CN113736864A - Method for rapidly identifying purity of hybrid seeds of green Chinese onions - Google Patents
Method for rapidly identifying purity of hybrid seeds of green Chinese onions Download PDFInfo
- Publication number
- CN113736864A CN113736864A CN202111053005.7A CN202111053005A CN113736864A CN 113736864 A CN113736864 A CN 113736864A CN 202111053005 A CN202111053005 A CN 202111053005A CN 113736864 A CN113736864 A CN 113736864A
- Authority
- CN
- China
- Prior art keywords
- purity
- green chinese
- kasp
- plate
- pcr reaction
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
- 238000000034 method Methods 0.000 title claims abstract description 35
- 244000295724 Allium chinense Species 0.000 title claims abstract description 28
- 235000016790 Allium chinense Nutrition 0.000 title claims abstract description 28
- 239000003550 marker Substances 0.000 claims abstract description 4
- 238000005119 centrifugation Methods 0.000 claims description 9
- 244000257727 Allium fistulosum Species 0.000 claims description 8
- 235000008553 Allium fistulosum Nutrition 0.000 claims description 8
- 239000000203 mixture Substances 0.000 claims description 7
- 238000000137 annealing Methods 0.000 claims description 6
- 238000004925 denaturation Methods 0.000 claims description 6
- 230000036425 denaturation Effects 0.000 claims description 6
- 239000002773 nucleotide Substances 0.000 claims description 5
- 125000003729 nucleotide group Chemical group 0.000 claims description 5
- 241000234282 Allium Species 0.000 claims description 4
- 235000002732 Allium cepa var. cepa Nutrition 0.000 claims description 3
- VYPSYNLAJGMNEJ-UHFFFAOYSA-N Silicium dioxide Chemical compound O=[Si]=O VYPSYNLAJGMNEJ-UHFFFAOYSA-N 0.000 claims description 3
- 238000004458 analytical method Methods 0.000 claims description 3
- 238000003556 assay Methods 0.000 claims description 3
- 238000001816 cooling Methods 0.000 claims description 3
- 238000001704 evaporation Methods 0.000 claims description 3
- 239000007788 liquid Substances 0.000 claims description 3
- 238000012257 pre-denaturation Methods 0.000 claims description 3
- 239000000741 silica gel Substances 0.000 claims description 3
- 229910002027 silica gel Inorganic materials 0.000 claims description 3
- 238000010790 dilution Methods 0.000 claims description 2
- 239000012895 dilution Substances 0.000 claims description 2
- 230000008020 evaporation Effects 0.000 claims description 2
- 238000007865 diluting Methods 0.000 claims 1
- 244000291564 Allium cepa Species 0.000 abstract description 3
- 238000012408 PCR amplification Methods 0.000 abstract description 3
- 238000002474 experimental method Methods 0.000 abstract description 3
- 239000000523 sample Substances 0.000 description 9
- 238000005516 engineering process Methods 0.000 description 4
- 239000003147 molecular marker Substances 0.000 description 4
- 108010044467 Isoenzymes Proteins 0.000 description 3
- 238000009395 breeding Methods 0.000 description 3
- 230000001488 breeding effect Effects 0.000 description 3
- 238000001514 detection method Methods 0.000 description 3
- 230000007613 environmental effect Effects 0.000 description 3
- 238000010791 quenching Methods 0.000 description 3
- 230000000171 quenching effect Effects 0.000 description 3
- 239000000243 solution Substances 0.000 description 3
- 241000196324 Embryophyta Species 0.000 description 2
- 241000234280 Liliaceae Species 0.000 description 2
- 238000011161 development Methods 0.000 description 2
- 239000007850 fluorescent dye Substances 0.000 description 2
- 238000012252 genetic analysis Methods 0.000 description 2
- 230000008774 maternal effect Effects 0.000 description 2
- 210000000056 organ Anatomy 0.000 description 2
- 230000008775 paternal effect Effects 0.000 description 2
- 125000006853 reporter group Chemical group 0.000 description 2
- 230000000844 anti-bacterial effect Effects 0.000 description 1
- 230000009286 beneficial effect Effects 0.000 description 1
- 150000001720 carbohydrates Chemical class 0.000 description 1
- 239000003153 chemical reaction reagent Substances 0.000 description 1
- 238000001962 electrophoresis Methods 0.000 description 1
- 230000002068 genetic effect Effects 0.000 description 1
- 229910052500 inorganic mineral Inorganic materials 0.000 description 1
- 238000004519 manufacturing process Methods 0.000 description 1
- 239000000463 material Substances 0.000 description 1
- 230000007721 medicinal effect Effects 0.000 description 1
- 239000011707 mineral Substances 0.000 description 1
- 238000012986 modification Methods 0.000 description 1
- 230000004048 modification Effects 0.000 description 1
- 108090000623 proteins and genes Proteins 0.000 description 1
- 102000004169 proteins and genes Human genes 0.000 description 1
- 238000013094 purity test Methods 0.000 description 1
- 230000006641 stabilisation Effects 0.000 description 1
- 238000011105 stabilization Methods 0.000 description 1
- 235000013311 vegetables Nutrition 0.000 description 1
- 239000011782 vitamin Substances 0.000 description 1
- 229940088594 vitamin Drugs 0.000 description 1
- 229930003231 vitamin Natural products 0.000 description 1
- 235000013343 vitamin Nutrition 0.000 description 1
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6858—Allele-specific amplification
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/13—Plant traits
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Analytical Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Biotechnology (AREA)
- Molecular Biology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Immunology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Genetics & Genomics (AREA)
- Biochemistry (AREA)
- Microbiology (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Botany (AREA)
- Mycology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses an identification method of green Chinese onion hybrid seeds, in particular relates to a method for quickly identifying the purity of green Chinese onion hybrid seeds, particularly tries to identify the purity of F1 generation seeds from known parents and parents, and belongs to the technical field of seed identification. A method for rapidly identifying the purity of hybrid seeds of green Chinese onion adopts KASP marker to identify the purity of hybrid seeds of green Chinese onion. The invention only needs to extract the total DNA of the scallion to carry out batch PCR amplification and then carry out batch experiments, thereby saving a great deal of manpower and being especially applied to the operation of a great number of samples. The method can conveniently, quickly and accurately identify the purity of the hybrid seeds of the green Chinese onions.
Description
Technical Field
The invention relates to an identification method of hybrid seeds of green Chinese onions, in particular to a method for quickly identifying the purity of hybrid seeds of green Chinese onions, which is particularly used for identifying the purity of F1 seeds by trial of known parents and belongs to the technical field of seed identification.
Background
The herba Alii Fistulosi is a two-and three-year-old herbaceous plant with enlarged pseudostem and tender leaf composed of leaf sheath of Allium of Liliaceae (Liliaceae). Is native to western China and Russian Siberian, and is an important spicy and health-care vegetable in China. The green Chinese onions have more than 2000 years of cultivation history in China, and are more commonly cultivated in the north. The pseudostem and tender leaf of herba Alii Fistulosi are tender, contain saccharide, protein, minerals and vitamins, and have antibacterial and medical effects. The scallion seeds are generally hybrid varieties, and the purity is one of important indexes for identifying the seed quality.
The common methods for identifying the crop varieties mainly comprise methods of seed morphology identification, field planting morphology identification, isoenzyme electrophoresis technology identification and the like. The seed morphology identification method is easily influenced by environmental conditions, and the accuracy of the identification result is poor; the field planting shape identification has the technical problems of long period, high cost and large workload, the phenotype is easily influenced by cultivation measures and environmental conditions, the efficiency and the accuracy of variety identification are seriously influenced, and the requirements of breeding work and production operation cannot be met more and more. By utilizing the isozyme technical identification method, although the purity of the crop variety is accurate and reliable, the isozyme marker has tissue and organ specificity, the information content is very limited, and the polymorphism is not rich enough. The identification technology of the purity of the green Chinese onion seeds is also gradually developed from the traditional identification method depending on morphology to form molecular marker identification. The molecular marker technology can reveal the genetic difference between filial generation and parents on the DNA level, is not influenced by environmental conditions and cultivation measures, has no tissue, organ and development specificity, can detect tiny variation, is not limited by plant growing seasons, has rich polymorphism and high stability, and can greatly shorten the identification time. The rapid development of DNA molecular marking technology makes it possible to detect the authenticity and purity of the allium fistulosum hybrid from the genome level.
Disclosure of Invention
The invention aims to solve the technical problems, and provides a method for rapidly identifying the purity of the welsh onion hybrid, which can conveniently, rapidly and accurately identify the purity of the welsh onion.
In order to achieve the purpose, the invention is realized by the following technical scheme:
a method for rapidly identifying the purity of hybrid seeds of green Chinese onion adopts KASP marker to identify the purity of hybrid seeds of green Chinese onion.
Preferably, the method for rapidly identifying the purity of the allium fistulosum hybrid comprises the following steps:
a. extracting the DNA of the green Chinese onion to be detected;
b. sample DNA concentration is diluted and transferred to a 384PCR plate;
c. preparing a KASP PCR reaction system;
d. b, placing the prepared KASP PCR reaction system into the 384PCR plate in the step b for rapid centrifugation, and tightly covering with a silica gel cover to prevent liquid evaporation during PCR reaction;
e. putting the 384PCR plate into a PCR instrument for PCR reaction;
f. and (3) quickly centrifuging the PCR plate after the reaction is finished, scanning and analyzing by using an OMEGA F SNP typing detector, and distinguishing the onion sample to be detected after the analysis is finished.
Preferably, the DNA concentration dilution in step b is to dilute the sample DNA concentration to 30ng/ul, and the sample DNA is transferred from the 96-well plate to the 384PCR plate in the workstation.
Preferably, the KASP PCR reaction is formulated as described in step c aboveThe system comprises the following specific steps: the total volume of the reaction system was 5ul, including 2ul DNA, 2ul 2 XPAMS PRO MIX, 0.056ul KASP assay MIX, ddH20 to 1 ul.
Preferably, the PCR reaction in step e above comprises the following specific steps: putting the 384PCR plate into a PCR instrument for PCR reaction, wherein the reaction procedure comprises pre-denaturation at 95 ℃ for 10 min; denaturation at 95 deg.C for 15s, annealing at 61-55 deg.C for 45s, and cooling at 0.6 deg.C for 10 cycles; denaturation at 95 ℃ for 15s, annealing at 55 ℃ for 45s, 35 cycles.
Preferably, the nucleotide sequence of the labeled KASP-labeled primer is: no.182 (F1).
Preferably, the nucleotide sequence of the primer No.182(F1) is the primer shown in No.182(F1), No.182(F2) and No.182 (R).
Preferably, the centrifugation speed in step d is 4500r/min and the centrifugation time is 40 s.
Preferably, in the above-mentioned No.182(F1), the underlined part is a HEX fluorescent tag sequence
GAAGGTCGGAGTCAACGGATTTGCCGCCCTCTCTGTGTAA；
No.182(F2) FAM fluorescent tag sequence underlined
GAAGGTGACCAAGTTCATGCTTGCCGCCCTCTCTGTGTAG；
No.182(R):GCATTTCGTCATGGAGCTTTG。
Due to the adoption of the technical scheme, the invention has the following beneficial effects:
(1) the method is rapid and accurate: according to the invention, the scallion total DNA is extracted for batch PCR amplification and then scanned, the detection steps are completed by instrument operation, batch experiments can be carried out, a large amount of manpower is saved, the method is especially suitable for operation of a large number of samples, and the degree of purity can be detected by scanning.
(2) And (3) label stabilization: and (3) verifying 318 parts of green Chinese onion samples, wherein the molecular marker identification result is completely consistent with the genetic analysis result. In addition, the invention can finish detection only by one pair of primers, and is efficient and accurate.
(3) The invention can carry out batch, automation and standardization on the operation of identifying the purity of the hybrid seeds of the green Chinese onions, and is particularly suitable for the detection of a large number of groups of green Chinese onions.
The method can be used for quickly and accurately judging the purity of the large groups of the green Chinese onions, improves the breeding efficiency of the green Chinese onions, and has important significance for establishing a molecular marker-assisted breeding technical system of the green Chinese onions. The invention only needs to extract the total DNA of the green Chinese onion to carry out batch PCR amplification and then carry out batch experiments, thereby saving a great deal of manpower.
Drawings
FIG. 1 is a KASP purity test typing chart for identifying the purity of hybrids of Allium fistulosum according to the method of example 1.
In the figure, the upper left dot represents the maternal type, the lower right dot represents the paternal type, and the middle dot represents the heterozygous genotype.
Detailed Description
The technical solution of the present invention is further described below with reference to the accompanying drawings, but not limited thereto, and any modification or equivalent replacement of the technical solution of the present invention without departing from the spirit and scope of the technical solution of the present invention shall be covered by the protection scope of the present invention. Materials, reagents and the like used in the following examples are commercially available unless otherwise specified.
Example 1
A method for rapidly identifying the purity of a Chinese onion hybrid comprises the following specific steps:
a. extracting the DNA of the green Chinese onion to be detected;
b. sample DNA concentration was diluted to 30ng/ul and the sample DNA was transferred from 96-well plate to 384PCR plate in the workstation;
c. preparing KASP PCR reaction system with a total volume of 5ul, including 2ul DNA, 2ul 2 × PARMS PRO MIX, 0.056ul KASP assay MIX, ddH20 to 1 ul;
d. placing the prepared KASP PCR reaction system into the 384PCR plate of the step b for rapid centrifugation, wherein the centrifugation speed is 4500r/min, the centrifugation time is 40s, and the liquid is prevented from evaporating during the PCR reaction by tightly covering with a silica gel cover;
e. putting the 384PCR plate into a PCR instrument for PCR reaction, wherein the reaction procedure comprises pre-denaturation at 95 ℃ for 10 min; denaturation at 95 deg.C for 15s, annealing at 61-55 deg.C for 45s, and cooling at 0.6 deg.C for 10 cycles; denaturation at 95 ℃ for 15s, annealing at 55 ℃ for 45s, 35 cycles;
f. and (3) quickly centrifuging the PCR plate after the reaction is finished, scanning and analyzing by using an OMEGA F SNP typing detector, and distinguishing the onion sample to be detected after the analysis is finished.
The nucleotide sequence of the KASP-tagged primer described in the examples is: no.182(F1), primer sequences No.182(F1), No.182(F2) and No.182(R) are as follows:
no.182(F1) underlined is a HEX fluorescent tag sequence,
GAAGGTCGGAGTCAACGGATTTGCCGCCCTCTCTGTGTAA；
no.182(F2), the underlined part is the FAM fluorescent target sequence,
GAAGGTGACCAAGTTCATGCTTGCCGCCCTCTCTGTGTAG；
No.182(R): GCATTTCGTCATGGAGCTTTG。
the identification results are as follows:
the homozygous genotypes identified according to the method of this example 1 are shown in FIG. 1, where the upper left dot represents the maternal type, the lower right dot represents the paternal type, and the middle dot represents the heterozygous genotype. And (3) identifying 318 parts of green Chinese onion samples by a KASP marking method, wherein the PCR result is consistent with the genetic analysis result, and the marking effectiveness is indicated.
The fluorescence reporter group A adopted by the method is FAM, the fluorescence reporter group B is HEX, and the fluorescence quenching group is BHQ. The fluorescent probe A, fluorescent probe B, quenching probe A and quenching probe B were obtained from 2 XMASTER Mix (LGC).
Claims (8)
1. A method for rapidly identifying the purity of the allium fistulosum hybrid is characterized in that the purity of the allium fistulosum hybrid is identified by adopting KASP markers.
2. A method for rapidly identifying the purity of a Chinese onion hybrid is characterized by comprising the following steps:
a. extracting the DNA of the green Chinese onion to be detected;
b. sample DNA concentration is diluted and transferred to a 384PCR plate;
c. preparing a KASP PCR reaction system;
d. b, placing the prepared KASP PCR reaction system into the 384PCR plate in the step b for rapid centrifugation, and tightly covering with a silica gel cover to prevent liquid evaporation during PCR reaction;
e. putting the 384PCR plate into a PCR instrument for PCR reaction;
f. and (3) quickly centrifuging the PCR plate after the reaction is finished, scanning and analyzing by using an OMEGA F SNP typing detector, and distinguishing the onion sample to be detected after the analysis is finished.
3. The method of claim 2, wherein the DNA concentration dilution in step b is performed by diluting the sample DNA concentration to 30ng/ul, and transferring the sample DNA from a 96-well plate to a 384PCR plate in the workstation.
4. The method for rapidly identifying the purity of the hybrid seeds of green Chinese onion according to claim 2, wherein the step c of preparing the KASP PCR reaction system comprises the following steps: the total volume of the reaction system was 5ul, including 2ul DNA, 2ul 2 XPAMS PRO MIX, 0.056ul KASP assay MIX, ddH20 to 1 ul.
5. The method for rapidly identifying the purity of the welsh onion hybrid according to claim 2, wherein the PCR reaction in the step e comprises the following specific steps: putting the 384PCR plate into a PCR instrument for PCR reaction, wherein the reaction procedure comprises pre-denaturation at 95 ℃ for 10 min; denaturation at 95 deg.C for 15s, annealing at 61-55 deg.C for 45s, and cooling at 0.6 deg.C for 10 cycles; denaturation at 95 ℃ for 15s, annealing at 55 ℃ for 45s, 35 cycles.
6. The method for rapidly identifying the purity of hybrids of green Chinese onion as claimed in claim 1 or 2, wherein said primer nucleotide sequence of KASP marker is: no.182 (F1).
7. The method of claim 6, wherein the primer nucleotide sequence No.182(F1) is the primers shown in No.182(F1), No.182(F2) and No.182 (R).
8. The method as claimed in claim 2, wherein the centrifugation speed in step d is 4500r/min and the centrifugation time is 40 s.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202111053005.7A CN113736864B (en) | 2021-09-09 | 2021-09-09 | Method for rapidly identifying purity of green Chinese onion hybrid |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202111053005.7A CN113736864B (en) | 2021-09-09 | 2021-09-09 | Method for rapidly identifying purity of green Chinese onion hybrid |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN113736864A true CN113736864A (en) | 2021-12-03 |
| CN113736864B CN113736864B (en) | 2024-05-17 |
Family
ID=78737364
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202111053005.7A Active CN113736864B (en) | 2021-09-09 | 2021-09-09 | Method for rapidly identifying purity of green Chinese onion hybrid |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN113736864B (en) |
Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106834480A (en) * | 2017-02-24 | 2017-06-13 | 山东省农业科学院蔬菜花卉研究所 | A kind of KASP marks of a large amount of colony's onion cytoplasm fertilities of Rapid identification and its application |
| CN107960320A (en) * | 2017-11-23 | 2018-04-27 | 辽宁省农业科学院 | A kind of high-efficient breeding method of high-yield hybrid shallot |
| KR20200070935A (en) * | 2018-12-10 | 2020-06-18 | 한국생명공학연구원 | KASP primer set based on SNP for discriminating Korean melon cultivar and F1 hybrid purity checking and uses thereof |
| WO2020248892A1 (en) * | 2019-06-11 | 2020-12-17 | 四川农业大学 | Kasp labeled primer for detecting high molecular weight glutenin subunit dy10-m619sn of wheat, and application thereof |
| CN112251535A (en) * | 2020-11-11 | 2021-01-22 | 山东省农业科学院蔬菜花卉研究所 | KASP marker for rapidly identifying fertility of onion nuclei in large groups and application thereof |
-
2021
- 2021-09-09 CN CN202111053005.7A patent/CN113736864B/en active Active
Patent Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106834480A (en) * | 2017-02-24 | 2017-06-13 | 山东省农业科学院蔬菜花卉研究所 | A kind of KASP marks of a large amount of colony's onion cytoplasm fertilities of Rapid identification and its application |
| CN107960320A (en) * | 2017-11-23 | 2018-04-27 | 辽宁省农业科学院 | A kind of high-efficient breeding method of high-yield hybrid shallot |
| KR20200070935A (en) * | 2018-12-10 | 2020-06-18 | 한국생명공학연구원 | KASP primer set based on SNP for discriminating Korean melon cultivar and F1 hybrid purity checking and uses thereof |
| WO2020248892A1 (en) * | 2019-06-11 | 2020-12-17 | 四川农业大学 | Kasp labeled primer for detecting high molecular weight glutenin subunit dy10-m619sn of wheat, and application thereof |
| CN112251535A (en) * | 2020-11-11 | 2021-01-22 | 山东省农业科学院蔬菜花卉研究所 | KASP marker for rapidly identifying fertility of onion nuclei in large groups and application thereof |
Non-Patent Citations (1)
| Title |
|---|
| OLGA E. SCHOLTEN等: "SNP-markers in Allium species to facilitate introgression breeding in onion", 《BMC PLANT BIOLOGY》, vol. 16, no. 187, pages 1 - 10 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN113736864B (en) | 2024-05-17 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN109554503B (en) | Molecular marker for early sex identification of actinidia arguta seedlings and application of molecular marker | |
| CN109609686B (en) | Molecular marker for early sex identification of actinidia arguta seedlings and application of molecular marker | |
| CN107760789B (en) | Genotyping detection kit for parent-child identification and individual identification of yaks | |
| CN113584216B (en) | Development and application of KASP marker of wheat grain weight gene TaCYP78A16 | |
| CN107794304B (en) | Genotyping detection kit for yak individual identification and paternity test | |
| CN113355446B (en) | InDel molecular marker related to purple character of Chinese cabbage and application thereof | |
| CN113186303A (en) | Method for identifying variety of chicken | |
| CN106906303A (en) | One SNP marker for influenceing quality character of pork and its application | |
| CN113151567B (en) | SSR molecular marker and method for identifying Lepista sordida N006# strain | |
| CN112251535B (en) | KASP marker for rapidly identifying fertility of onion nuclei in large groups and application thereof | |
| CN106834480B (en) | KASP marker for rapidly identifying cytoplasm fertility of large-population welsh onion and application thereof | |
| CN108411030B (en) | Primer pair, kit containing primer pair, application of primer pair and method for detecting ecological A17 and R108 of medicago truncatula | |
| CN114561487B (en) | Method for identifying tea tree large leaflet variety by utilizing InDel molecular marker | |
| CN110878376A (en) | SSR molecular marker primer for identifying dendrobium huoshanense and application thereof | |
| CN113736864A (en) | Method for rapidly identifying purity of hybrid seeds of green Chinese onions | |
| CN113755630A (en) | Mixed sample detection method for detecting carrot seed purity based on mSNP technology | |
| CN109536633A (en) | The SNP marker and application isolated with the anti-graywall main effect QTL-qRgls2 of corn | |
| CN116397042B (en) | SNP marker related to soybean hundred grain weight and application thereof | |
| CN116814841B (en) | Primer group for identifying rice black brown glume gene HK4, and method and application thereof | |
| CN114058734B (en) | SNP molecular marker combination for detecting rape varieties and application thereof | |
| CN114107555B (en) | SNP molecular marker combination for detecting purity of wheat variety and application thereof | |
| CN114032330B (en) | SNP molecular marker for rapidly identifying apple anthracnose | |
| CN115873975B (en) | SNP molecular marker for identifying wheat powdery mildew resistance and application thereof | |
| CN110055349B (en) | Primer group for identifying conventional cotton-in-cotton institute 99001, product and detection method thereof | |
| CN113564274A (en) | EST-STS molecular marker primer of Luding lily disease-resistant related gene CAT and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |