whether colorless guaiacol can be oxidized into reddish brown by laccase, if reddish brown oxidation rings are generated, three fungi can generate laccase, measuring the colony diameter (D, cm) and the hydrolysis ring diameter (D, cm), and expressing the hydrolysis capacity Dp = (D/D) 2 by adopting Dp. If the ratio of the diameter of the oxidation ring to the diameter of the bacterial colony is larger, the level of laccase production activity of the corresponding bacterial strain is judged, and then whether the bacterial strain can remove lignin is qualitatively detected.

1.2 degradation effect on orchard waste

1.2.1 preparation of solid microbial inoculum

Taking SDAU-H strain stored in laboratory from 4 deg.C refrigerator, selecting small amount of hypha, inoculating to PDA culture medium, culturing at 25 deg.C in incubator for 3-5 days, taking the place where colony edge grows vigorously, inoculating to PDA culture medium again, culturing at 25 deg.C for 5 days, and making use of punch to obtain bacterial cake with 7mm edge diameter and 2mm thickness in PDA culture medium plate. Pre-wetting and uniformly mixing apple branch/peach branch sawdust, locust manure and corncobs which are crushed into 20mm in diameter according to the mass ratio of 3.

1.2.2 degradation of orchard waste

Setting each pile of degradation material to weigh 5kg, adding 1kg of locust manure and 1kg of corn cob into each pile, adding 3kg of apple branch or peach branch sawdust, uniformly stirring, sterilizing for 30min at the temperature of 121 ℃, respectively inoculating 50wt%, 60wt% and 70wt% of solid microbial inoculums prepared by 1.2.1 and mixed with apple branches or peach branches of orchard waste degradation material according to the table 2, setting a sample without any fungi as a blank control by taking whether a decomposition agent is added as another variable, and setting 3 groups of samples in each group for repeating.

And placing the prepared orchard waste experimental group and the control group in a constant-temperature 25 ℃ constant-humidity 60% air-conditioning room, continuously degrading for 30 days, observing the degradation process change of the sample, and recording the observed physical property change of the sample.

TABLE 2 solid inoculum size and sample composition design table

Note: HC means Trichoderma harzianum SDAU-H, "/" means no decomposing agent and "+" means decomposing agent.

1.2.3 determination of pile temperature in orchard waste degradation

Detecting the central temperature change of each group of the compost samples, measuring the temperature of the compost samples at 12 pm every day by using a thermometer at intervals of 5d, and repeating three times for each group of samples by taking three sample measuring points and processing the samples to obtain the average temperature measurement value as a sample temperature value.

1.2.4 determination of waste weight before and after degradation of orchard waste

All experimental and blank samples were weighed accurately using an electronic balance after completion of inoculation and addition of the decomposing agent (noted as initial weight) at the start of the experiment, and the sample weights were weighed accurately after 30 days of degradation culture (noted as final weight) to obtain 3 sets of parallel experimental data for all experimental samples.

1.2.5 determination of lignocellulose content before and after degradation of orchard waste

And (3) measuring the contents of cellulose, lignin and hemicellulose of the samples at the beginning of degradation and after the degradation is finished, wherein the measuring method comprises the following steps:

(1) Accurately weighing 0.500g of sample weight, placing the sample in an oven at 80 ℃ to fully dry the sample until the weight is constant, transferring the sample into a triangular flask with the specification of 150mL, adding 50mL of neutral detergent, and then placing the sample in a pressure cooker to keep the sample at the high temperature of 100 ℃ for 1 hour.

(2) Using a flat-bottomed glass sand core soil (weight of which is weighed in advance and recorded as W) ₀ ) The filtration operation was performed, and the residue produced by the filtration was further washed with hot water until the pH of the washing water =7.0 or so. Continuously washing with anhydrous ethanol and acetone twice, transferring into oven, drying at 80 deg.C until the weight of the sample is constant, weighing the total weight of the filter soil and the sample, and recording as W ₁ 。

(3) And (3) transferring the sample with the filtering sand core soil in the step (2) into a 150mL beaker, continuously adding 50mL of an acidic detergent, transferring to a pressure cooker, keeping the temperature of the pressure cooker at 100 ℃ for 50min, taking out the sample, and washing the sample with warm water until the pH of the washing water is = 7.0. Washing with 95% ethanol, anhydrous ethanol and acetone twice, oven drying at 80 deg.C until the weight of the sample is constant, weighing the total weight of the filter soil and the sample, and recording as W ₂ 。

(4) Continuously completing the step (3) withTransferring a sample of the filtered sand core soil into a 150mL beaker, adding 5mL of a pre-refrigerated 75% sulfuric acid solution, placing the sample at room temperature for hydrolysis reaction for 3h, then continuously adding 45mL of distilled water, placing the sample at room temperature for overnight placement, washing the sample with distilled water the next day until the pH =7.0 of washing water, transferring the sample into an 80 ℃ oven for drying operation until the weight of the sample is kept constant, and weighing the total weight of the filtered soil and the sample and taking the total weight as W ₃ 。

(5) Finally, transferring the sample with the filtering sand core soil, which is finished in the step (4), to a muffle furnace, setting the temperature to be 550 ℃ for ashing, taking 4 hours, then cooling a dryer, weighing the sample, and recording the weight as W ₄ 。

The calculation method comprises the following steps:

cellulose percentage C1 (%) = (W) ₂ -W ₀ )-(W ₃ -W ₀ )-(W ₄ –W ₀ )]/0.500×100％；

Lignin percentage C2 (%) = (W) ₃ -W ₄ )/0.500×100％

Hemicellulose percentage content C3 (%) = (W) ₂ -W ₃ )/0.500×100％

Cellulose degradation rate (%) = (C1 at the start of degradation-sample C1 after 30 days of degradation)/C1X 100% before the start of degradation

Lignin degradation rate (%) = (C2 at the beginning of degradation-sample C2 after 30 days of degradation)/C2 × 100% before the beginning of degradation

Hemicellulose degradation rate (%) = (C3 at the start of degradation-sample C3 after 30 days of degradation)/C3 × 100% before the start of degradation

1.2.6 determination of Activity of degrading enzymes in orchard waste

Extracting strains from the sample after degradation culture, inoculating the strains into a PDB culture medium for culture at 28 ℃, culturing at 120rmp, and centrifuging at 12000rmp for 10min after culture to obtain a crude enzyme solution.

(1) And (3) xylanase activity detection:

measuring 1% xylan solution of a substrate, 10mL, preheating at 50 ℃ for 3min, adding 1mL of crude enzyme solution, fully mixing, fully hydrolyzing in a constant-temperature water bath at 50 ℃ for 50min, continuously adding 1.5mL of DNS reagent, mixing, boiling the water bath for 10min, cooling, fixing the volume of the reaction solution to 20mL, and placing the sample at a position with the wavelength of lambda =540nm to measure the absorbance value.

Drawing a standard curve: taking 6 colorimetric tubes of 20mL, numbering 1-6, sequentially adding 0, 0.2, 0.4, 0.6, 0.8 and 1.0mL of xylose standard solution of 1mg/mL, 2.0, 1.8, 1.6, 1.4, 1.2 and 1.0mL of distilled water, adding 1.5mL of DNS reagent, fully cooking in boiling water for 5mL, cooling, adding distilled water to a constant volume of 20mL, shaking uniformly, standing for 20min, and measuring the absorbance value at the position of wavelength lambda =540 nm.

(2) And (3) cellulase activity determination:

the cellulase measured in the experiment is glycosidase (CMC), a substrate 1% glucose solution is measured in 10mL, the solution is preheated for 3min at 50 ℃, 1mL of a mixed solution of a crude enzyme solution and a CMC buffer solution is added, the solution is fully hydrolyzed for 60min at 40 ℃ in a constant-temperature water bath, 1.5mL of LDNS reagent is continuously added for mixing, the solution is boiled in the water bath for 10min, the volume of the reaction solution is determined to be 20mL after cooling, and a sample is placed at the position with the wavelength of lambda =540nm to measure the absorbance value.

Drawing a standard curve: taking 8 colorimetric tubes of 20mL, numbering 1-8, sequentially adding glucose standard solution of 1mg/mL of 0, 0.2, 0.4, 0.6, 0.8, 1.0, 1.2 and 1.4mL, distilled water of 2.0, 1.8, 1.6, 1.4, 1.2, 1.0, 0.8 and 0.6mL, adding DNS reagent of 1.5mL, fully cooking in boiling water for 5mL, cooling, adding distilled water to reach a constant volume of 20mL, shaking uniformly, standing for 20min, and measuring the absorbance value at the wavelength of lambda =540 nm.

1.2.7 determination of content of related nutrient elements before and after degradation of orchard waste

The method comprises the steps of measuring potassium element by using a flame photometer, measuring phosphorus element by using a spectrophotometer, measuring nitrate nitrogen by using a spectrophotometer and measuring ammonium nitrogen by using a spectrophotometer.

1.2.7.1 flame photometer method for determining potassium element

(1) 1mol/L neutral NH ₄ OAc solution: weighing chemically pure CH ₃ COONH ₄ 77.09 And g, dissolving the mixture in distilled water, and transferring the dissolved mixture into a 1L volumetric flask to reach a constant volume of nearly 1L. With HOAc and NH ₄ OH adjusted pH =7.0, then diluted to 1L.

(2) Potassium standard solution: accurately weighing dried analytical pure KCl 1.9068g, dissolving in water, fixing the volume to 1L, and shaking up to obtain the product containing potassium 1000mg/L. Sucking 25mL of the solution, and shaking up in a 250mL volumetric flask with constant volume to obtain a standard solution containing 100mg/L of potassium.

(3) And (3) determination of a sample: weighing 5g of soil sample by a hundredth balance, putting the soil sample into a 150mL plastic leaching bottle, and adding 50mL of neutral NH by a pipette ₄ And (3) vibrating the OAc solution on a vibrator for 30 minutes after a bottle cap is covered, taking out the solution, carrying out dry filtration, putting the filtrate in a small triangular flask, measuring the filtrate and a potassium standard series on a flame photometer, recording the reading of a galvanometer, checking out the corresponding concentration on a standard curve, and calculating the quick-acting potassium content of the soil according to a formula.

(4) Drawing a standard curve: 100mg/LK standard solution is respectively prepared into 5, 10, 20, 30 and 50mg/L K standard series solution in a 100mL volumetric flask, and 1mol/L neutral ammonium acetate solution is used for constant volume. Firstly, 50mg/LK standard solution is used for flame photometer spray combustion, the grating is adjusted to make the scale of galvanometer have maximum reading, and then all levels of standard solution are measured in sequence. And recording the reading of the galvanometer, and finally drawing a standard curve by taking the concentration as an abscissa and the reading of the galvanometer as an ordinate on the checkered paper.

1.2.7.2 Spectrophotometer method for determining phosphorus element

(1) 0.5mol/L sodium bicarbonate solution: 42g of chemically pure sodium bicarbonate is weighed and dissolved in 800mL of distilled water. After cooling, the pH value is adjusted to 8.5 by 0.5mol/L sodium hydroxide solution, the solution is washed into a 1000mL volumetric flask, the volume is fixed to the scale, and the solution is stored in a reagent bottle.

(2)7.5mol/L 1/2H ₂ SO ₄ Molybdenum antimony stock solution: about 400mL of distilled water was taken and placed in a 1000mL beaker, the beaker was immersed in cold water, and then 208.3mL of analytically pure concentrated sulfuric acid was slowly injected, stirred continuously, and cooled to room temperature. Separately, 20g of analytically pure ammonium molybdate was weighed, dissolved in 200mL of distilled water at 50 ℃ and cooled. Then slowly pouring the sulfuric acid solution into the ammonium molybdate solution, continuously stirring, then adding 100mL of 0.5% antimony potassium tartrate solution, diluting to 1000mL by using distilled water, shaking up, and storing in a brown reagent bottle.

(3) Molybdenum antimony anti-mixed color developing agent: 1.5g of L-ascorbic acid is added into 100mL of molybdenum-antimony stock solution, the mixture is shaken up and stored in a reagent bottle, and the solution is prepared as before.

(4) Phosphorus (P) standard solution: accurately weighing 0.2197g of analytically pure potassium dihydrogen phosphate which is dried for 4-8 hours at the temperature of 45 ℃ into a small beaker, dissolving the analytically pure potassium dihydrogen phosphate in a small amount of distilled water, completely washing the solution into a 1000mL volumetric flask, fixing the volume to a scale by using the distilled water, and fully shaking the solution uniformly, wherein the solution is a standard solution containing 50mg/L phosphorus. Accurately sucking 50mL of the solution, diluting with distilled water to a constant volume of 500mL, shaking up to obtain a 5mg/L phosphorus standard solution (the solution cannot be stored for a long time), and preparing according to a standard curve system during color comparison.

(5) 0.5mol/L sodium hydroxide solution: 20g of sodium hydroxide was dissolved in 1000mL of distilled water, shaken up, and left to stand for use.

(6) Soil leaching: weighing 5g of air-dried soil which passes through 1mm sieve pores by using a hundredth balance, placing the air-dried soil into a 250mL plastic leaching bottle, accurately adding 100mL of 0.5mol/L sodium carbonate solution, adding one spoon of phosphorus-free activated carbon, covering, oscillating on an oscillator for 30 minutes, filtering by using dry phosphorus-free filter paper, and taking the filtrate into a 100mL dry triangular flask.

(7) And (3) measuring phosphorus in the solution to be measured: sucking 10mL of filtrate into a 50mL volumetric flask, then slowly adding 5mL of molybdenum antimony sulfate anti-mixing color development agent along the wall of the volumetric flask, fully shaking up, discharging carbon dioxide, adding distilled water to the scale, and fully shaking up again. After 30 minutes of standing, the colorimetric determination was carried out on a spectrophotometer using light having a wavelength of 660nm and 1cm through a cuvette. The color stabilization time was 24 hours. The colorimetric assay was performed in parallel with a blank test (i.e., the test solution was replaced with 0.5mol/L sodium bicarbonate reagent, and the other steps were the same as above). And (4) finding out the content of phosphorus in the solution to be detected according to the measured extinction value and a standard curve, and then calculating the content of available phosphorus in the soil.

(8) Drawing a standard curve: 0, 1, 2, 3, 4 and 5mL of the phosphorus standard solution of 5mg/L are respectively sucked into a volumetric flask of 50mL, and 10mL of sodium bicarbonate solution of 0.5mol/L are added one by one. Slowly adding 5mL of molybdenum antimony sulfate anti-mixed color developing agent along the wall of the volumetric flask, fully shaking up, discharging CO ₂ Then, adding distilled water to a constant volume to scale, and fully shaking up. This seriesThe concentrations of phosphorus in the solution are respectively 0, 0.1, 0.2, 0.3, 0.4 and 0.5mg/L. Standing for 30 minutes, and then carrying out color comparison with the same liquid to be detected. And drawing a standard curve on the paper grid by taking the solution concentration as the horizontal coordinate and the reading of the optical density as the vertical coordinate.

Determination of nitrogen element-nitrate nitrogen by 1.2.7.3 spectrophotometer method

(1) Nitrate standard stock solution, 0.1mg/mL: 0.1631g of potassium nitrate which has been dried at 105-110 ℃ for 1h are weighed and dissolved in distilled water. Transfer into 1000mL volumetric flask and dilute to the mark and shake well. This solution 1.00mL contained 0.10mg nitrate.

(2) Nitrate standard solution, 10.0 μ g/mL: 10.00mL of the nitrate standard stock solution (100. Mu.g/mL) was pipetted into a 100mL volumetric flask, diluted to the mark with distilled water and shaken well. This solution 1.00mL contained 10.0. Mu.g nitrate.

(3) Drawing a standard curve: accurately dividing 0, 10.0, 20.0, 50.0, 100, 200, 400, 600, 800 and 1000 mu g of nitrate radical standard solution into a series of 100mL volumetric flasks, diluting to 50mL with distilled water, and carrying out color comparison.

(4) A fresh soil sample corresponding to 10.00g of dry soil is weighed to be accurate to 0.01g, placed in a 200mL triangular flask, added with 100mL of potassium chloride solution, plugged, and shaken on a shaker for 1h. The suspension was taken out and left to stand (about 30 min), and the suspension was filtered with filter paper, and a certain amount of supernatant was taken up for analysis. The filtrate was stored in a refrigerator for future use.

Measuring absorbance A of the leaching solution at 220nm and 275nm ₂₂₀ And A ₂₇₅ . The corrected absorbance a was calculated as follows:

A＝A ₂₂₀ -fA ₂₇₅ (f is 2.0)

The nitrate nitrogen in the leach liquor was removed by the method of the literature "Norman R J, edberg J C, stucki J W.determination of nitrate in Soil extract by dual-wall ultra violet spectrometry [ J ]. Soil Science Society of American Journal Abstract,1985,49 (5): 1182-1185", the absorbance of the treated solution at 220nm and 275nm was measured, and the ratio of the two was calculated as f. After a correlation curve between the A value and the nitrate nitrogen concentration is established, the nitrate nitrogen concentration in the leaching liquor can be calculated.

1.2.7.4 determination of Nitrogen-ammonium Nitrogen by Spectrophotometer method

(1) 2mol/LKCl solution: 149.1g of KCl was weighed and dissolved in 1L of water.

(2) Phenol solution. 10g of phenol and 100mg of sodium nitroprusside are weighed and diluted to 1L. The reagent was unstable and had to be stored in brown bottles in a refrigerator at 4 ℃. Note that sodium nitroprusside is extremely toxic!

(3) Sodium hypochlorite alkaline solution: 10g of NaOH, 7.06g of disodium hydrogen phosphate, 31.8g of sodium phosphate and 10mL of sodium hypochlorite (52.5 g/L) were weighed out, dissolved in water, diluted to 1L, stored in a brown bottle and stored in a refrigerator at 4 ℃.

(4) Masking agent: 400g/L of potassium sodium tartrate was mixed in equal volumes with 100g/L of disodium EDTA salt solution. 0.5mL of 10mol/L sodium hydroxide solution was added to 100mL of the mixture.

(5) 2.50. Mu.g/mL ammonium Nitrogen (NH) ₄ ⁺ -N) standard solution: weighing dry ammonium sulfate 0.4717g, dissolving in water, washing in volumetric flask, dissolving to 1L, preparing into storage solution containing ammonium nitrogen 100 μ g/mL, diluting with water 20 times before use, and preparing into standard solution containing ammonium nitrogen (N) 5 μ g/mL.

(6) And (4) leaching. A fresh soil sample corresponding to 10.00g of dry soil is weighed to be accurate to 0.01g, placed in a 200mL triangular flask, added with 100mL of potassium chloride solution, plugged, and shaken on a shaker for 1h. Taking out and standing for about 30min, and sucking a certain amount of supernatant for analysis after the suspension of the soil and the potassium chloride is clarified.

(7) And (5) measuring the absorbance. Absorbing 2-10 mL of soil leachate, putting the soil leachate into a 50mL volumetric flask, supplementing 10mL with potassium chloride solution, then sequentially adding 5mL of phenol solution and 5mL of sodium hypochlorite alkaline solution, and shaking up. After standing at room temperature of about 20 ℃ for 1 hour, 1mL of masking agent was added to dissolve a precipitate which may be generated, and then the precipitate was dissolved to the scale with water. The absorbance was read by colorimetry using a 1cm cell at a wavelength of 625 nm.

(8) Working curve. Respectively suck 0.00mL,0.50mL,1.00mL,2.00mL,3.00mL,4.00mL and 5.00mLNH ₄ ⁺ -N standard solutions in 50mL volumetric flasks, 10mL each of potassium chloride solution, afterAnd (4) carrying out colorimetric determination. The concentration of each bottle of standard solution is 0mg/L,0.05mg/L,0.1mg/L,0.2mg/L,0.3mg/L,0.4mg/L and 0.5mg/L in ammonium state.

1.3 data processing

All experiments were set up with 3 sets of parallel experiments, data were averaged using software SPSS 22.0 and standard deviations were calculated, and Duncan's were used to analyze the significance of differences between treatments. All data plots were made with Origin 8.5 software.

2. Test results

2.1 degradation ability of lignocellulose

2.1.1 ability to degrade cellulose

The results of the determination of the cellulose degrading ability of Trichoderma harzianum SDAU-H are shown in Table 3, and it can be seen that Trichoderma harzianum SDAU-H has the ability to degrade cellulose.

TABLE 3 degradation ability of cellulose

2.1.2 Lignin-degrading ability

The results of the measurement of the lignin-degrading ability of Trichoderma harzianum SDAU-H are shown in Table 4, and Trichoderma harzianum SDAU-H can be seen to have the lignin-degrading ability.

TABLE 4 degradation ability of lignin

Note: the different lower case letter representations after the same column of values differ significantly at the P <0.05 level

2.2 degradation of orchard waste

2.2.1 degradation results of peach Branch waste

The results of observing the degradation change of peach tree branch waste after 30 days of degradation by each test group designed according to table 2 are shown in fig. 1.

In the blank control group (figure 1) without any bacteria, obvious white colonies can be observed when the samples are degraded and cultured for 25 days, mainly because peach branches are rotten and changed along with the degradation time of fermentation to show degradation physical properties.

As can be seen from fig. 2 to 7, the growth of colonies on the sample after degradation for 20 days was significant in the case of the inoculated 50% sample with the addition of the decomposing agent. When the decomposing inoculant exists, the growth of the trichoderma harzianum on the peach branch waste is the most vigorous, and the growth state of the trichoderma harzianum is not obviously influenced by the inoculation amount of the trichoderma harzianum. With the increase of the inoculation degree, the trichoderma harzianum does not show a remarkable increase trend of the growth process.

2.2.2 degradation results on apple Branch waste

Compared with other samples inoculated with fungi, the degradation process of the apple branch waste is obviously slower under the condition that strains are not inoculated, and obvious bacterial colonies do not appear until 25 days (figure 8), the reason for the degradation process is mainly analyzed because the apple branch is not easy to generate the fungi for degrading cellulase, and the currently shown bacterial colony condition is the result of competitive growth of various floras in the waste after the apple branch is fermented for a period of time.

From FIGS. 9 to 13, it can be seen that in the sample inoculated with 50%, the sample inoculated with Trichoderma harzianum showed significant colonies on the 20 th day of culture after addition of the decomposing agent, while the sample without the decomposing agent showed significant colonies on the 11 th day of degradation, indicating that the addition of the decomposing agent did not significantly promote the growth of 50% Trichoderma harzianum inoculated in apple tree branch waste. For inoculation of 60% trichoderma harzianum, the degradation of the sample tends to be the same as that of 50% inoculation, and the growth of the strain is not promoted by the addition of the decomposing agent. 70% of the inoculated samples show no remarkable degradation promoting phenomenon due to the addition of the decomposing agent, and on the contrary, the colony growth state of the samples without the addition of the decomposing agent is more remarkable. With the increase of the inoculation amount, the colony growth of the trichoderma harzianum shows a descending trend, namely the growth of the trichoderma harzianum is more vigorous when the inoculation amount is less, which indicates that the colony growth is more favorable when the inoculation amount is less in the apple tree branch waste environment.

2.3 Effect on orchard waste degradation temperature

2.3.1 Effect on degradation temperature of peach Branch waste

The effect of Trichoderma harzianum SDAU-H on the degradation temperature of peach branch waste is shown in FIGS. 14-16. Inoculating the materials of Trichoderma harzianum SDAU-H, and reducing the metabolic strength of microorganisms along with the consumption of easily decomposed substances at the high-temperature stage of composting to cause temperature reduction.

2.3.2 Effect on Stacking temperature of apple Branch waste

The effect of Trichoderma harzianum SDAU-H on apple tree branch waste windrow temperature is shown in FIGS. 17-19. In the apple branch waste material pile added with the decomposing agent, after degradation culture for one week, the temperature fluctuation of the material pile inoculated with the trichoderma harzianum is more remarkable than that of the trichoderma harzianum apple branch material pile not added with the decomposing agent, when the inoculation amount is 50%, the growth quantity of colonies of the trichoderma harzianum in the apple branch waste material reaches saturation, the colonies are in the process of rapidly degrading organic matters after being cultured for one week, the reduction of surrounding nutrient substances can lead the trichoderma harzianum to compete with necessary nutrient substances for growth, so that the quantity of moulds is reduced, when the quantity of the moulds reaches saturation again, the colonies continue to carry out vigorous degradation reaction, and the circulation is repeated, so that the condition of large fluctuation range of the temperature of the material pile is generated. Compared with a material pile without the decomposing agent, the trichoderma harzianum material pile added with the decomposing agent can aggravate organic matter degradation reaction of other microbial colonies due to the existence of the decomposing agent, and the nutrient consumption in the waste material pile is more obvious, so that the colony saturation of trichoderma harzianum is in a changing state, the organic matter degradation exothermic reaction process is disturbed, and the temperature fluctuation is large.

2.4 degrading enzyme Activity

2.4.1 degrading enzyme activity of Trichoderma harzianum SDAU-H in peach branch waste

The enzyme activities of xylanase and CMC in peach tree branch waste of Trichoderma harzianum SDAU-H are shown in figures 20 and 21 respectively, and Trichoderma harzianum can improve the enzyme activity of degrading enzyme.

2.4.2 degrading enzyme Activity of Trichoderma harzianum SDAU-H in apple Branch waste

The enzyme activities of xylanase and CMC in apple tree branch waste of Trichoderma harzianum SDAU-H are shown in figure 22 and figure 23 respectively, and Trichoderma harzianum can improve the enzyme activity of degrading enzyme.

2.5 quality Change before and after degradation of waste orchard Branch

2.5.1 Mass Change before and after degradation of peach Branch waste

By weighing the weight of all samples before and after degradation, the degradation degree of trichoderma harzianum SDAU-H on the stock can be analyzed from the mass reduction of the peach branch waste stock. As can be seen from fig. 24, when the inoculation amount was 60%, the amount of the compost to which the decomposing agent was added was reduced by more than 10%.

2.5.2 quality Change before and after degradation of apple Branch waste

Analyzing the quality reduction of the apple tree branch waste stack, and further analyzing the degradation of the stack by trichoderma harzianum SDAU-H. As can be seen from fig. 25, the weight reduction rate gradually increased with the increase in the inoculation amount, and the weight reduction rate of the stockpile to which the decomposing agent was added was high as a whole.

2.6 Change in lignocellulose content in Branch waste

As can be seen from fig. 26, the degradation rates of cellulose, hemicellulose and lignin by trichoderma harzianum were 32%, 21% and 28%, respectively, and trichoderma harzianum exhibited stronger degradation effects on cellulose.

2.7 determination of content of relevant nutrient elements before and after degradation of orchard waste by Trichoderma harzianum SDAU-H

2.7.1 Effect of Trichoderma harzianum SDAU-H on Potassium content in compost

The content change of potassium element in peach branch compost and apple branch compost is respectively shown in fig. 27 and fig. 28, the content of potassium basically has no change trend, the content of potassium in the branch compost is always between 58.6 and 58.7, the change is very slight, and the trichoderma harzianum SDAU-H and the presence or absence of a decomposing agent are proved to have no effect on the content of potassium in the branch compost of peach trees and apple trees.

2.7.2 Effect of Trichoderma harzianum SDAU-H on phosphorus content in compost

The content change of phosphorus element in peach branch compost and apple branch compost is shown in figure 29 and figure 30 respectively, and the content of phosphorus is in a rising trend.

Influence of 2.7.3 Trichoderma harzianum SDAU-H on nitrate nitrogen content in compost

The content change of nitrate nitrogen in peach branch compost and apple branch compost is shown in figure 31 and figure 32 respectively, nitrate nitrogen is basically not contained in the compost, the content of nitrate nitrogen treated by trichoderma harzianum and a decomposing agent is a positive value, and trichoderma harzianum can play a role of degradation to influence the content of nitrate nitrogen.

Influence of 2.7.4 Trichoderma harzianum SDAU-H on ammonium nitrogen content in compost

The content of ammonium nitrogen in peach branch compost and apple branch compost is shown in fig. 33 and 34, respectively, and the peach branch compost treated by trichoderma harzianum is basically free of ammonium nitrogen before and after the compost.

In conclusion, the Trichoderma harzianum shows higher degradation efficiency on the fibers, and the degradation rate of the Trichoderma harzianum on the fibers in waste piles reaches 32%; the addition of the decomposition maturing agent can obviously improve the growth speed of the colony inoculated with the trichoderma harzianum, and the decomposition maturing agent has a certain promotion effect on the trichoderma harzianum when degrading to generate nitrogen elements.

The above-described embodiments are merely illustrative of the preferred embodiments of the present invention, and do not limit the scope of the present invention, and various modifications and improvements of the technical solutions of the present invention can be made by those skilled in the art without departing from the spirit of the present invention, and the technical solutions of the present invention are within the scope of the present invention defined by the claims.

Sequence listing

<110> Shandong university of agriculture

<120> Trichoderma harzianum strain and application thereof in degradation of waste orchard branches

<160> 1

<170> SIPOSequenceListing 1.0

<210> 1

<211> 587

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

tggggcttca ctcccaaccc aatgtgaacg ttaccaaact gttgcctcgg cgggatctct 60

gccccgggtg cgtcgcagcc ccggaccaag gcgcccgccg gaggaccaac caaaactctt 120

tttgtatacc ccctcgcggg ttttttataa tctgagcctt ctcggcgcct ctcgtaggcg 180

tttcgaaaat gaatcaaaac tttcaacaac ggatctcttg gttctggcat cgatgaagaa 240

cgcagcgaaa tgcgataagt aatgtgaatt gcagaattca gtgaatcatc gaatctttga 300

acgcacattg cgcccgccag tattctggcg ggcatgcctg tccgagcgtc atttcaaccc 360

tcgaacccct ccggggggtc ggcgttgggg atcggccctg cctcttggcg gtggccgtct 420

ccgaaataca gtggcggtct cgccgcagcc tctcctgcgc agtagtttgc acactcgcat 480

cgggagcgcg gcgcgtccac agccgttaaa cacccaactt ctgaaatgtt gacctcggat 540

caggtaggaa tacccgctga acttaagcat atcaaaagcc ggaggaa 587

Claims (10)

1. Trichoderma harzianum (Trichoderma harzianum) SDAU-H is characterized in that the Trichoderma harzianum is preserved in the China general microbiological culture Collection center (CGMCC No. 23810), the preservation date is 2021 years, 11 months and 17 days, and the preservation address is No. 3 of Xilu No. 1 Beijing Hokko sunward area north Chen.

2. A microbial agent comprising the trichoderma harzianum of claim 1.

3. A method for preparing a microbial agent according to claim 2, comprising the steps of: uniformly mixing the wood chips of the branches of the fruit trees, the locust manure and the corncobs, sterilizing, then inoculating the trichoderma harzianum of claim 1, and culturing to obtain the microbial agent.

4. The method according to claim 3, wherein the fruit tree branch chips are apple tree branch chips or peach tree branch chips.

5. The preparation method according to claim 3, wherein the mass ratio of the fruit tree branch wood chips, the locust manure and the corncobs is 3.

6. The method according to claim 3, wherein the culturing is carried out at 25 ℃ for 20 to 30 days.

7. Use of trichoderma harzianum according to claim 1 or a microbial agent according to claim 2 for degrading waste branches of orchards.

8. Use according to claim 7, wherein the waste branches are apple or peach branches.

9. A method for degrading abandoned branches in an orchard is characterized by comprising the following steps:

(1) Preparing a microbial agent according to the method of any one of claims 3-6;

(2) Uniformly mixing the wood chips of the branches of the fruit trees, the locust manure and the corncobs, sterilizing, inoculating the microbial agent prepared in the step (1), and performing composting degradation.

10. The method for degrading waste branches in orchards according to claim 9, wherein in the step (2), the inoculation amount of the microbial agent is 50-70% of the total weight of the fruit tree branch wood chips, the locust manure and the corncobs.

Images