CN113699265B - Glutenin and subunit content linkage marker Whass115339 - Google Patents

Glutenin and subunit content linkage marker Whass115339 Download PDF

Info

Publication number
CN113699265B
CN113699265B CN202110975560.9A CN202110975560A CN113699265B CN 113699265 B CN113699265 B CN 113699265B CN 202110975560 A CN202110975560 A CN 202110975560A CN 113699265 B CN113699265 B CN 113699265B
Authority
CN
China
Prior art keywords
gluten
subunit
content
wheat
marker
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Active
Application number
CN202110975560.9A
Other languages
Chinese (zh)
Other versions
CN113699265A (en
Inventor
周正富
姚文
张紫薇
吴政卿
雷振生
李文旭
秦毛毛
杨攀
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Henan Agricultural University
Henan Academy of Agricultural Sciences
Original Assignee
Henan Agricultural University
Henan Academy of Agricultural Sciences
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Henan Agricultural University, Henan Academy of Agricultural Sciences filed Critical Henan Agricultural University
Priority to CN202110975560.9A priority Critical patent/CN113699265B/en
Publication of CN113699265A publication Critical patent/CN113699265A/en
Application granted granted Critical
Publication of CN113699265B publication Critical patent/CN113699265B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
    • C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01H—NEW PLANTS OR NON-TRANSGENIC PROCESSES FOR OBTAINING THEM; PLANT REPRODUCTION BY TISSUE CULTURE TECHNIQUES
    • A01H1/00—Processes for modifying genotypes ; Plants characterised by associated natural traits
    • A01H1/04—Processes of selection involving genotypic or phenotypic markers; Methods of using phenotypic markers for selection
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/13—Plant traits
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/156—Polymorphic or mutational markers

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Organic Chemistry (AREA)
  • Genetics & Genomics (AREA)
  • Analytical Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Botany (AREA)
  • Zoology (AREA)
  • General Health & Medical Sciences (AREA)
  • Wood Science & Technology (AREA)
  • Biotechnology (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • Immunology (AREA)
  • Biophysics (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • Physics & Mathematics (AREA)
  • Mycology (AREA)
  • Developmental Biology & Embryology (AREA)
  • Environmental Sciences (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The application belongs to the technical field of wheat molecular breeding, and particularly relates to a wheat gluten and subunit component content major QTL locus linkage marker Whass115339, wherein the marker is related to the wheat gluten and subunit component content. According to the application, wheat materials with larger content difference of glutenin and subunit components thereof, namely No.1 and Zheng Yomai 9987, are taken as parents to construct and obtain F6 and F7 generation Recombinant Inbred Line (RIL) groups containing 196 families, and through measuring the phenotype related to the content of the glutenin and subunit components thereof and combining genetic linkage map information, QTL positioning analysis is carried out, a gene locus QGlu.6AS-3 influencing the content of the glutenin and subunit components thereof is found to exist on a short arm of a wheat 6A chromosome, and SNP Whaas115339 closely linked with the gene locus QGlu.6AS-3 is converted into KASP markers, and the markers can be used for high-quality wheat molecular breeding.

Description

Glutenin and subunit content linkage marker Whass115339
Technical Field
The application belongs to the technical field of wheat molecular breeding, and particularly relates to a wheat gluten and subunit content major QTL locus linkage marking patent application.
Background
Gluten protein components contained in wheat flour processed from different wheat varieties have a decisive role for the quality and use of the specific wheat flour, wherein: the strong gluten wheat is suitable for making bread, the weak gluten wheat is suitable for making cakes, and the medium gluten wheat between the strong gluten and the weak gluten is suitable for making noodles and steamed bread. The main components of the gluten protein are gluten protein and prolamine protein, which can respectively endow dough with elasticity and extensibility.
The research shows that the wheat gluten is heterogeneous macromolecular polymer protein which is formed by connecting polypeptide chains through intermolecular disulfide bonds, and has a larger molecular weight of about 40-3000 KD. According to the migration rate of gluten in sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE), the gluten can be divided into high molecular weight glutenin subunits (HMW-GS, accounting for 10% of the total gluten content, 80-130 KD) and low molecular weight glutenin subunits (LMW-GS, accounting for 90% of the total gluten content, 10-70 KD).
HMW-GS is controlled by 3 complex sites on the wheat first homologous chromosome population, located on the long arms of chromosomes 1A, 1B and 1D, respectively, denoted Glu-A1, glu-B1 and Glu-D1, respectively, collectively referred to as Glu-1 sites. Theoretically, wheat is hexaploid, so there should be 6 bands of HMW-GS on SDS-PAGE electropherograms. However, most varieties contain only 3 to 5 bands due to silencing or non-expression of part of the genes, 2 of which are encoded by genes at Glu-D1 locus, 1 or 2 of which are encoded by genes at Glu-B1 locus, and 1 or 0 of which are encoded by genes at Glu-A1 locus.
LMW-GS is controlled by gene clusters on the short arms of chromosomes 1A, 1B and 1D, denoted Glu-A3, glu-B3 and Glu-D3, respectively, collectively referred to as Glu-3 sites. LMW-GS can be classified into three types according to the migration rate and isoelectric point on SDS-PAGE electrophoresis patterns: b type (40-50 KD), C type (30-40 KD) and D type (44-74 KD). Wherein, the B type and the C type belong to thiol-rich glutelins, are coded by Glu-3 locus and contain sulfur-containing amino acid (cysteine and methionine) residues, and can form disulfide bonds; form D belongs to a thiol-lean gluten protein, controlled by genes on the short arms of chromosomes 1B and 1D, with little or no sulfur-containing amino acid residues.
Protein structural analysis showed that HMW-GS consisted of signal peptide S, non-repeat N-terminal, C-terminal and intermediate repeat region R in sequence. The N-terminus contains 81 to 104 amino acid residues, wherein the x-type subunit typically contains 3 cysteine residues (Cys) (4 each), and the y-type subunit typically contains 5 Cys; the C-terminal end contains 42 amino acid residues, and the x-type subunit and the y-type subunit both contain 1 Cys; r is 481-681 amino acids to form a polypeptide. The difference in molecular weight between the x-type subunit and the y-type subunit is mainly due to the difference in R, especially the difference in the quantity of tripeptides and hexapeptides, and is mainly caused by the deletion, translocation and repetition of some amino acid residues, and cysteine (Cys) forms disulfide bonds in polypeptide chains or among chains, so that the physicochemical properties and the spatial structure of the subunits are influenced, and the quality characteristics of wheat flour containing the subunits are determined. The LMW-GS is composed of a signal peptide (Sig), an N-terminal region (Nter), a hypervariable repeat region (Rep) and C-terminal (Cter) I, II and III regions in sequence. REP accounts for about 30% of the LMW-GS structure, and this region contains 11-20 repeat motifs PPFSQQQQ rich in proline (Pro) and glutamine (Gln); cter I is a conserved region; cter II is rich in Gln; cter III contains a sequence that terminates LMW-GS. Nter and Pro-rich REP exist predominantly in the form of beta-turns; cter exists mainly in the form of an alpha-helix, accounting for about 35% of the LMW-GS structure. The LMW-GS is a spatial structure formed by connecting Cys of Cter and HMW-GS forming polymers, and the structure influences the gluten quality of wheat.
Because different wheat varieties have different gluten quality characteristics, and in view of the fact that the composition and the content of wheat gluten and subunits thereof are one of key factors for determining the processing quality of wheat, the analysis of genetic mechanisms for controlling the content of gluten and subunits thereof has important significance for basic research for strengthening the quality characters of wheat in China and cultivating high-quality wheat varieties.
Disclosure of Invention
The application aims to provide an SNP marker Whass115339 linked with a major QTL locus related to the content of wheat glutenin subunits, and a KASP molecular marker is developed based on the SNP locus, so that a certain technical foundation is laid for breeding of new varieties of high-quality wheat.
The technical scheme adopted by the application is detailed as follows.
A wheat gluten and subunit content major QTL locus linkage marker, designated wheats 115339, which is related to gluten or gluten subunit component content, the SNP sequence of which is:
AGCGATCCCTTGAGATGTAAGAGTACATAATTAAGTAGAGGAATAACAGCAGAGGGAGTATTTGATTAACCATATCTGACACACAGTCACGCATATAGCT[G/A]GTAATCAAAGTGTGTATCATCTAGCTAGCGTTCGACATTTTAGTTTACCGGATGTTCCTGAATCTTTACCTGCTTGGAAATTATATATGCGCCCGCCACT；
that is, the 101 th base contains an allele locus, and therefore, the specific base sequence is shown as SEQ ID No. 1-2, specifically:
type G (SEQ ID No.1, i.e. high gluten content type):
AGCGATCCCTTGAGATGTAAGAGTACATAATTAAGTAGAGGAATAACAGCAGAGGGAGTATTTGATTAACCATATCTGACACACAGTCACGCATATAGCTGGTAATCAAAGTGTGTATCATCTAGCTAGCGTTCGACATTTTAGTTTACCGGATGTTCCTGAATCTTTACCTGCTTGGAAATTATATATGCGCCCGCCACT；
type a (SEQ ID No.2, i.e. low gluten content type):
AGCGATCCCTTGAGATGTAAGAGTACATAATTAAGTAGAGGAATAACAGCAGAGGGAGTATTTGATTAACCATATCTGACACACAGTCACGCATATAGCTAGTAATCAAAGTGTGTATCATCTAGCTAGCGTTCGACATTTTAGTTTACCGGATGTTCCTGAATCTTTACCTGCTTGGAAATTATATATGCGCCCGCCACT。
the marker Whass115339 is related to gluten and gluten subunit component content, wherein type G is a high gluten (and subunits thereof) content type and type a is a low gluten (and subunits thereof) content type; at the same time, the marker has an additive effect, for example with the sequence of Whaas 16493: TGACAAATCATCCTAAGACTTTGAGATTGATAGGGGTGACTATAGAGGGATAAAGATGTCTTACAAGGCTTGGAAGAGAGGTGGAGAAAATATTGGAAAT [ G/A ] AACTTGAAACAGATGGTGTACAAGACATACCAGAGTTTGAAGGTGACAGTGATGTTTCAGAGTTTTGGCGGGAGGAGAAAGAGGCTGGCAGTGGAGAGGA.
Based on markingWhaas115339The sequence of the KASP marker primer of (c) was designed as follows:
F1 (FAM)：5’-GAAGGTGACCAAGTTCATGCTCTGACACACAGTCACGCATATAGCTG-3’，
F2 (HEX)：5’-GAAGGTCGGAGTCAACGGATTCTGACACACAGTCACGCATATAGCTA-3’，
R (Common)：5’-GCAGGTAAAGATTCAGGAACATCCGG-3’。
the KASP marker is applied to wheat high-quality breeding and is used for distinguishing linkage markersWhaas115339And selecting the G type for the breeding of the high-quality strong gluten wheat or the A type for the breeding of the high-quality weak gluten wheat.
Because the content of gluten and subunit components thereof has an important influence on the quality of wheat, in the application, the inventor uses the wheat variety No.1 and Zheng Yomai 9987 with larger difference of the content of gluten and subunit components thereof as a material, and uses F6 and F7 generation Recombinant Inbred Line (RIL) groups containing 196 families constructed and obtained by parents, and finds that a gene locus QGlu.6AS-3 influencing the content of gluten and subunit components thereof exists on a short arm of a wheat 6A chromosome through the correlation property measurement of the content of gluten and subunit components thereof and the QTL positioning analysis combined with a genetic linkage map, so as to lay a foundation for researching a genetic mechanism for regulating the content of gluten and subunit components thereof.
In the application, the genetic force analysis result shows that: genetic factors dominate the trait of gluten and its subunit content, with QTL cluster 6AS-3 being one of the QTLs controlling the content of gluten and its subunit components. KASP molecular markers developed based on SNP locus Whaas115339 (6 AS-3) related to major QTL cluster can be effectively used for genotyping. Further additive analysis shows that the gluten and subunit component content of specific SNP combination type are larger than those of other SNP combination types, and can be applied to molecular marker assisted breeding.
Drawings
FIG. 1 is a comparison of RIL parents based on RP-HPLC gluten and its subunit component content, wherein: a: peak plot of RIL parental RP-HPLC; b: comparison of RIL amphiphilic gluten and subunit component content;
FIG. 2 is a graph showing the distribution of the content traits of the glutelin subunit components of the offspring of RIL population, wherein: e1, E2, E3 and E4 represent the environment 2018 original sun, 2018 Yanjin, 2019 original sun and 2019 dune, respectively;
FIG. 3 is a graph of a correlation analysis of the content traits of gluten subunit components of RIL population, wherein: * Represents extremely significant at P < 0.01;
FIG. 4 is a genetic linkage map of the RIL population;
FIG. 5 is a typing chart of major QTL cluster 6AS-3 related KASP markers in the RIL population;
FIG. 6 is a graph of a phenotypic data correlation analysis of KASP markers versus gluten subunit component content; in the figure: a. b, c, d represent significant differences (P < 0.05) determined by analysis of variance.
Detailed Description
The application is further illustrated by the following examples. Before describing the specific embodiments, the following description will briefly explain some experimental contexts in the following embodiments.
Experimental materials:
in the experimental process, complex precious 1 and Zheng Yomai 9987 with obvious quality character differences are selected as parents, offspring of a recombinant inbred line (Recombinant Inbred Lines, RIL) group containing 196 families obtained through a single grain transmission method are used as experimental materials (the RIL group is planted in various places of Henan province in 2017-2018, F6 and F7 are selected as experimental materials when the content of glutelin subunit components is measured, F6 generation materials are selected when a genetic linkage map is constructed), and the group is created by a high-yield high-quality wheat breeding team of the agricultural academy of Henan province. Wherein: the patent No.1 is a black grain wheat variety with stable characters, which is directionally bred for many years by complex agricultural sciences, zheng Yomai and 9987 are wheat varieties which are bred by Yumai 21/Yumai No. 2// Yumai 57, which are utilized by new variety research institute of Zhengzhou Qingbang crops, and both parents are publicly available varieties.
Part of the instrument equipment:
HS-3 vertical mixer available from Zhejiang Ningbo New Zhi Biotechnology Co., ltd;
reverse phase high performance liquid chromatography (RP-HPLC, waters e2695 Separations Module, 2998 Photodiode Array Detector, 2414 Refractive Index Detector), available from Shanghai Volter technology Co., ltd;
LM3100 hammer mill, IM9500 type multifunctional grain near infrared analyzer, product of Perten company, sweden;
grinder GT100 vibratory ball mill, available from Beijing Geruidemann instrument Equipment Co., ltd;
thermo Nano Drop 2000c ultraviolet visible spectrophotometer, thermo Fisher scholk company product;
Bio-Rad CFX Connect real-time fluorescent quantitative PCR, a product of Bio-Rad Life medicine Co., ltd.
Part of the experimental method:
(1) Flour milling and moisture determination: threshing the wheat ears after drying by using a threshing machine, weighing 40 g wheat seeds by each RIL family, and crushing and grinding by using a hammer type experiment to obtain whole wheat flour; and (3) utilizing a multifunctional grain near infrared analyzer to measure the moisture of the whole wheat flour.
(2) Extraction of wheat gluten: gluten extraction was performed using whole wheat flour according to the method used by DuPont et al (DuPont et al Sequential Extraction and Quantitative Recovery of Gliadins, glutens and Other Proteins from Small Samples of Wheat Flour, journal of agricultural and food chemistry, 2005), and specific reference may be made to the following:
(a) Weighing 45 mg whole wheat flour (each sample is subjected to repeated experiments twice), adding 1ml of 7% n-propanol (containing 0.3M NaI), vibrating by a vortex oscillator for 10 min, extracting by a vertical mixer for 30 min (rotating speed 60 rpm), centrifuging at 12000 rpm for 10 min, discarding the supernatant, and reversely absorbing redundant water in a centrifuge tube on filter paper;
(b) Adding 1ml of 70% ethanol, vibrating with a vortex oscillator for 10 min, extracting with a vertical mixer at 1 h and 12000 rpm, centrifuging for 10 min, discarding the supernatant, and reversely absorbing excessive water in a centrifuge tube on filter paper;
(c) Adding 1ml 50% isopropanol, shaking by a vortex oscillator for 10 min, carrying out water bath at 65 ℃ for 30 min, centrifuging at 2000 rpm for 2 min, discarding the supernatant, and reversely absorbing excessive water in a centrifuge tube on filter paper;
(d) Adding 1ml 50% isopropanol, shaking by a vortex oscillator for 5 min, carrying out water bath at 65 ℃ for 50 min, centrifuging at 2000 rpm for 2 min, discarding the supernatant, and reversely absorbing excessive water in a centrifuge tube on filter paper;
(e) Adding 1ml 50% isopropanol, shaking by a vortex oscillator for 5 min, carrying out water bath at 65 ℃ for 30 min, centrifuging at 12000 rpm for 10 min, discarding the supernatant, and reversely absorbing excessive water in a centrifuge tube on filter paper;
(f) Add 500. Mu.l 50% isopropanol (80 mM Tris-HCl, pH 8.0, 1% DL-Dithiothreitol), vortex shaker shake 10 min,65℃water bath 1 h;
(g) Add 500. Mu.l 50% isopropanol (80 mM Tris-HCl, pH 8.0, 1.4% 4-Vinylpyridine), vortex shaker shake for 5 min,65℃water bath for 30 min;
(h) Centrifuging at 12000 rpm for 10 min, and collecting supernatant to a new centrifuge tube; filtering the supernatant to a new centrifuge tube by using a sterile syringe through a nylon filter membrane; finally, 200. Mu.l was taken into the inner cannula in the sample bottle.
(3) Determination and calculation of the wheat gluten subunit component content: measuring the content of gluten and subunit components thereof by using RP-HPLC; the instrument parameters were referenced as follows:
vydac 218tp c18 (250 mm ×4.6 mm) column;
the flow rate of the eluent is 0.8 ml/min;
the elution gradient is: 0-10 min,90% eluent A (ultrapure water containing 0.06% TFA) and 10% eluent B (acetonitrile containing 0.05% TFA); the eluent A is linearly decreased to 35% after 10-65 min, and the column temperature is 60 ℃.
And integrating the peak areas of the chromatographic peaks corresponding to the subunit components of the gluten according to different elution times, and calculating the relative content of the gluten and the subunit components of the gluten. The relative amounts of gluten and its subunit components are calculated according to the following formula:
；
wherein: yu represents the content of gluten/gluten subunit component in the 1 mg sample in 10 units 6 AU/mg；
M represents the weight of the sample called when extracting gluten, and the unit is mg;
x represents the moisture content (%) of the sample;
tu represents the peak area calculated by RP-HPLC detection of the gluten/gluten subunit fraction in the sample of weight M in AU (100 is because the gluten extraction in the sample of weight M is 1ml and the loading by RP-HPLC is 10. Mu.l).
Example 1
In this example, the content of gluten (Glu) and subunit components thereof in the parents of the RIL population constructed, no.1 and Zheng Yomai 9987,9987, were first described as follows.
RP-HPLC measurement results of total gluten (Glu) of RIL population and Zheng Yomai 9987 and subunit components HMW-GS, LMW-GS, ax subunit (Ax), bx subunit (Bx), by subunit (By), dx subunit (Dx) and Dy subunit (Dy) thereof show that the compositions of the amphiphilic high molecular weight glutenin subunits are different, wherein: is the "ax1+bx7+by8+dx5+dy10" subunit combination type, and Zheng Yomai 9987 is the "ax1+bx7+by9+dx2+dy12" subunit combination type (as shown in fig. 1 a). Meanwhile, for the content of gluten (Glu) and its subunit components HMW-GS, LMW-GS, ax, bx, by, dx and Dy (the data listed are average values in four environments for two years), the parent No.1 is significantly higher than the parent Zheng Yomai 9987,9987, about twice as much (as shown in FIG. 1 b).
Further carrying out remarkable difference analysis on the contents of gluten and subunit components thereof of RIL population parents, no.1 and Zheng Yomai 9987, and the results show that: the difference in the content of HMW-GS, ax, bx, dx and Dy of the glutelin subunit components between parents reached very significant levels (P < 0.01); the difference in the content of gluten Glu and gluten subunit components LMW-GS between parents reached significant levels (P < 0.05); the difference in the content of the gluten subunit component By between parents is not significant.
Further, the phenotypic data of the gluten subunit component content traits of the RIL population were statistically analyzed (the results are shown in tables 1 and 2 below) in order to understand the overall distribution and genetic variation.
TABLE 1 phenotypic analysis of the content traits of the wheat gluten subunit components of RIL population
TABLE 2 (subsequent TABLE 1), phenotypic analysis of the content traits of the glutenin subunits of wheat of RIL population
In the table: e1, E2, E3, E4 and Mean represent average values in 2018 original sun, 2018 Yanjin, 2019 original sun, 2019 dune and four environments, respectively.
Analysis of the above table data can be seen: the content of the gluten and the subunit components of the gluten of the parent Luodanzhen No.1 is obviously different from that of the gluten and the subunit components of the gluten of the Zheng Yomai 9987, and the content of the gluten and the subunit components of the gluten of the parent Luodanzhen No.1 is larger than that of the parent Zheng Yomai 9987. The content amplitude of the gluten and the components of 196 RIL population offspring is large, the average value is mostly between parents, the variation range of the variation coefficient is 14.86% -39.35%, and the variability of the phenotype data is good. The variation of each character is abundant, and the two ends of the phenotype data value of the amphipathic character are distributed, so that the bidirectional super-amphipathic separation phenomenon is shown. The absolute values of skewness and kurtosis are less than 1 except for individual traits of individual environments, and the phenotypic distribution of the population substantially conforms to a normal distribution.
The distribution of phenotypic data for the gluten subunit component content trait of RIL populations in a four year environment is plotted as shown in fig. 2, and it can be seen that: the contents of gluten (Glu) and its subunit components HMW-GS, LMW-GS, ax, bx, by, dx and Dy in four environments of E1, E2, E3 and E4 basically conform to normal distribution. The characteristic of the content of the glutelin subunit components is influenced by environmental conditions, the phenotype values of the content of the glutelin subunit components in different environments are different, and the content of the glutelin subunit components in four environments is Glu > LMW-GS > HMW-GS; in both E1 and E2 environments, the gluten subunit content Bx > Dx > Dy > By, in E3 environments, the gluten subunit content Bx > Dx > Dy > Ax > By, and in E4 environments, the gluten subunit content Dx > Bx > Dy > Ax > By.
On the other hand, BLUP values of the glutelin subunit component content traits of RIL groups under four environments for two years are subjected to variance analysis, and the influence of genotypes, environments and genotype-environment interactions on the glutelin subunit component content traits of wheat is analyzed respectively. The results are shown in Table 3 below.
TABLE 3 analysis of variance and generalized genetic Table of the content traits of glutelin subunits of RIL population
The table indicates that P < 0.001 is very significant.
Analysis can be seen: the difference of the phenotype mean square values of the contents of the glutelin Glu and the subunit components of the glutelin Glu is larger, and the phenotype mean square values of the contents of the subunit components of the glutelin Glu and the subunit components of the glutelin Glu are larger; the phenotypic mean square of Ax, bx, by, dx and Dy content is small. Each trait reached an extremely significant level (P < 0.001) in genotype, environment, genotype and environment interactions, indicating that genotype, environment and genotype and environment interactions play an important role in the formation of the gluten subunit component content traits. The generalized genetic variation range is 0.39-0.88, and the generalized genetic variation of other characters is above 0.68 except the two characters of the content of the glutelin subunit components Ax and By, which indicates that the content of the glutelin subunit components is mainly influenced By genetic factors and is suitable for genetic analysis.
Correlation analysis was further performed on BLUP values of the gluten subunit component content trait of RIL population under four environments for two years, and the graph is shown in FIG. 3.
Analysis showed that each trait exhibited very significant positive correlation (P < 0.01). The variation range of the correlation coefficient r is 0.268-0.909, wherein the correlation between the content character HMW-GS of the glutelin subunit component and Ax is the highest, and the correlation coefficient is 0.909; the correlation coefficient between the gluten subunit component content traits HMW-GS and LMW-GS is 0.588; the content of Glu has high correlation coefficient with the content of HMW-GS and LMW-GS, which are respectively 0.884 and 0.891.
From the above results, the following conclusions can be initially drawn: the content traits of the glutelin and the subunit components of the parent Luodan No.1 and Zheng Yomai 9987 are obviously different, the expression of the content traits of the glutelin subunit components in the offspring of RIL population is continuous, the expression is controlled by micro-effect polygene, the expression is genetic of a plurality of traits, and the phenotype distribution range is wide, so that the method is suitable for QTL analysis. In addition, the genetic background of the primary positioning group recombinant inbred line selected by QTL positioning is clear, the interference of the genetic background can be eliminated to a great extent, and the relation of the genotype and the content character of the wheat glutenin subunit components can be reflected more accurately.
Example 2
Prior to the analysis of example 1, the inventors constructed a genetic linkage map using F6 generation material of RIL population, and combined the analysis results of example 1, the inventors performed QTL mapping using gluten (Glu) and the contents of its subunit components HMW-GS, LMW-GS, ax subunit (Ax), bx subunit (Bx), by subunit (By), dx subunit (Dx) and Dy subunit (Dy) under four environments for two years as phenotype data. The main experimental methods in the QTL positioning process are briefly described below.
(1) SLAF (Specific-locus amplified fragment sequencing) sequencing
Reads generated by SLAF tag sequencing are derived from the results of the enzyme digestion sequencing of different samples, and sequences are clustered together according to similarity of the sequences and defined as SLAF fragments (SLAF tags). The sequence similarity on the same SLAF label is higher than that of other SLAF labels, and the sequence differences of different samples on the SLAF labels are compared to find out polymorphic SLAF labels for analysis. SLAF label mainly divides: no Poly (Non-Polymorphic type), poly (Polymorphic type) and Repeat (Repeat type) three types, respectively, represent Non-Polymorphic, polymorphic and repeated SLAF tags.
In this example, the wheat genomic sequence was selected for electronic cleavage prediction, and the genomic DNA of each sample that was acceptable was digested with the RsaI restriction enzyme. And (3) adding A to the 3' end of the obtained enzyme section (SLAF label), connecting a Dual-index sequencing joint, carrying out PCR amplification, purifying, mixing, cutting glue, selecting a target fragment, and sequencing by Illumina HiSeq TM after the library quality is checked to be qualified. The sequence with fragment length 464 bp-484 bp is defined as SLAF tag.
(2) Genetic linkage map construction
Genetic linkage map refers to the position and genetic distance of a molecular marker on a chromosome, the latter is usually expressed in terms of the separation frequency centimorgan (cM) of a gene or a DNA fragment during chromosome exchange, and the greater the cM value, the greater the distance between the two.
In this example, SLAF-seq technology from Beijing Baimaike Biotechnology Inc. was used to develop high density molecular tags for F6 generation of RIL genetic isolate containing 196 families with CODE No.1 and Zheng Yomai 9987 as parents. The genome used was wheat genome, the actual genome size was 1700 Mb, the assembled genome size was 14,547.26 Mb, and the GC content was 46.05%. And calculating mLOD values among the obtained SLAF molecular tags, and carrying out linkage grouping through the mLOD values. Genetic map construction is carried out on each linkage group by adopting HighMap software, the software calculates genetic distances among marks through a maximum likelihood estimation method, determines the sequence of the marks on a chromosome, obtains a high-quality map, and evaluates the map in the aspects of collinearity, genetic relationship, monomer source and the like.
(3) Whole Genome Composite Interval Mapping (GCIM)
QTL analysis was performed using software R3.5.1 (QTL. Gcimappgui), where the LOD value was set to 2.5, the model was a random model, and the scan rate was 1 cM.
When QTL is named, the q+ trait is abbreviated by the abbreviation +chromosome +number (when a plurality of QTLs are present on the same chromosome), and the QTL is named. Wherein the chromosomes are expressed by the names of wheat chromosomes, and the long arm or the short arm can be noted, the "", the "-", the chromosome and the number are added between the characters and the chromosomes. For example, "QGlu.1DL-2" represents the second QTL tagged region on the long arm of the 1D chromosome that controls gluten content.
Based on the above experimental methods, some experimental results are briefly described below.
Genetic linkage map
By sequencing analysis, 5,084,346 SLAF tags and 1,934,082 SNP tags are obtained in total, and 9454 SNP markers on a chromosome which can be used for mapping are finally obtained by filtering. The SNPs that were available for mapping were scored into 21 linkage groups by alignment with the reference genome. And (4) taking the linkage group as a unit, adopting HighMap software to analyze to obtain linear arrangement of markers in the linkage group, estimating genetic distances between adjacent markers, and finally obtaining a genetic linkage map with upper icon parent average depth 165.06X, offspring average depth 18.05X, total map distance of 3,140.54 cM and average map distance of 0.37 cM (figure 4).
QTL localization of (two) wheat gluten subunit component content
In this example, QTL localization was performed by using the whole Genome Composite Interval Mapping (GCIM) method, using phenotypic data of the contents of gluten (Glu) and its subunit components HMW-GS, LMW-GS, ax, bx, by, dx and Dy in four environments of the RIL population, and BLUP values of the respective traits. A total of 41 additive QTLs were detected, distributed over 16 chromosomes of wheat. Part of the QTL information site is as follows.
TABLE 4 partial QTL information locus table for the content traits of wheat gluten subunits of RIL population
In the table: e1, E2, E3, E4 and BLUP represent the BLUP values in 2018 raw, 2018 Yanjin, 2019 raw, 2019 dune and four environments, respectively.
It can be seen that QGlu.6AS-3 contains a major QTL for controlling gluten (Glu) and subunit content thereof. Further analysis of major QTL clusters concerning the content traits of gluten subunit components shows that Whaas 115259-Whaas 115345 are one of the major QTL intervals.
Example 3
Based on the results of the previous examples, the molecular marker SNP sequence Whaas115339 related to the content of wheat gluten subunit components was selected as an example for the relevant KASP marker development. Before introducing a specific experimental procedure, a part of the experimental method is briefly described as follows.
(1) Extraction of wheat leaf genomic DNA
Extraction by CTAB method, or specifically referring to the following operations:
(a) Shearing a proper amount of wheat leaves, placing the crushed wheat leaves into a 2 ml centrifuge tube, adding a proper amount of steel balls, freezing the mixture for 2 minutes by liquid nitrogen, and placing the mixture on a vibration ball mill for grinding for 5 minutes; adding 650 μl of CTAB buffer, mixing, and maintaining the temperature in a 65 deg.C water bath for 1 h (during the period, reversing every 10-20 min to ensure mixing);
(b) Adding 650 μl of chloroform-isoamyl alcohol (24:1) mixed solution, gently reversing a centrifuge tube, mixing uniformly, and centrifuging at 12000 rpm for 10 min;
(c) Sucking 300 μl of supernatant into another centrifuge tube, adding 300 μl of chloroform-isoamyl alcohol, gently reversing and mixing, and centrifuging at 12000 rpm for 10 min;
(d) Sucking 200 mu l of upper water phase into another new centrifuge tube, adding 200 mu l of isopropanol, uniformly mixing, standing at room temperature for 30 min, centrifuging at 12000 rpm for 10 min, and discarding the supernatant;
(e) Adding 500 mu l of 70% ethanol, oscillating with a vortex meter, centrifuging at 12000 rpm for 10 min, discarding the supernatant, reversely drying with filter paper, and drying in an ultra clean bench; adding 50 mu l of TE buffer after air drying; taking 1 mu l of the solution as a sample, detecting the concentration of the solution by using an ultraviolet spectrophotometer, and carrying out subsequent experiments or preserving at the temperature of minus 20 ℃ for later use after the qualification is ensured.
(2) Primer design
Designing a Common primer (reverse direction) according to the SNP sequence (Whaas 115339) of the molecular marker; designing upstream primers (two) by taking SNP of the primer as a 3' end, and adding a fixed tag (a specific nucleotide sequence, 5' -3 ') FAM (GAAGGTGACCAAGTTCATGCT) or HEX (GAAGGTCGGAGTCAACGGATT) when designing KASP primers; primers were synthesized by Shanghai Biotechnology Co.
The sequence (201 bp) of the SNP sequence Whaas115339 related to the major QTL cluster 6AS-3 with the content of the specific glutelin subunit components is shown AS SEQ ID No. 1-2, and the specific sequence is AS follows:
AGCGATCCCTTGAGATGTAAGAGTACATAATTAAGTAGAGGAATAACAGCAGAGGGAGTATTTGATTAACCATATCTGACACACAGTCACGCATATAGCTGGTAATCAAAGTGTGTATCATCTAGCTAGCGTTCGACATTTTAGTTTACCGGATGTTCCTGAATCTTTACCTGCTTGGAAATTATATATGCGCCCGCCACT；
or:
AGCGATCCCTTGAGATGTAAGAGTACATAATTAAGTAGAGGAATAACAGCAGAGGGAGTATTTGATTAACCATATCTGACACACAGTCACGCATATAGCTAGTAATCAAAGTGTGTATCATCTAGCTAGCGTTCGACATTTTAGTTTACCGGATGTTCCTGAATCTTTACCTGCTTGGAAATTATATATGCGCCCGCCACT；
that is, the 101 st base thereof contains an allele site, and thus, a specific base sequence can be expressed as:
AGCGATCCCTTGAGATGTAAGAGTACATAATTAAGTAGAGGAATAACAGCAGAGGGAGTATTTGATTAACCATATCTGACACACAGTCACGCATATAGCT[G/A]GTAATCAAAGTGTGTATCATCTAGCTAGCGTTCGACATTTTAGTTTACCGGATGTTCCTGAATCTTTACCTGCTTGGAAATTATATATGCGCCCGCCACT。
based onWhaas115339 The specific KASP marker primer sequences for the SNP sites were designed as follows:
F1 (FAM)：5’-GAAGGTGACCAAGTTCATGCTCTGACACACAGTCACGCATATAGCTG-3’，
F2 (HEX)：5’-GAAGGTCGGAGTCAACGGATTCTGACACACAGTCACGCATATAGCTA-3’，
R (Common)：5’-GCAGGTAAAGATTCAGGAACATCCGG-3’。
(3) Real-time fluorescent quantitative PCR amplification
Specific operations are referred to as follows:
(a) Diluting the concentration of the extracted F6 generation blade genome DNA to 100 ng/Mul to serve as a DNA template for PCR amplification;
(b) Preparation of fluorescent quantitative PCR Primer Mix system (100 μl):
F1 (FAM, 10 µmol)，12 µl；
F2 (HEX, 10 µmol)，12 µl；
R (Common, 10 µmol)，30 µl；
TE/ddH2O，46 μl；
preparation of a fluorescent quantitative PCR amplification system (10 μl):
Primer Mix，1.4 µl；
Master Mix 5 µl；
MgCl 2 ，2 µl；
Template DNA (100 ng/µl)，1 µl；
ddH 2 O，2.52 µl。
the amplification procedure was: pre-denaturation at 95℃for 15 min;95 ℃,20 s, 65-55 ℃,1 min,10 cycles (each cycle is reduced by 1 ℃); 94 ℃,20 s,57 ℃,1 min,30 cycles; the signal was read after 1 min at 37 ℃.
The amplified products were scanned with a light beam using Bio-Rad CFX Maestro typing software and the scanned data were typed.
Based on the above design, the verification profile for the designed KASP mark is as follows.
Parting verification
The developed KASP markers were typed for 196 parts of material from the F6 generation of RIL population and the markers were validated.
The results show that: based on KASP markers developed by SNP locus Whaas115339 related to the major QTL cluster 6AS-3, 196 materials of RIL group are well typed, homozygous genotype Whaas115339-A has 94 families, homozygous genotype Whaas115339-G has 100 families, and heterozygous genotype Whaas115339-AG has 2 families (FIG. 5). By comparing with the chip result of genetic map sequencing, the designed KASP marker is correctly typed in the F6 generation RIL population, which indicates that the marker is available and can distinguish the base type of SNP locus.
(II) additive analysis
Analyzing KASP marking typing results of SNP locus Whaas115399 related to main effect QTL cluster 6AS-3 of the content character of the glutelin subunit components, wherein the typing results of parents are AS follows:
the gluten and its subunit components of the RIL population, which are classified as G, are both higher than those of the gluten and the subunit components of the gluten, which are classified as A, in the RIL population, with G being Zheng Yomai 9987,9987 as A, and other traits than the two traits of gluten subunit components By and LMW-GS reaching a level of significant or very significant difference between the two types.
Further to the other SNP sites Whaas16493 (the site technical scheme is irrelevant to the application, and the description is not provided in detail, but the description is provided that the sequence of Whaas16493 is TGACAAATCATCCTAAGACTTTGAGATTGATAGGGGTGACTATAGAGGGATAAAGATGTCTTACAAGGCTTGGAAGAGAGGTGGAGAAAATATTGGAAAT [ G/A ] AACTTGAAACAGATGGTGTACAAGACATACCAGAGTTTGAAGGTGACAGTGATGTTTCAGAGTTTTGGCGGGAGGAGAAAGAGGCTGGCAGTGGAGAGGA, the result of the amphiphilicity typing of KASP markers based on the major QTL cluster 1DL-2 related SNP sites Whaas16493 is that the number of Lo-Pearl 1 is A, zheng Yomai 9987 is G, the content of gluten and subunit components thereof typed A in RIL population is higher than that typed G, and the additive analysis result that each trait reaches extremely significant difference level between the two types shows that the characteristics of the subunit components of gluten exist in SNP combination types A+G (Whaas 16493-A, whaas 115399-G) > A+A (Whaas 823-A, whaas 115399-A) > G+G (Whaas 16493-G, whaas 115399-G) > A (Whaas 16493-A) at the two SNP sites. And for the 4 characters of gluten (Glu) and the contents of the components LMW-GS, dx and Dy, the 4 SNP combination types reach significant level between every two. Thus, for these two SNP loci associated with two major QTL clusters for the gluten subunit component content trait, A+G (Whaas 16493-A, whaas 115399-G) is considered an excellent SNP combination type.
From the experiments, the following conclusions can be drawn: KASP markers developed by the major QTL cluster-related SNP locus Whaas115339 based on the gluten subunit component content trait are available.
After correlation analysis of the phenotypic data of the KASP markers and the gluten subunit component content, it was found that most traits had a significant or very significant relationship between the two genotypes of this SNP locus scored by the KASP markers. After the SNP locus is subjected to additive analysis, the additive effect is found, when the SNP type is the same as that of the SNP combination type (Whaas 16493-A, whaas 115399-G) of parent complex number 1, the gluten and subunit component content of the SNP locus are higher than those of the SNP combination type (Whaas 16493-G, whaas 115399-A) which is the same as that of male parent Zheng Yomai 9987, and a significant difference exists between the two types, and for the SNP locus related to a major QTL cluster of the gluten subunit component content character, A+G (Whaas 16493-A, whaas 115399-G) is an excellent SNP combination type.
SEQUENCE LISTING
<110> academy of agricultural sciences in Henan province
Henan Agricultural University
<120> glutenin and subunit content linkage marker Whass115339
<130> none
<160> 2
<170> PatentIn version 3.5
<210> 1
<211> 201
<212> DNA
<213> Triticum aestivum L.
<400> 1
agcgatccct tgagatgtaa gagtacataa ttaagtagag gaataacagc agagggagta 60
tttgattaac catatctgac acacagtcac gcatatagct ggtaatcaaa gtgtgtatca 120
tctagctagc gttcgacatt ttagtttacc ggatgttcct gaatctttac ctgcttggaa 180
attatatatg cgcccgccac t 201
<210> 2
<211> 201
<212> DNA
<213> Triticum aestivum L.
<400> 2
agcgatccct tgagatgtaa gagtacataa ttaagtagag gaataacagc agagggagta 60
tttgattaac catatctgac acacagtcac gcatatagct agtaatcaaa gtgtgtatca 120
tctagctagc gttcgacatt ttagtttacc ggatgttcct gaatctttac ctgcttggaa 180
attatatatg cgcccgccac t 201

Claims (4)

1. A glutenin and subunit content linkage marker Whass115339, which is characterized in that the marker is a major QTL locus linkage marker related to the glutenin and subunit content thereof, and the sequence is as follows:
AGCGATCCCTTGAGATGTAAGAGTACATAATTAAGTAGAGGAATAACAGCAGAGGGAGTATTTGATTAACCATATCTGACACACAGTCACGCATATAGCT[G/A]GTAATCAAAGTGTGTATCATCTAGCTAGCGTTCGACATTTTAGTTTACCGGATGTTCCTGAATCTTTACCTGCTTGGAAATTATATATGCGCCCGCCACT；
the 101 th base contains an allele locus, and the specific base sequence is shown as SEQ ID No. 1-2.
2. The use of the linkage marker Whass115339 of claim 1 in wheat breeding, wherein the linkage marker Whass115339 is associated with glutenin and subunit component content thereof, wherein type G is a high gluten content type and type a is a low gluten content type; at the same time, the label has an additive effect.
3. The KASP marker for the linkage marker Whass115339 of claim 1, wherein the KASP marker primer sequence is designed as follows:
F1：5’-GAAGGTGACCAAGTTCATGCTCTGACACACAGTCACGCATATAGCTG-3’，
F2：5’-GAAGGTCGGAGTCAACGGATTCTGACACACAGTCACGCATATAGCTA-3’，
R：5’-GCAGGTAAAGATTCAGGAACATCCGG-3’。
4. the application of the KASP marker in high-quality wheat breeding according to claim 3, wherein the KASP marker is used for distinguishing whether linkage marker Whaas115339 is G type or A type, the high-quality strong-gluten wheat breeding is selected to be G type, and the high-quality weak-gluten wheat breeding is selected to be A type.
CN202110975560.9A 2021-08-24 2021-08-24 Glutenin and subunit content linkage marker Whass115339 Active CN113699265B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN202110975560.9A CN113699265B (en) 2021-08-24 2021-08-24 Glutenin and subunit content linkage marker Whass115339

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202110975560.9A CN113699265B (en) 2021-08-24 2021-08-24 Glutenin and subunit content linkage marker Whass115339

Publications (2)

Publication Number Publication Date
CN113699265A CN113699265A (en) 2021-11-26
CN113699265B true CN113699265B (en) 2023-10-31

Family

ID=78654431

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202110975560.9A Active CN113699265B (en) 2021-08-24 2021-08-24 Glutenin and subunit content linkage marker Whass115339

Country Status (1)

Country Link
CN (1) CN113699265B (en)

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
AU2003259589A1 (en) * 2002-10-30 2004-05-20 Awb Limited Molecular markers for high molecular weight glutenin subunits
CN106754972A (en) * 2017-02-14 2017-05-31 江苏省农业科学院 One wheat gluten mutator and its application
CN110205398A (en) * 2019-06-11 2019-09-06 四川农业大学 It is a kind of detect wheat high-molecular-weight glutelin Dy10-m619SN subunit KASP labeled primer and application
CN112322774A (en) * 2020-12-02 2021-02-05 河南省农业科学院 Molecular marker of wheat gluten quality QTL qWGQ-1DS

Patent Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
AU2003259589A1 (en) * 2002-10-30 2004-05-20 Awb Limited Molecular markers for high molecular weight glutenin subunits
CN106754972A (en) * 2017-02-14 2017-05-31 江苏省农业科学院 One wheat gluten mutator and its application
CN110205398A (en) * 2019-06-11 2019-09-06 四川农业大学 It is a kind of detect wheat high-molecular-weight glutelin Dy10-m619SN subunit KASP labeled primer and application
WO2020248892A1 (en) * 2019-06-11 2020-12-17 四川农业大学 Kasp labeled primer for detecting high molecular weight glutenin subunit dy10-m619sn of wheat, and application thereof
CN112322774A (en) * 2020-12-02 2021-02-05 河南省农业科学院 Molecular marker of wheat gluten quality QTL qWGQ-1DS

Non-Patent Citations (4)

* Cited by examiner, † Cited by third party
Title
SNP markers for early identification of high molecular weight glutenin subunits (HMW‑GSs) in bread wheat;Catherine Ravel 等;《Theoretical and Applied Genetics》;第1-20页 *
SNP markers for low molecular glutenin subunits (LMW-GSs) at the Glu-A3 and Glu-B3 loci in bread wheat;Susanne Dreisigacker 等;《PLoS ONE》;第15卷(第5期);第1-16页 *
小麦谷蛋白亚基及其基因多态性研究进展;孙辉 等;《麦类作物学报》;第20卷(第1期);第82-86页 *
小麦高分子量麦谷蛋白亚基基因功能标记研究进展;温亮 等;《分子植物育种》;第18卷(第17期);第5813-5819页 *

Also Published As

Publication number Publication date
CN113699265A (en) 2021-11-26

Similar Documents

Publication Publication Date Title
Zhang et al. Identification of SNPs and development of allele-specific PCR markers for γ-gliadin alleles in Triticum aestivum
Lei et al. Y-type gene specific markers for enhanced discrimination of high-molecular weight glutenin alleles at the Glu-B1 locus in hexaploid wheat
Wang et al. Development of STS markers and establishment of multiplex PCR for Glu-A3 alleles in common wheat (Triticum aestivum L.)
Zhang et al. Characterisation and marker development for low molecular weight glutenin genes from Glu-A3 alleles of bread wheat (Triticum aestivum. L)
Gale Diagnostic DNA markers for quality traits in wheat
Huang et al. Molecular characterization and genomic organization of low molecular weight glutenin subunit genes at the Glu-3 loci in hexaploid wheat (Triticum aestivum L.)
CN111719010A (en) High-throughput SNP diagnostic marker of wheat powdery mildew resistance gene Pm21 and application thereof in breeding
CN111719008A (en) SNP coseparated with wheat powdery mildew disease-resistant gene Pm5e and application thereof
CN113699265B (en) Glutenin and subunit content linkage marker Whass115339
CN103421771B (en) Genetic marker for character of litter size of pig utilizing WIF1 gene
CN110129342B (en) Molecular marker of corn high-lysine gene ZmcytMdh4 and application thereof
Maruyama-Funatsuki et al. Identification and characterization of a novel LMW-s glutenin gene of a Canadian Western Extra-Strong wheat
Filip Composition of high molecular weight glutenin subunits in polish common wheat cultivars (Triticum aestivum L.)
CN102399891B (en) Polymerase chain reaction (PCR) system for identifying or complementarily identifying quality trait genes of wheat Sinkiang stretched noodles
CN106977594A (en) A kind of common wheat low molecular weight glutenin and its encoding gene and application
CN100355779C (en) Wheat seed hardness relative protein and its code gene and application
CN114457091A (en) Gene TaXip influencing wheat grain quality and application thereof
CN114592084B (en) Molecular marker of related site qGLI-7DS of wheat gliadin content
CN114591946B (en) Molecular marker of related site qGLI-6DS of wheat gliadin content
CN114592085B (en) Molecular marker of genetic locus related to gliadin content
CN100357438C (en) Wheat seed hardness related gene and its encoding protein and uses
CN114231640B (en) Molecular marker related to pig hair-blacking color traits and breeding application thereof
Yan et al. Sequences of the waxy loci of wheat: utility in analysis of waxy proteins and developing molecular markers
AU2003259589A1 (en) Molecular markers for high molecular weight glutenin subunits
CN115011617B (en) Main effect QTL for controlling wheat plant height, candidate gene and application thereof

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant