CN113967188A

CN113967188A - Preparation method and application of bamboo leaf fermentation filtrate

Info

Publication number: CN113967188A
Application number: CN202111501341.3A
Authority: CN
Inventors: 叶琳琳; 陈志雄; 周安坤
Original assignee: Hangzhou Yayan Cosmetics Co ltd
Current assignee: Hangzhou Yayan Cosmetics Co ltd
Priority date: 2021-12-10
Filing date: 2021-12-10
Publication date: 2022-01-25
Anticipated expiration: 2041-12-10
Also published as: CN113967188B

Abstract

The invention discloses a method for preparing bamboo leaf fermentation filtrate, which comprises the following steps: drying folium Bambusae, and pulverizing to obtain folium Bambusae powder; weighing 1g of bamboo leaf powder and 2 +/-0.1 g of glucose, adding 100ml of distilled water, and sterilizing to obtain a fermentation substrate; inoculating activated Saccharomyces cerevisiae to YPD liquid culture medium, and shake culturing at 28 + -0.5 deg.C for 24+ -2 hr to obtain seed solution; inoculating the seed solution into fermentation medium, adjusting pH to 5.5 + -0.5, fermenting at 28 + -0.5 deg.C for 3 + -0.5 days in shaking table, centrifuging the obtained fermentation product, and filtering the supernatant to obtain folium Bambusae fermentation filtrate. The application of the bamboo leaf fermentation filtrate is as follows: it is used for whitening skin, enhancing skin barrier, relieving inflammation, and caring skin.

Description

Preparation method and application of bamboo leaf fermentation filtrate

Technical Field

The invention relates to the field of biology, in particular to a preparation method and application of bamboo leaf fermentation filtrate.

Background

Bamboo belongs to the subfamily of Gramineae bamboo, bamboo resources in China are abundant and various, and more than 40 bamboo resources belong to more than 400 bamboo resources [1 ]; wherein the planting area of the moso bamboo accounts for about one third of the total area of the bamboo, but the utilization rate is very low [2 ]. According to the detailed record of the compendium of materia medica, bamboo leaves, bamboo shavings, bamboo roots and the like have rich medicinal and edible values, and provide important resources for developing traditional Chinese medicines, health products and skin care products. With the development of biotechnology and modern medicine in recent years, the development and utilization of bamboo leaves have been further improved [3 ]. Research reports that bamboo leaves contain rich bamboo leaf flavone, polysaccharide, amino acid and various trace elements [4 ]. Pan-precession and other researches show that the bamboo leaf flavone as a natural antioxidant has better capacity of eliminating superoxide anions and hydroxyl radicals [5 ]; the research of Wangcheng et al shows that the bamboo leaf flavone nano particles act on B16 cells, the tyrosinase activity in the cells can be obviously inhibited, the generation of melanin is inhibited, and the whitening effect is superior to that of beta-arbutin [6] when the concentration is 100 mg/mL. Researches on Huangsaijin and the like show that the bamboo leaf polysaccharide can obviously reduce lipid peroxidation of mice in experimental groups, and improve the activities of SOD and GSH-px, which shows that the bamboo leaf polysaccharide has a certain anti-aging effect [7 ]. Studies of Zhang Ying and the like show that bamboo leaves contain rich amino acid resources, such as Glu, Asp and the like, and special amino acid delta-OH-Lys in the bamboo leaves has higher antioxidant activity than Lys [8 ]. In a word, a large number of researches show that the active ingredients in the bamboo leaves have biological effects of resisting oxidation, resisting free radicals, resisting aging, whitening and the like.

In the skin care industry, fermented cosmetics become another hot spot after natural plants extract cosmetics, such as the sea blues puzzle, SK-II magical water and the like, and are popular with consumers because of the remarkable skin care effect [9 ]. China has abundant Chinese herbal medicine resources, and a lot of researches report that the Chinese herbal medicines are fermented by microorganisms to obtain the raw materials of the cosmetics with remarkable skin care effect. Zhao Dan and the like utilize wine yeast to ferment lucid ganoderma, and the obtained lucid ganoderma fermentation liquid has the anti-aging and whitening effects [10 ]; caipid et al have studied that fermentation broth of yeast fermented jasmine has significant whitening effect [11 ].

The patent of CN112913370A discloses a bamboo leaf fermentation liquid: the pH value of the bamboo leaf fermentation liquor is 2-5, and the bamboo leaf fermentation liquor is prepared by the method comprising the following steps: according to the weight portion, 3 to 5 portions of bamboo leaf fragments with the grain diameter of 10 to 20 microns, 10 to 15 portions of water and 1 to 3 portions of sugar are put into a fermentation tank and are evenly mixed; stirring at least once per day at 20-35 deg.C, fermenting for 10-15 days to obtain folium Bambusae fermentation liquid, and diluting 50-150 times; the application is to repair the soil degradation of the open-air bamboo forest.

The references referred to are as follows:

[1] the characteristics of the bamboo forest type and geographical distribution in China, bamboo research, 1990(04): 1-16.

[2] Liyangjun, permit, Zhang Qisheng, Jiansheng, China's bamboo processing industry status quo and strategy analysis [ J ]. forestry engineering bulletin, 2016,1(01): 2-7.

[3] The physiological functions and extraction process of bamboo leaf flavone from Quincchun tea, Liu Tree, Chunzhu and bamboo leaf are 2007(04) 59-62.

[4] Yue Yongde, Gaoyai, Tangfeng, bamboo extract and its utilization research progress [ J ] Anhui agriculture university bulletin 2007(03): 328) 333.

[5] Pan Ching, Zhang Shiying, He Ming Ting, Zhu Meng Ling, the study of the extraction process and the antioxidant property of the total flavone of bamboo leaves [ J ]. Chinese food science, 2012,12(03): 39-44.

[6] The whitening effect of the bamboo leaf flavone nanoparticles based on the B16 melanoma cell evaluation system [ J ] fine chemical engineering, 2016,33(12): 1375-one 1380.

[7] Sauvin, Yi' e Wu, Gong lamp, plum blossom, lophatherum gracile polysaccharide research on anti-aging effect [ J ] modern food technology, 2015,31(11): 51-55.

[8] Existence of special amino acids of Zhang Ying, Dingxialin, Wangshengying and bamboo leaves and biological significance thereof [ J ]. university of Wuxi light industry, 1997(01): 31-34.

[9] Gonghui, the current situation and the prospect of the Chinese microecological skin care product are analyzed [ J ] daily chemical science 2020,43(09): 1-4.

[10] Zhao Dan, xu Dan Ni, Wang Dong winter, Chan, Li Meng, Wang Chang Tao the ingredient detection and whitening and anti-aging efficacy evaluation of Ganoderma lucidum fermentation liquor [ J ] daily chemical industry, 2016,46(04): 226-.

[11] A composite yeast-fermenting composition for whitening and moistening skin and its application are CN105434323A P2016-03-30.

[12] Research on the influence and action pathway of sodium dodecyl sulfate on keratinocyte gene expression in Zhao Dan, Suning, Chan Jia Chan, Li Meng, HoTong, Wang Chang, daily chemical industry, 2016,46(06): 334-.

[13] Shiyang, Wanglichuan, Mazalin, Knoxia, old military, Zhao Ming, Yunnan Siberian solomonseal rhizome extract component and activity determination and cytotoxicity evaluation [ J ] daily chemical industry, 2020,50(11): 788-.

[14] Wu Yongxiang, Bishufeng, Jiangwei, Zhendae, jin has Zhen and jin Tai is complete, the influence of mulberry bark polyphenol on melanin generation in B16 cell and its mechanism [ J ] Chinese pharmacology report, 2018,34(09): 1296-fold wine.

[15] Wangyangheng, Lianyanhui, Sun Badong, Ligusticum wallichii extract whitening double-target activity research [ J ] daily chemical industry 2020,50(04): 249-254.

[16]Maeda K,Fukuda M.Invitro effectiveness of several whitening cosmetic components in human melanocytes.J Soc Cosmet Chem.1991；42(6):361-368。

[17] Hu zhen, in spring water, research on skin barrier function progresses [ J ]. journal of chinese clinician (electronic edition), 2013,7(07):3101 and 3103.

[18] Luning, Liuyufeng, Wanggang, Zhang Hailong, Zhao Xiaodong, human keratinocyte culture experimental study [ J ] Chinese cosmetic medicine, 2004(05): 522-doped 524+ 641.

[19] Batista DI, Perez L, Orfali RL, et al, Profile of skin barrier proteins (filaggrin, claudins 1 and 4) and Th1/Th2/Th17 cytokines in adults with atomic formation [ J ]. J Eur acid Dermatol Veneol, 2015,29(6): 1091-.

[20] Park J, Jekarl DW, Kim Y, et al. novel FLG null mutations in Korea tissues with atomic peaks and complexion of the fractional spectra in Asian peaks [ J ]. J Dermatol,2015,42(9):867 DW 873(Park J, Jekarl, Kim Y, DW al. comparison of mutations in Korean atopic dermatitis FLG with Asian population mutation profiles [ J ]. J Dermatol,2015,42(9):867 FLG 873).

[21] Yang YL, Chang CH, Huang CC, Liu HW.anti-inversion and anti-apoptosis effects of pearl extract gel on UVB irradiation HaCaT cells. biomed Mater Eng.2015; 26Suppl 1: S139-45.doi:10.3233/BME-151299 PMID:26405901(Yang YL, Chang CH, Huang CC, Liu HW. Pearl extract gel on anti-inflammatory and anti-apoptotic effects of UVB irradiation on HaCaT cells Biomed Mater Eng.2015; 26Suppl 1: S139-45.doi:10.3233/BME-151299 PMID: 26405901).

[22] BERNHOFER L P, SEIBERG M, MARTIN K M. the influx of the response of the systems to the topical application of the consumer products by the epithelial mesenchymal interaction [ J ]. Toxicolog in Vitro, 1999, 13(2): 219-229 (BERNHOFER L P, SEIBERG M, MARTIN K M. skin equivalent System effects on the response of topically applied consumer products by epithelial mesenchymal interaction [ J ]. Toxicolog in Vitro, 1999, 13(2): 219-229).

Disclosure of Invention

The invention aims to solve the technical problem of providing a preparation method and application of bamboo leaf fermentation filtrate.

In order to solve the technical problem, the invention provides a method for preparing bamboo leaf fermentation filtrate, which comprises the following steps:

1) preparing bamboo leaf powder

Drying folium Bambusae, and pulverizing to obtain folium Bambusae powder;

2) preparing a fermentation substrate

Weighing 1g folium Bambusae powder, 2+ -0.1 g glucose, adding 100ml distilled water, sterilizing (autoclaving at 121 deg.C for 15min), and using as fermentation medium;

namely, the seed solution is inoculated after cooling;

3) preparing a seed solution

Inoculating activated Saccharomyces cerevisiae (Saccharomyces cerevisiae single colony) into YPD liquid culture medium, and shake culturing at 28 + -0.5 deg.C for 24+ -2 hr to obtain seed solution (bacterial liquid concentration is about 1.8-2.2 × 10)⁸CFU/ml)；

4) Preparing bamboo leaf fermentation filtrate

Inoculating the seed solution obtained in the step 3) into the fermentation substrate obtained in the step 2) according to the inoculation amount of 9-11% (preferably 10%) by volume fraction, adjusting the pH value to be 5.5 +/-0.5, performing shake fermentation at the temperature of 28 +/-0.5 ℃ for 3 +/-0.5 days, centrifuging the obtained fermentation product, and filtering the supernatant obtained by centrifugation to obtain a bamboo leaf fermentation filtrate.

Description of the drawings: the fermentation filtrate was clear in appearance, pale yellow-green in color, and had a special odor.

The improvement of the preparation method of the bamboo leaf fermentation filtrate of the invention comprises the following steps:

the concentration of the seed liquid is (1.8-2.2) x10⁸CFU/ml。

The preparation method of the bamboo leaf fermentation filtrate is further improved as follows:

firstly activating the yeast to obtain the activated yeast;

the activation (strain activation) is: a ring of yeast is selected and streaked on a wort agar culture medium plate, and the strain is cultured in an aseptic incubator at the temperature of 28 +/-0.5 ℃ until a single colony is grown.

Description of the drawings: the morphological characteristics of the saccharomyces cerevisiae single colony are that the surface is smooth, moist and sticky, and an inoculating loop is easy to pick up.

the rotating speed of the shaking table in the step 3) is 220 +/-20 rpm;

the rotating speed of the shaking table in the step 4) is 220 +/-20 rpm;

the centrifugation of the step 4) is 10000 +/-1000 rpm for 9-11 minutes.

in the step 1): cleaning Phyllostachys Pubescens leaf (Phyllostachys Pubescens leaf), oven drying at 50 + -10 deg.C for 3 + -0.5 days, pulverizing in pulverizer until sieving with 40 mesh sieve to obtain folium Bambusae powder.

The invention also provides the application of the bamboo leaf fermentation filtrate prepared by any one of the methods: it is used for whitening skin, enhancing skin barrier, relieving inflammation, and caring skin.

The invention takes the bamboo leaf fermentation filtrate as a research object, takes keratinocyte and B16 melanoma cell as a research model, and discusses the skin whitening, skin barrier enhancing and anti-inflammatory skin care effects of the bamboo leaf fermentation filtrate. CCK8 experiment shows that the bamboo leaf fermentation filtrate has no toxicity to keratinocytes and B16 melanoma cells; the determination of the melanin content in B16 cells by a sodium hydroxide cracking method shows that the bamboo leaf fermentation filtrate can obviously reduce the melanin content in the cells (p is less than 0.001); the construction of a sodium dodecyl sulfate damage keratinocyte model shows that the bamboo leaf fermentation filtrate can promote the mRNA expression of filaggrin (p is less than 0.001) and inhibit the mRNA expression of TNF-alpha and IL-6 in cells (p is less than 0.001 and p is less than 0.01).

Therefore, the invention provides a certain experimental basis for the application of the bamboo leaf fermentation filtrate in whitening, moisturizing, anti-inflammatory and other effects of cosmetics, and also provides a reference for improving the utilization rate of the added value of the moso bamboo.

Drawings

The following describes embodiments of the present invention in further detail with reference to the accompanying drawings.

FIG. 1 shows the proliferation of keratinocytes (a) and B16 melanocytes (B) by the fermentation filtrate of bamboo leaves;

FIG. 2 shows the effect of the bamboo leaf fermentation filtrate on the synthesis of melanin by B16 melanocytes;

abscissa "10" in fig. 1 and 2^-1、10^-2、10^-3"refers to the dilution factor of the bamboo leaf fermentation liquor;

FIG. 3 is a graph of the effect of bamboo leaf fermentation filtrate on keratinocyte morphology;

in fig. 3:

(a) blank control group, (b) SLS model group, and (c) bamboo leaf fermentation filtrate experimental group;

FIG. 4 is a graph of the effect of bamboo leaf fermentation filtrate on filaggrin gene expression in keratinocytes;

FIG. 5 is a graph showing the effect of bamboo leaf fermentation filtrate on the expression of inflammation-related genes in keratinocytes.

Detailed Description

The invention will be further described with reference to specific examples, but the scope of the invention is not limited thereto:

in the following cases, the ingredients used are all available in conventional commercial forms.

And (3) saccharomyces cerevisiae: china center for the Collection of Industrial microorganisms, accession number CICC 31105.

The main equipment comprises: UV-35000 model double light speed ultraviolet visible spectrophotometer: shanghai Ling analytical instruments, Inc.; shaking the incubator: shanghai wettability Biotech Co., Ltd.

The culture medium used comprises:

1. wort agar medium:

weighing 40g of wort agar, adding into 1000ml of distilled water, boiling to dissolve, packaging, and sterilizing at 121 deg.C under high pressure (0.1MPa) for 15 min. When the temperature is reduced to about 40 ℃, the sterilized petri dish is poured on a sterile operating platform, and the plate is inverted after 1 hour.

2. Yeast extract peptone glucose medium (YPD liquid medium):

10g of yeast extract and 20g of peptone were weighed into 900ml of water, sterilized at 115 ℃ under high pressure for 15min, and then 100ml of an aqueous glucose solution (containing 20g of glucose) was added.

Example 1, preparation of bamboo leaf fermentation filtrate, the following steps were sequentially performed:

1) preparing bamboo leaf powder

The preparation method comprises the steps of cleaning Phyllostachys radiata leaves, drying in a 50 ℃ oven for 3 days, crushing in a crusher until the leaves pass through a 40-mesh sieve, and collecting the leaves to obtain the bamboo leaf powder.

2) Preparing a fermentation substrate

Weighing 1g of bamboo leaf powder and 2g of glucose, adding 100ml of distilled water, carrying out autoclaving at 121 ℃ for 15min, and cooling to room temperature to obtain a fermentation substrate; standby;

the fermentation substrate is used for inoculating seed liquid.

3) Preparing a seed solution

3.1), strain activation:

and (3) selecting a ring of saccharomyces cerevisiae liquid on a wort agar culture medium plate for streaking, and culturing in an aseptic incubator at 28 ℃ until a single colony grows out (about 24 hours), wherein the single colony of the saccharomyces cerevisiae has the morphological characteristics of smooth surface, wetness, viscosity and easy picking of an inoculating ring.

3.2) selecting activated single colony of the saccharomyces cerevisiae, inoculating the single colony to a YPD liquid culture medium, and culturing for 24 hours at 28 ℃ in a shaking table (the rotating speed is 220rpm) to obtain a seed solution, wherein the concentration of the bacterial solution is about 2 multiplied by 10⁸CFU/ml。

3.3), performing liquid microscopic examination on seeds:

sucking 10uL of the seed liquid obtained in the step 3.2) by using a sterile pipettor to prepare a water-immersed sheet, and observing the shape of the yeast under a high-power microscope; the yeast morphology at this time was a single morphology, i.e., oval with evidence of budding.

Therefore, it can be seen that the seed liquid obtained in step 3.2) has a uniform shape, no other bacteria, and a concentration of about 2 × 10⁸CFU/ml, so that the method can be used for preparing fermentation liquor in the subsequent steps.

4) Preparing bamboo leaf fermentation filtrate

Inoculating the seed solution obtained in the step 3.2) into the fermentation substrate obtained in the step 2) according to the inoculation amount of 10%, adjusting the pH value to 5.5, and fermenting for 3 days in a shaking table (the rotating speed is 220rpm) at 28 ℃ to obtain a fermentation product.

Collecting the fermentation product, centrifuging for 10min under the centrifugation condition of 10000rpm, collecting the supernatant, and filtering the supernatant by filter paper to obtain the fermentation filtrate.

The fermentation filtrate was clear in appearance, pale yellow-green in color, and had a special odor.

Determination of the active substance concentration in the fermentation filtrate

Measurement of flavone content in fermentation filtrate

Taking 10.0mg of dried rutin sample, and diluting to 100ml by using 30% ethanol water solution for later use; respectively measuring the standard solutions 0.0ml, 1.0ml, 2.0ml, 4.0ml, 6.0ml and 8.0ml in a 25ml volumetric flask, and adding 30% ethanol water solution for proper dilution; transferring 1ml of 5% NaNO prepared in advance into a volumetric flask₂The solution was shaken and left for 5min, immediately after which 1ml of 10% Al (NO) was added₃)₃Oscillating the aqueous solution until the system is uniform, and standing at room temperature for 5 min; 10ml of 1.0mol/L sodium hydroxide solution is respectively dripped into the system, shaken up and kept stand for 10 minutesAnd (3) min, fixing the volume by using 30% ethanol water solution, standing for 5min, measuring the absorbance of the solution at 510nm, at least parallelly measuring each sample for 3 times, and taking a 0.0mL solvent bottle as a blank reference. And drawing a standard curve by taking the absorbance as a horizontal coordinate and the concentration of rutin as a vertical coordinate.

Taking appropriate amount of raw materials, diluting with about 4ml 30% ethanol water solution, dissolving, transferring to 25ml volumetric flask, adding certain amount of 5% NaNO₂Oscillating the aqueous solution until the system is uniform, standing the aqueous solution for 5min at room temperature, and then dropwise adding 10% Al (NO)₃)₃Changing color of the solution, shaking and standing for 5 min; and after the system completely reacts, adding 10ml of 1mol/L NaOH aqueous solution, oscillating until the system is completely uniform, standing for 10min, adding 30% ethanol aqueous solution after complexation is finished, fixing the volume and standing for 5 min. Transferring a proper amount of the solution to be detected into a cuvette, taking a 30% ethanol aqueous solution (without a sample) as a blank control, measuring the absorbance of the solution by using an ultraviolet spectrophotometer, measuring each sample in parallel for 3 times, recording the absorbance of each time, and substituting the absorbance into a standard curve equation to calculate the concentration of the total flavone in the sample.

The results obtained were: the concentration of total flavonoids in the fermentation filtrate obtained in example 1 was 129.77 ug/mL. The extraction rate of flavone is 1.39%.

The extraction rate (%) of flavone is C (concentration of flavone) × V (total volume of extractive solution) ÷ m (mass of bamboo powder) × 100

Second, measuring polysaccharide content in fermentation filtrate

Accurately weighing 100.0mg of anthrone reagent, dissolving with 75% sulfuric acid prepared in advance, metering to 100ml, and storing at low temperature in dark condition for use (after use within 6h, the prepared solution is yellow, and the reagent is deteriorated due to green light); preparing 1mg/ml glucose standard solution, and diluting to 0, 20ug/ml, 40ug/ml, 60ug/ml, 80ug/ml, 100ug/ml, 120ug/ml, 140ug/ml, 160ug/ml solution for use; taking 1ml of the above solution in a 10ml centrifuge tube, using 1ml of distilled water as a blank control, adding 4ml of prepared anthrone-sulfuric acid reagent in an ice bath, sealing and oscillating immediately, heating in a boiling water bath at 100 ℃ for 15min, and repeating each sample for four times. The time interval between each sample and the time when the samples are added into the boiling water bath until the reaction is finished is controlled within 8s, the samples are immediately transferred into an ice water bath after the reaction is finished and are transferred into a room temperature environment after being cooled for 5min, and the absorbance of the samples at 620nm is measured when the temperature of the system is consistent with the ambient temperature. And drawing a standard curve by taking the absorbance as an abscissa and the glucose concentration as an ordinate.

And (3) taking a proper amount of sample to dilute to a proper concentration, adding an anthrone-sulfuric acid reagent, measuring and calculating the polysaccharide content according to the standard method after the reaction is finished, and calculating the final result in terms of glucose.

The results obtained were: the fermentation filtrate obtained in example 1 had a polysaccharide content of 581.74 ug/mL. The polysaccharide extraction rate was 7.14%.

Polysaccharide extraction rate (%) ═ C (polysaccharide concentration) × V (total volume of extract liquid) ÷ m (bamboo powder mass) × 100

Thirdly, measuring the content of amino acid in the fermentation filtrate

Preparing 100ml of ninhydrin aqueous solution of 20mg/ml, and storing at low temperature in dark place (for use in situ); taking 10ml of a centrifuge tube, adding 0ug/ml, 2ug/ml, 4ug/ml, 6ug/ml, 8ug/ml, 10ug/ml, 12ug/ml, 14ug/ml, 16ug/ml and 1ml of glycine standard solution with different concentrations of 18ug/ml respectively, adding 2ml of PBS buffer solution (pH 6.0), shaking uniformly, adding 1ml of ninhydrin standard solution, heating at 100 ℃ for 30min after shaking, cooling in an ice water bath for 5min after reaction, transferring to a room temperature environment, using 0ug/ml of standard solution as a blank control, and measuring absorbance at 568nm by using an ultraviolet spectrophotometer. And (4) drawing a standard curve by taking the absorbance of the glycine as an abscissa and the concentration of the glycine as an ordinate.

Taking a proper amount of sample, adding ninhydrin aqueous solution, measuring and calculating the amino acid content according to the standard method, and calculating the final result according to glycine.

The results obtained were: the fermentation filtrate obtained in example 1 had an amino acid content of 32.23 ug/mL. The extraction rate of amino acids was 0.28%.

Amino acid extraction rate (%) ═ C (amino acid concentration) × V (total volume of extract liquid) ÷ m (bamboo powder mass) × 100

Experiment 1

1 experimental part

1.1 Primary reagents and instruments

KeratinizationCells, B16 cells, purchased from Shanghai Song Van Biotech Co., Ltd; RPMI1640 culture medium (containing double antibody) purchased from Zhejiang Senrui Biotech limited; fetal bovine serum, purchased from Hangzhou Biotechnology GmbH in Zhejiang; CCK8 kit, purchased from TargetMol; phosphate buffered saline, purchased from biotechnology limited, solebao, beijing; RNAioso Plus kit, PrimeScript^TMRT reagent Kit, TB Green qPCR, purchased from Baozi physician technology Limited; other reagents were analytically pure.

Bamboo leaf fermentation filtrate: the fermented filtrate of bamboo leaves (FBL for short) obtained in example 1;

CO₂incubator HF90, HealForce; a multifunctional microplate reader Spark, Tecan; inverted biomicroscopes, olympus; centrifuge L3-5K, Hainan Correct.

1.2 Experimental methods and results

Description, data analysis: the experimental results are all as follows

The results show that the data analysis is completed by One-Way ANOVO in GraphPad Prism 8 software after the homogeneous variance t test is adopted for comparison under different experimental conditions, and the difference of p less than 0.05 has different statistical significance.

1.2.1 cell culture and grouping

Keratinocytes (HaCaT cells) and mouse melanoma cells (B16 cells) were cultured in RPMI1640 medium (containing 1% by volume of penicillin-streptomycin and 1% by volume of fetal bovine serum) and DMEM high-sugar medium (containing 1% by volume of penicillin-streptomycin and 1% by volume of fetal bovine serum) at 37 deg.C and 5% CO, respectively₂Culturing under the condition, digesting by using 0.25% pancreatin when the cell fusion degree reaches 70% -80%, counting by using a blood counting chamber, and finally preparing a cell suspension with a certain concentration for inoculating on a cell culture dish for passage.

The keratinocyte cell assay is divided into three groups: blank control group, model group, experimental group; the blank control group cell is not treated, the model group cell is treated with lauryl sodium sulfate (SLS) with the concentration of 85ug/mL for 4h, the experimental group cell is treated with bamboo leaf fermentation liquid (FBL obtained in example 1 is diluted by 100 times) with a certain concentration for 24h, the sample is discarded and washed twice with sterile PBS, and finally treated with lauryl sodium sulfate (SLS) with the concentration of 85ug/mL for 4h [12 ]. For carrying out the following 1.2.4.

1.2.2 viability assay of HaCaT cells and B16 cells

Diluting the FBL obtained in the example 1 by PBS buffer solution into 10 times, 100 times and 1000 times, thereby obtaining bamboo leaf fermentation liquor with gradient concentration;

cell proliferation was measured by the CCK8 experiment, and the appropriate concentration of the bamboo leaf fermentation broth was selected for the subsequent experiments. Taking HaCaT cells and B16 cells in logarithmic growth phase, wherein the density is (3-5) x10⁴Each/ml, plated separately on 96-well cell culture plates at 37 ℃ with 5% CO₂Cultured overnight under the conditions. Adding 10 μ L of gradient bamboo leaf fermentation liquid, and adding 5% CO at 37 deg.C₂After 24 hours under the conditions of (1), 10. mu.L of CCK8 reagent was added and incubated for 2-4 hours (incubation conditions of 5% CO at 37 ℃)₂) As experimental group.

The use of the bamboo leaf fermentation liquor is cancelled, and the rest is equal to the experimental group and is used as a control group;

blank wells were used as zeroing wells (to exclude background interference);

the absorbance at 450nm of each well was measured using a microplate reader. The cell proliferation rate was calculated as follows [13 ]:

the cytotoxicity of the bamboo leaf fermentation filtrate was measured as follows:

the proliferation rates of the HaCaT and B16 cells after being treated by FBLs with different concentrations for 24 hours are shown in figures 1(a) and (B), and it can be seen from figure 1(a) that after the FBLs are diluted ten times, the cells have obvious proliferation promoting effect on the HaCaT cells, the cell activity reaches 138.4% (p is less than 0.01), the statistical significance is achieved, and the FBLs with other concentrations have no proliferation promoting effect or toxicity on the HaCaT cells; it can be seen from FIG. 1(B) that none of the FBLs at different concentrations promoted proliferation of B16 cellsAnd also has no toxicity, and it is required to indicate that the morphology of HaCaT cells and B16 cells is not changed under the action of FBL at different concentrations; when the cell viability is less than 80%, it can be said that the sample is toxic to the cells [ 15%]From fig. 1, it can be seen that under the FBL action, the viability of both cells is above 100%, and 10 was selected in the subsequent efficacy experiment^-3g/mL is taken as the experimental concentration, and in conclusion, the FBL is preliminarily judged to have certain safety as a natural skin care raw material through analysis.

1.2.3 determination of the amount of melanin in B16 cells

Determination of intracellular melanin content by sodium hydroxide lysis [14]Taking B16 cells in logarithmic growth phase, with density of (3-5) × 10⁴Per ml, plated on 96-well cell culture plates at 37 ℃ with 5% CO₂Cultured overnight under the conditions. Adding 10 μ L of gradient bamboo leaf fermentation liquid, setting five groups in parallel, acting for 24h, removing supernatant, washing with sterilized PBS for 3 times, adding 150 μ L of 1N NaOH (containing 10% DMSO), mixing with pipette, reacting in 80 deg.C water bath for 40min to obtain experimental group.

blank wells were used as zeroing wells (to exclude background interference);

and finally, measuring the light absorption value at 405nm on a microplate reader. The relative melanin content was calculated as follows:

the effect of the bamboo leaf fermentation filtrate on the melanin content in the B16 cells is as follows:

the relative melanin content is shown in figure 2.

Mouse B16 melanoma cells are similar to the metabolic process of human melanocytes in synthesizing melanin, so the cells are mostly used as models when screening whitening-related raw materials in vitro. Arbutin, VC, and the like are commonly used whitening raw materials in current cosmetics, but they are found to have great toxicity to cells at high concentration [16], so the development of the current whitening raw materials not only focuses on whitening effect, but also considers the toxicity to cells, i.e., safety. From the above toxicity test of FBL on B16 cells, it was found that both high and low FBL concentrations had no effect on B16 cell proliferation, and FBL was relatively safe as a raw material for skin-whitening cosmetics. As can be seen from fig. 2, after FBL is diluted by one hundred times and acts on B16 cells for 24 hours, the melanin content in the cells is reduced to 63.81% of that in the blank control group, and the difference is very significant (p is less than 0.001) compared with the blank control group, so that FBL can significantly reduce the melanin content in B16 cells, and it can be presumed that FBL has a certain whitening effect as a skin-care whitening raw material.

1.2.4 RNA extraction and fluorescent quantitative PCR

Taking cells in logarithmic growth phase, the density is 5X 10⁴Each/ml, spreading on 6-well cell culture plate, wherein the total volume of each well is 2 ml; the cells were divided into three groups, blank control (cells without any treatment), SLS (SLS at 85ug/mL for 4h), FBL (FBL at a certain concentration for 24h, then SLS at 85ug/mL for 4h), RNAiso for total RNA extraction, and PrimeScript for purification^TMThe RT reagent Kit reversely converts RNA into cDNA, adds SYBR, primers and a cDNA template, and then carries out real-time fluorescence quantitative PCR reaction, wherein the reaction program is a two-step method, and the specific program is as follows: pre-denaturation at 95 ℃ for 30 s; PCR was carried out at 95 ℃ for 5s and 60 ℃ for 30s for 40 cycles. The primer sequence is FLG-F: TGAAGCCTATGACACCACTGA, FLG-R: TCCCCTACGCTTTCTTGTCCT; TNF- α -F GAGGCCAAGCCCTGGTATG, TNF- α -R: CGGGCCGATTGATCTCAGC, respectively; IL-6-F: CCTGAACCTTCCAAAGATGGC, IL-6-R: TTCACCAGGCAAGTCTCCTCA.

The evaluation results of the anti-inflammatory efficacy of the bamboo leaf fermentation liquid are as follows:

sodium lauryl sulfate is a surfactant commonly found in the cosmetic industry that disrupts the barrier function of the skin epidermis and initiates skin inflammation through the TNF-alpha signaling pathway, ultimately resulting in increased expression of the proinflammatory factor IL-6 [21 ]. In the experiment, an inflammation model is manufactured by SLS with a certain concentration, and as can be seen from figure 5, the mRNA expression levels of TNF-alpha and IL-6 in an SLS model group are obviously higher than those in a blank control group (p is less than 0.001 and p is less than 0.01), the result is consistent with the research conclusion of BERNHOFER and the like [22], while the mRNA expression levels of TNF-alpha and IL-6 in an FBL group are obviously lower than those in the SLS model group (p is less than 0.001 and p is less than 0.01); therefore, FBL can inhibit the gene expression of TNF-alpha and IL-6 in cells, relieve the inflammatory reaction of keratinocytes, and protect cells damaged by SLS, and it is preliminarily presumed that FBL has an anti-inflammatory effect as a cosmetic raw material.

The results of the study of bamboo leaf fermentation filtrate to enhance skin barrier are as follows:

keratinocytes are located in the epidermal layer of the skin and play an important role in the skin barrier function [17 ]. FIG. 3 is a morphological diagram of HaCaT cells under an inverted microscope (eyepiece 10x, objective 20 x); (a) the cells in the figure are not treated, the normal HaCaT cell growth mode is adherent growth, the outline is clear, the shape is flat and polygonal, and the refractivity is good [18 ]; (b) the cells in the graph are treated by SLS with the concentration of 85ug/mL for 4h, and the number of adherent cells is obviously smaller than that of the cells in the graph (a is less, the shape of part of the cells is changed into a strip shape, the outline is fuzzy, and more particles can be seen inside and outside the cells), (c) the cells in the graph are firstly treated by bamboo leaf fermentation liquor with certain concentration for 24h, then the sample is discarded, and then washed twice by sterile PBS, and finally treated by sodium dodecyl sulfate (SLS) with the concentration of 85ug/mL for 4h, and at the moment, HaCaT cells are not different from the graph in number or shape from the graph in the graph (a).

Filaggrin is one of keratinocyte differentiation proteins, and is expressed mainly in the granular layer and the stratum lucidum. Batista et al showed that filaggrin expression was significantly lower in atopic dermatitis patients than in normal humans [19 ]; Kabashima-Kubo et al found that a decrease in the expression level of silk polyprotein resulted in skin barrier dysfunction [20 ]. From FIG. 4, it can be seen that the mRNA expression level of the silk fibroin of the SLS model group is significantly lower than that of the blank control group (p < 0.01), while the mRNA expression level of the silk fibroin of the FBL group is significantly higher than that of the SLS model group (p < 0.001), which is consistent with the cell morphology observed under an inverted microscope, and the analysis preliminarily speculates that the FBL has the efficacy of strengthening the skin barrier function.

In summary, the following conclusions can be drawn:

the bamboo leaf fermentation filtrate has no toxicity when acting on keratinocytes and B16 melanocytes, both cells show higher activity, and the bamboo leaf fermentation filtrate has certain safety; through the experiment of measuring the melanin content, the bamboo leaf fermentation filtrate can obviously inhibit the generation of melanin in B16 cells, which shows that the bamboo leaf fermentation filtrate has certain whitening effect; the keratinocyte injury model is prepared by lauryl sodium sulfate with a certain concentration, the cell morphology of an experimental group added with the bamboo leaf fermentation filtrate is obviously better than that of a control group, the gene expression level of silk fibroin is also obviously higher than that of the control group, and the gene expression levels of inflammatory factors TNF-alpha and IL-6 are also obviously lower than that of the control group, so that the bamboo leaf fermentation filtrate has certain effects of enhancing the skin barrier and resisting inflammation.

The inventors have also conducted the following comparative tests:

comparative example 1, bamboo leaves ethanol extraction (prior art),

weighing about 3g of ground bamboo leaf powder, adding 90ml of 50% ethanol water solution (v/v), adjusting the ultrasonic power to 600W, performing ultrasonic treatment for 30min, setting the ultrasonic temperature to 40 ℃, and performing ultrasonic extraction experiments after parameters are set. After the ultrasonic treatment is finished, cooling to room temperature, filtering, and washing with a small amount of ultrapure water for multiple times; mixing filtrates, distilling under reduced pressure to remove all ethanol and part of water, filtering again after the chlorophyll in the bottle is precipitated, washing with ultrapure water for a few times, and mixing filtrates; refrigerating; centrifuging for 25-35min at 12000r/min according to chlorophyll content, collecting supernatant (yellow, slightly green) after centrifuging to obtain pigment precipitate. The obtained product was subjected to the experiment according to the above method, and compared with the fermentation of bamboo leaves of the present invention, as shown in table 1 below.

TABLE 1

	Bamboo leaf ethanol extraction (extraction rate)	Bamboo leaf fermentation (extraction rate)
			Amino acids	0.15％	0.28％
Flavone	1.16％	1.39％
			Polysaccharides	3.69％	7.14％

Comparative example 2, 3 parts of bamboo leaf pieces with a particle size of 10 μm to 20 μm, 10 parts of water and 1 part of sugar were put into a fermentation tank and mixed uniformly; stirring at least once a day at 20-35 deg.C, fermenting for 15 days, and extracting the amino acids, flavones and polysaccharides with far lower extraction rate than that obtained by extracting folium Bambusae with ethanol.

Comparative example 3, the amount of glucose in the fermentation substrate was changed to 3g, and the rest was the same as in example 1. The contents of total flavone, polysaccharide and amino acid in the obtained fermentation filtrate are all inferior to the result obtained in example 1, but are also superior to the result obtained by ethanol extraction of bamboo leaves, which shows the importance of the glucose concentration set by the invention.

Finally, it is also noted that the above-mentioned lists merely illustrate a few specific embodiments of the invention. It is obvious that the invention is not limited to the above embodiments, but that many variations are possible. All modifications which can be derived or suggested by a person skilled in the art from the disclosure of the present invention are to be considered within the scope of the invention.

Sequence listing

<110> Yayan Yan cosmetics Co Ltd

Preparation method and application of bamboo leaf fermentation filtrate

<160> 6

<170> SIPOSequenceListing 1.0

<210> 1

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

tgaagcctat gacaccactg a 21

<210> 2

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

tcccctacgc tttcttgtcc t 21

<210> 3

<211> 19

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

gaggccaagc cctggtatg 19

<210> 4

<211> 19

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

cgggccgatt gatctcagc 19

<210> 5

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

cctgaacctt ccaaagatgg c 21

<210> 6

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 6

ttcaccaggc aagtctcctc a 21

Claims

1. The preparation method of the bamboo leaf fermentation filtrate is characterized by comprising the following steps:

1) preparing bamboo leaf powder

Drying folium Bambusae, and pulverizing to obtain folium Bambusae powder;

2) preparing a fermentation substrate

Weighing 1g of bamboo leaf powder and 2 +/-0.1 g of glucose, adding 100ml of distilled water, and sterilizing to obtain a fermentation substrate;

3) preparing a seed solution

Inoculating activated Saccharomyces cerevisiae to YPD liquid culture medium, and shake culturing at 28 + -0.5 deg.C for 24+ -2 hr to obtain seed solution;

4) preparing bamboo leaf fermentation filtrate

Inoculating the seed solution obtained in the step 3) into the fermentation substrate obtained in the step 2) according to the inoculation amount of 9-11% of the volume fraction, adjusting the pH value to 5.5 +/-0.5, fermenting for 3 +/-0.5 days at 28 +/-0.5 ℃ in a shaking table, centrifuging the obtained fermentation product, and filtering the supernatant obtained by centrifuging to obtain a bamboo leaf fermentation filtrate.

2. The method for preparing a bamboo leaf fermentation filtrate according to claim 1, wherein:

the concentration of the seed liquid is (1.8-2.2) x10⁸CFU/ml。

3. The method for preparing a bamboo leaf fermentation filtrate according to claim 1 or 2, characterized in that:

firstly activating the yeast to obtain the activated yeast;

the activation is as follows: a ring of yeast is selected and streaked on a wort agar culture medium plate, and the strain is cultured in an aseptic incubator at the temperature of 28 +/-0.5 ℃ until a single colony is grown.

4. The method for producing a bamboo leaf fermentation filtrate according to claim 3, wherein:

the rotating speed of the shaking table in the step 3) is 220 +/-20 rpm;

the rotating speed of the shaking table in the step 4) is 220 +/-20 rpm;

the centrifugation of the step 4) is 10000 +/-1000 rpm for 9-11 minutes.

5. The method for producing a bamboo leaf fermentation filtrate according to claim 4, wherein:

in the step 1): cleaning Phyllostachys Pubescens leaf, oven drying at 50 + -10 deg.C for 3 + -0.5 days, and pulverizing in pulverizer until it passes through 40 mesh sieve to obtain folium Bambusae powder.

6. Use of a bamboo leaf fermented filtrate obtained by the method according to any one of claims 1 to 5, characterized in that: it is used for whitening skin, enhancing skin barrier, relieving inflammation, and caring skin.