WO2020248892A1 - Kasp labeled primer for detecting high molecular weight glutenin subunit dy10-m619sn of wheat, and application thereof - Google Patents

Abstract

Disclosed are a KASP labeled primer for detecting a high molecular weight glutenin subunit Dy10-m619SN of the wheat, and an application thereof. The KASP labeled primer comprises a forward primer F1, a forward primer F2, and a reverse primer R1; or comprises a forward primer F1, a forward primer F2, and a reverse primer R2, wherein sequences of F1, F2, R1, and R2 are as represented by SEQ ID NO. 1-SEQ ID NO. 4. The molecular labeled primer provided by the present invention can be used for identifying an SNP mutation site of a subunit Dy10 to be detected of the wheat, can determine the phenotype of the high molecular weight glutenin subunit Dy10-m619SN of the wheat according to the SNP mutation site or is used in combination with an SDS-PAGE technology to detect the phenotype of the subunit to achieve the purpose of assisting in identifying the wheat to be detected.

Description

A KASP labeled primer for detecting Dy10-m619SN subunit of wheat high molecular weight gluten and its application Technical field

The invention belongs to the technical field of molecular genetic breeding, and specifically relates to a KASP marker primer for detecting the Dy10-m619SN subunit of wheat high molecular weight gluten and its application.

Background technique

Wheat (Triticum aestivum L.) is one of the main food crops in my country and the world, and its planting area and output account for about 30% of the cereal planting area. Different from other food crops, because wheat flour contains gluten protein, it forms elastic and ductile dough after adding water and kneading. This characteristic makes wheat suitable for making various foods, such as bread, biscuits, noodles, Pastries etc. With the improvement of people's living standards, the demand for wheat products has increased rapidly, and the quality of wheat processing has attracted increasing attention.

The processing quality of wheat mainly depends on the characteristics of seed storage protein. Wheat seed storage proteins include gluten and gliadin. The research results show that the composition, content and ratio of gliadin and gluten are important factors affecting the quality of wheat processing. Gliadin is mainly a monomeric protein with weak interaction between molecules, lack of elasticity, and fluidity, which determines the viscosity and ductility of gluten. High-molecular-weight gluten subunits (HMW-GS; 80-140KD) are one of the important components of gluten, and form valleys with low-molecular-weight gluten subunits (LMW-GS; 35-51KD) through intermolecular disulfide bonds Protein polymer (GMP) determines the strength and elasticity of the dough. HMW-GS accounts for 10% of the total protein in wheat grains. It is the main genetic factor that determines the elasticity of wheat dough and has the closest relationship with wheat processing quality. Therefore, the breeding of more excellent HMW-GS is of great significance to provide usable genetic resources for wheat quality breeding.

The composition and content of HMW-GS have an important influence on processing quality. By comparing and analyzing the processing quality effects of subunit combinations, it is found that the Glu-1 allelic subunit types have different effects on processing quality. It is generally believed that the Glu-D1 subunit combination Dx5+Dy10 contributes the most to processing quality, and Glu-B1 position The point subunit combination Bx17+By18 is better than other subunits, and Glu- A1 positions 1, 2* are better subunits than Null. Dx5+Dy10 is currently recognized as the highest quality subunit combination, specific to Dy10 subunit, Kang et al. evaluated 100 wheat varieties through quantification theory and statistics, indicating that Dy10 subunit has positive significance on wheat protein quality and belongs to high-quality subunits. It is believed that the Dy10 subunit is conducive to the increase in the number of proteins; Blechl et al. used the Dy10 subunit to overexpress the transgenic strain, which increased the content of gluten polymer and reduced the ductility of the dough; Debbie et al. studied the Dy10 subunit deletion and found that Dough mixing peak time; Wang et al. studied the Dy10-m328SF subunit mutant line and found that it can increase the wet gluten content and bread volume. Therefore, the Dy10 subunit is beneficial to increase the strength of gluten and has an important impact on the processing quality of wheat.

We used EMS chemical mutagenesis to obtain a Dy10 subunit mutant of the common wheat variety Shumai 482, and named this subunit Dy10-m619SN, and then proved that the high molecular weight gluten protein Dy10-m619SN subunit of the mutant material was synthesized It can be partially cleaved during the process, and there are two Dy10 subunit bands detected by SDS-PAGE electrophoresis. For the first time, we discovered protein cleavage in wheat high-molecular-weight gluten subunits. This Dy10-m619SN subunit may provide new ideas for the study of wheat processing quality. Therefore, for this specific material, it is necessary for us to develop a molecular marker that can quickly and accurately detect its phenotype.

Molecular marker-assisted selection breeding technology uses molecular markers linked to target trait candidate genes to detect candidate genotypes through molecular biology to achieve the purpose of selecting target traits. Mainly have the advantages of simple operation, not affected by the environment and environmental interaction, and the ability to quickly and efficiently select target materials. Single Nucleotide Polymorphisms (SNP, Single Nucleotide Polymorphisms) refer to DNA sequence polymorphisms caused by the variation of a single nucleotide in the genome, including transition, transversion, deletion (deletion) ) And insertion (insertion). KASP (Competitive Allele-Specific PCR, Kompetitive Allele-Specific PCR) technology is LGC Genomics' SNPline genotyping detection program. The core of this scheme is based on the specific matching of primer end bases to type SNP. This technology only needs to synthesize two universal fluorescent probes, plus synthesize specific site-specific SNP PCR primers and a reverse universal primer, and then genotype SNP sites.

Summary of the invention

The purpose of the present invention is to provide two molecular marker primers developed based on KASP technology for the rapid identification or auxiliary identification of the SNP variant sites of the Dy10 subunit of the high molecular weight glutenin of wheat to be tested, which can be used to detect the high molecular weight of the wheat to be tested. The SNP variant site of gluten Dy10 subunit determines its Dy10-m619SN subunit phenotype, and then realizes the rapid identification of the test material or the combined use of SDS-PAGE technology to detect the subunit phenotype to assist in the identification of the test wheat and improve the Measure the efficiency of material selection, reduce work intensity and shorten the breeding period.

In order to achieve the above technical objectives, the present invention is specifically implemented through the following technical solutions:

A KASP labeled primer for detecting the Dy10-m619SN subunit of wheat high-molecular-weight gluten, said KASP labeled primer includes forward primer F1, forward primer F2 and reverse primer R1; or includes forward primer F1, forward primer F2 and reverse primer R2.

The forward primer F1 is: GAAGGTGACCAAGTTCATGCT CAGAGCAGCAAGCGGCCAA, (underline indicates FAM KASP fluorescent group);

The forward primer F2 is: GAAGGTCGGAGTCAACGGATT CAGAGCAGCAAGCGGCCAG, (the underline indicates HEX KASP fluorescent group);

The reverse primer R1 is: CCCCCTCCATCCGACACAC;

The reverse primer R2 is: GGCTAGCCGACAATGCGTCG.

In another aspect of the present invention, a method for detecting SNP variation sites of wheat high molecular weight gluten Dy10-m619SN subunit is provided, which includes the following steps:

1) Extract the DNA of the wheat sample to be tested;

2) Take template DNA, use forward primer F1, forward primer F2 and reverse primer R1/R2 for KASP PCR amplification;

3) Using Bio-Rad CFX96 ^TM PCR amplification instrument to amplify PCR products;

4) Use biology software to genotyping PCR products.

The PCR reaction program in the step (3) is: 95°C pre-denaturation for 15 minutes; the first step of the amplification reaction: 95°C denaturation for 20s, 68°C gradient annealing and extension for 60s, 10 cycles, each cycle of annealing and extension The temperature is lowered by 1°C; the second step of the amplification reaction, denaturation at 94°C for 20s, annealing and extension at 57°C for 60s, 30 cycles; storage at 15°C.

The method for identifying or assisting in the identification of the Dy10-m619SN subunit of wheat to be tested is to detect whether the SNP variant site of the wheat high molecular weight gluten Dy10 subunit to be tested is G:G, A:A or G:A. Determine the phenotype of the Dy10-m619SN subunit of wheat high molecular weight gluten.

The method for detecting whether the SNP variant site of the Dy10 subunit of the wheat high molecular weight gluten to be tested is G:G, A:A or G:A includes the following steps: PCR is performed using the genomic DNA of the wheat to be tested as a template and using the KASP primer set Amplify, scan the obtained amplified product with fluorescence signal, and judge according to the fluorescence signal. The FAM fluorescent model carries the genotype A:A, the HEX fluorescent signal carries the genotype G:G, and the two fluorescent signals carries the genotype G:A.

In another aspect of the present invention, a kit for detecting the Dy10-m619SN subunit of wheat high-molecular-weight gluten is provided. The kit comprises the above-mentioned forward primer F1, forward primer F2 and reverse primer R1 ; Or include forward primer F1, forward primer F2 and reverse primer R2.

In another aspect of the present invention, the application of the forward primer F1, forward primer F2 and reverse primer R1/R2 in detecting the Dy10-m619SN subunit of wheat high molecular weight gluten is also within the protection scope of the present invention. .

The beneficial effects of the present invention are:

The present invention develops a KASP marker special primer based on the wheat SNP variation site to be tested. Experiments have shown that the KASP marker primer of the present invention can be used to identify the SNP mutation site of the wheat high molecular weight gluten Dy10 subunit to be tested as G:G. , A:A or G:A, the phenotype of the Dy10-m619SN subunit of the high molecular weight gluten protein of the tested wheat can be determined according to the SNP variation site of the tested wheat (that is, the phenotype of the Dy10-m619SN subunit is identified by SDS-PAGE technology ).

KASP markers can be used to determine the phenotype of the next-generation high-molecular-weight gluten Dy10-m619SN subunit at the seedling stage of the material to be tested. This avoids tedious and large-scale SDS-PAGE technology detection and effectively reduces breeding costs. The workload greatly shortens the breeding process. For example: when the progeny of the tested material need multiple backcrossing or cross-purification background operations, the use of KASP markers can quickly identify the phenotype, select the desired offspring, and eliminate other individual plants, greatly reducing the workload and enhancing the breeding work Maneuverability, while saving a lot of time and shortening breeding years.

Description of the drawings

Figure 1 is the result of SDS-PAGE identification of wild-type and mutant materials; where the asterisk is the position of the high-molecular-weight gluten Dy10-m619SN subunit;

Figure 2 is the comparison result of the partial nucleotide sequence of the high molecular weight gluten Dy10 subunit of wild-type and mutant materials. The red box indicates the SNP variation site;

Figure 3 is a multiple alignment of partial nucleotide sequences of different high-molecular-weight gluten subunits, and selection of suitable positions to develop KASP molecular marker primers, the underlined indicates the position of the primer;

Figure 4 is the identification result of the molecular markers of the primer set of forward primer F1 and reverse primer R1 of the present invention. GG represents wild type Dy10, AA represents mutant Dy10-m619SN, and GA represents heterozygous type;

Figure 5 is the identification result of the molecular markers of the primer set of forward primer F2 and reverse primer R2 of the present invention. GG represents wild-type Dy10, AA represents mutant Dy10-m619SN, and GA represents heterozygous type;

Fig. 6 is the identification result of SDS-PAGE technique for the offspring of wild-type and mutant hybrids; where the asterisk is the position of the high-molecular-weight gluten Dy10 subunit band.

Detailed ways

The technical solutions of the present invention will be clearly and completely described below in conjunction with specific embodiments of the present invention. Obviously, the described embodiments are only a part of the embodiments of the present invention, rather than all the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those of ordinary skill in the art without creative work shall fall within the protection scope of the present invention.

Example 1 Obtaining primers

The phenotype of the high molecular weight gluten subunit of the tested material is shown in Figure 1 SDS-PAGE (the left side is the wild type, and the right side is the mutant type). Subsequent gene cloning and sequencing of the wild-type and mutant high-molecular-weight glutenin Dy10 subunits of the tested materials proved that the nucleotide sequences of the high-molecular-weight glutenin Dy10 subunits of the two materials had only one SNP mutation site at 1856bp ( Figure 2). In addition, other high molecular weight gluten subunits (Ax1, Dx5, Bx7, and By9) of the material to be tested were cloned and sequenced. Figure 3 shows the multiple nucleotide sequences of different high molecular weight gluten subunits. Comparison chart. According to the design principles of KASP primers, combined with the results of the high molecular weight gluten subunit nucleotide sequence alignment, select appropriate gene positions to design KASP marker primers (shown underlined in Figure 3).

Example 2 Establishment of detection method

The application steps of the molecular marker primer provided by the present invention in detecting the Dy10-m619SN subunit of wheat high molecular weight gluten to be tested, the specific experimental steps are as follows:

1) Extract the DNA of the wheat sample to be tested and dilute it to a template concentration of 100ng/μl;

2) Take 1.00μl of template DNA, 0.14μl of primer mixture, 5.00μl of KASP Master Mix, 0.08μl of 50mM MgCl ₂ solution, 3.78μl of H ₂ O, and mix well for PCR amplification (forward primer F1, positive primer in the primer mixture) The final concentration of the forward primer F2 and reverse primer R1/R2 are both 10μM);

The forward primer F1 is: GAAGGTGACCAAGTTCATGCT CAGAGCAGCAAGCGGCCAA;

Forward primer F2 is: GAAGGTCGGAGTCAACGGATT CAGAGCAGCAAGCGGCCAG;

The reverse primer R1 is: CCCCCTCCATCCGACACAC;

Or the reverse primer R2 is: GGCTAGCCGACAATGCGTCG.

3) Using Bio-Rad CFX96 ^TM PCR amplification instrument to amplify PCR products;

4) The PCR reaction program is: 95°C pre-denaturation 15min; the first step of the amplification reaction: 95°C denaturation 20s, 68°C gradient annealing and extension 60s, 10 cycles, each cycle of annealing and extension temperature is reduced by 1°C; Two-step amplification reaction, denaturation at 94°C for 20s, annealing and extension at 57°C for 60s, 30 cycles; storage at 15°C;

5) Use biological software to perform genotyping of PCR amplified products.

Example 3 SDS-PAGE technology identification and KASP marker detection were performed on the hybrid offspring of wild type and mutant respectively

F2 seeds of the hybrid offspring were tested by half-grain milling for SDS-PAGE technology. Figure 6 shows part of the F2 grain gluten test results, which contain wild type, mutant type and heterozygous type. The F2 grains detected by SDS-PAGE technology were tested for germination in a filter paper petri dish moistened with 3-5ml of distilled water, DNA was extracted, and the KASP label detection method established in (2) above was used to detect SNP mutation sites. Figure 4 and Figure 5 show the genotyping and identification results of the two markers. The results show that the KSAP test results are consistent with the SDS-PAGE results. It shows that the KASP marker of the present invention is indeed suitable for detecting the phenotype of the Dy10-m619SN subunit of the wheat high molecular weight gluten protein to be tested.

The results show that the above KASP marker can quickly and accurately detect the Dy10-m619SN subunit phenotype of the high-molecular-weight glutenin of the test material.

Although the embodiments of the present invention have been shown and described, for those of ordinary skill in the art, it will be understood that various changes, modifications, substitutions, and substitutions can be made to these examples without departing from the principle and spirit of the present invention. Variations, the scope of the present invention is defined by the appended claims and their equivalents.

Claims (7)

1. A KASP-labeled primer for detecting the Dy10-m619SN subunit of wheat high-molecular-weight gluten, wherein the KASP-labeled primer includes a forward primer F1, a forward primer F2 and a reverse primer R1, and the F1, F2 The nucleotide sequences of R1 and R1 are shown in SEQ ID NO. 1 to 3, respectively.
2. A KASP-labeled primer for detecting the Dy10-m619SN subunit of wheat high-molecular-weight gluten, wherein the KASP-labeled primer includes a forward primer F1, a forward primer F2 and a reverse primer R2, and the F1, F2 The nucleotide sequences of R2 and R2 are shown in SEQ ID NO. 1 to 2 and SEQ ID NO. 4, respectively.
3. A method for detecting the Dy10-m619SN subunit of wheat high molecular weight gluten, which is characterized in that it comprises the following steps:

   1) Extract the DNA of the wheat sample to be tested;

   2) Take template DNA, use forward primer F1, forward primer F2 and reverse primer R1/R2 for KASP PCR amplification;

   3) Use Bio-Rad CFX96TM PCR amplification instrument to amplify PCR products;

   4) Use biology software to genotyping PCR products.
4. The method for detecting the Dy10-m619SN subunit of wheat high-molecular-weight gluten to be tested according to claim 3, wherein the PCR reaction procedure in step (3) is: 95°C pre-denaturation for 15 minutes; first step of amplification Reaction: Denaturation at 95°C for 20s, gradient annealing and extension at 68°C for 60s, 10 cycles, the temperature of annealing and extension in each cycle is reduced by 1°C; the second step of the amplification reaction, denaturation at 94°C for 20s, annealing and extension at 57°C for 60s, 30 cycles; store at 15°C.
5. The method for detecting the Dy10-m619SN subunit of wheat high molecular weight gluten to be tested according to claim 3, characterized in that the SNP variation site of the Dy10 subunit of wheat high molecular weight gluten to be tested is G:G. , A:A or G:A, to determine the phenotype of the Dy10-m619SN subunit of wheat high molecular weight gluten under test.
6. A kit for detecting the Dy10-m619SN subunit of wheat high-molecular-weight gluten to be tested, which is characterized by comprising the KASP-labeled primer according to claim 1 or 2.
7. Use of the KASP labeled primer of claim 1 or 2 in the detection of the Dy10-m619SN subunit of wheat high molecular weight gluten to be tested.

Images