CN111719010A - High-throughput SNP diagnostic marker of wheat powdery mildew resistance gene Pm21 and application thereof in breeding - Google Patents
High-throughput SNP diagnostic marker of wheat powdery mildew resistance gene Pm21 and application thereof in breeding Download PDFInfo
- Publication number
- CN111719010A CN111719010A CN202010119048.XA CN202010119048A CN111719010A CN 111719010 A CN111719010 A CN 111719010A CN 202010119048 A CN202010119048 A CN 202010119048A CN 111719010 A CN111719010 A CN 111719010A
- Authority
- CN
- China
- Prior art keywords
- wheat
- powdery mildew
- marker
- gene
- kasp
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Withdrawn
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/13—Plant traits
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Analytical Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Biotechnology (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Immunology (AREA)
- Mycology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Botany (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a powdery mildew resistance gene of wheatPm21The high-throughput diagnostic marker of (1) and its use in breeding, which is derived fromPm21Rapid, high-efficiency and high-throughput detection of wheat powdery mildew resistant gene in genePm21Can efficiently detect the SNP diagnostic marker of (1)Pm21The distribution of the gene in the wheat germplasm resource and filial generation is selected and bred by marker-assisted selectionPm21The wheat variety (line) of (1). The results prove that the diagnostic marker provided by the invention has the characteristics of rapidness, accuracy, high efficiency, high flux and the like, and can be used for completing mass materials in a short timePm21The screening of the disease-resistant gene effectively serves the breeding work of wheat for resisting powdery mildew.
Description
Technical Field
The invention relates to the technical field of plant molecular markers, and particularly provides a powdery mildew resistance gene of wheatPm21The high-throughput SNP diagnostic marker and the application technology thereof in breeding.
Background
The wheat powdery mildew is caused by Pobuchner whitePowder bacterium (A)Blumeria graminisf.sp.tritici) The caused fungal disease is one of the most important wheat diseases in the world, is distributed in various wheat producing countries, and seriously influences the yield of wheat. In recent years, with the adjustment of farming systems and the continuous change of climate, the diseases tend to become increasingly serious in several main wheat areas such as southwest, northwest and northeast of China. The disease mainly attacks the leaves of wheat plants, and can cause 5 to 34 percent of yield loss when the disease is serious, thereby seriously threatening the safe production of wheat. Therefore, the prevention and treatment of wheat powdery mildew is of great significance to the improvement of wheat yield.
To date, 65 (a) is the internationally formally named major anti-powdery mildew genePm1-Pm65) And more than 100 powdery mildew resistance Quantitative Trait Loci (QTL) mainly derived from common wheat and wheat related species are respectively positioned on 19 chromosomes (except 3A and 4D) of the wheat. Among the main genes that have been named,Pm2、 Pm4b、Pm12、Pm13、Pm16、Pm20、Pm21、Pm30、Pm2+6、Pm2+Mld、Pm4b+Mli、Pm1+2+9the toxicity frequency of the isogenes is lower, generally less than 40%, so that the genes still have better powdery mildew resistance and can be utilized in breeding for disease resistance.
With the variation of the physiological race of powdery mildew, and other reasons, some powdery mildew resistant genes discovered at an early stage basically lose the resistance, such as:Pm1、Pm5、Pm7、Pm9、Pm19、Pm4aand the like, the continuous discovery and utilization of new powdery mildew resistance genes have important significance for effectively preventing wheat powdery mildew. Some of the genes found to be resistant to powdery mildew, for example:Pm12、Pm13、Pm16、 Pm18、Pm20and the like, although high resistance to wheat powdery mildew is shown, most of the resistance is closely linked with undesirable agronomic traits, so that the resistance is difficult to apply to actual breeding, and a smaller introduced fragment carrying a disease-resistant gene is yet to be induced and marker-assisted selection is performed.
Pm21The powdery mildew resistant gene is transferred from the haynaldia villosa to the common wheat by hybridizing the common wheat and the haynaldia villosa. ComprisesPm21Translocation of the 6V chromosome short arm of the gene and the wheat 6A chromosome short arm occurs, and the product is obtainedThe wheat-haynaldia villosa 6VS/6AL translocation line is a recognized powdery mildew resistance gene with strongest resistance and widest resistance spectrum at present, is widely applied to wheat breeding and germplasm innovation research in China, and becomes one of main resistance sources of powdery mildew resistance breeding. By pairsPm21Further fine positioning and map cloning of gene and determinationPm21Is a gene coding CC-NBS-LRR protein.
KASP (Kompetitive Allle Specific PCR), a competitive Allele-Specific PCR technique. The method can accurately judge the double alleles of SNPs and InDels at specific sites in a wide range of genome DNA samples. The molecular marker has the characteristics of high stability, accuracy, low cost and high flux, can be used for high-flux screening of large-scale breeding materials, and improves the efficiency of molecular marker-assisted breeding.
This study has cloned powdery mildew resistance genes from Haynaldia villosaPm21On the basis of the gene sequence, the homologous genes of the gene sequence in the wheat genome are analyzed to determine that the gene sequence can be distinguishedPm21And their homologous genes located on 6A, and further screened by using different segregating populations and natural populations, to develop a SNP derived fromPm21The gene can be used for quickly detecting the powdery mildew resistant gene in a high-throughput mannerPm21The diagnostic marker can be widely applied to the wheat molecular marker-assisted selective breeding, and the breeding efficiency is improved.
Disclosure of Invention
Aiming at the blank existing in the prior art, the invention provides a diagnostic marker with important utilization value in breeding for resisting wheat powdery mildew with high flux, and the marker can be used for quickly, efficiently and high-flux detectionPm21SNP diagnostic marker with exon region causing resistance change of Chinese wheat powdery mildew, and can be used for detectingPm21The distribution of the gene in the wheat germ plasm resource can efficiently screen the gene with powdery mildew resistancePm21The wheat germplasm resource is applied to the wheat powdery mildew resistant molecular marker assisted selective breeding, solves the problems of low selection speed, low detection efficiency, low flux and the like existing in the prior breeding, and improves the wheat powdery mildew resistant breeding efficiency.
The technical scheme adopted by the invention is as follows:
the invention provides a powdery mildew resistance gene of wheatPm21The high-throughput SNP diagnostic marker of (1), which is named as KASP-QPm21_6A, is positioned on the short arm of the common wheat 6A chromosome and shows the resistance of the wheat powdery mildew in the whole growth period, the molecular marker is a single nucleotide polymorphism site, and the SNP site is G/C mutation;
the marker is a high-throughput SNP marker and comprises 2 forward primers and 1 reverse primer; the primer sequences are as follows:
the nucleotide sequence of the forward primer KASP-QPm21_6A-F-FAM combined with the disease-resistant site is shown as SEQ ID NO: 1:
5＇-ACAATATCTGACGGGATGCTTG- 3＇；
the upstream sequence KASP-QPm21_6A-F-HEX combined with the susceptible site has the nucleotide sequence shown in SEQ ID NO. 2:
5＇-ACAATATCTGACGGGATGCTTC- 3＇；
the reverse primer KASP-QPm21_6A-R has the nucleotide sequence shown in SEQ ID NO. 3:
5＇-CRRGCTTGTTCATTTGGAGAC- 3＇。
powdery mildew resistance gene using haynaldia villosaPm21The diagnostic marker KASP-QPm21_6A can be identified or detectedPm21Whether the materials exist or not, the use methods are respectively as follows:
(1) wheat DNA is used as a PCR amplification template, KASP-QPm21_6A is used as a primer, and PCR amplification is carried out, wherein the reaction system is 6 mu L. The reaction system specifically comprises: 20-50 ng/. mu.L of DNA 3. mu.L, 2 XKASP Master mix 3. mu.L, KASP Assaymix (upstream and downstream primer mix) 0.0825. mu.L. Amplified in 384-well PCR instrument.
(2) The PCR amplification program is pre-denaturation at 94 ℃ for 15 min; denaturation at 94 ℃ for 20s, renaturation at 65-57 ℃ for 60s (0.8 ℃ per cycle), 10 cycles; denaturation at 94 ℃ for 20s, renaturation at 57 ℃ for 60s, 30 cycles; storing at 10 deg.C;
(3) after the PCR is finished, placing the sample in an Omega SNP typing instrument to detect the PCR typing result;
(4) analyzing and identifying, wherein if the typing result is 'X: X', the typing result containsPm21If the typing of the disease-resistant gene is Y: Y, the disease-resistant gene is not contained.
The markers can be used in marker assisted breeding.
The marker can be used for screening the powdery mildew resistance gene of wheatPm21The application is as follows.
Compared with the prior art, the research has the following advantages:
(1) the invention developsPm21The diagnostic marker of (1): KASP-QPm21_ 6A;
(2) belongs to KASP markers, has the characteristics of high flux, simple and convenient operation and the like, can be used for high flux screening of large-scale breeding materials, and improves the efficiency of molecular breeding.
Drawings
FIG. 1 shows the design position of the forward primerPm21And aligning with the DNA sequences of 6A, 6B and 6D chromosomes.
FIG. 2 shows KASP-QPm21_6A labeled Yangmai 18 (containingPm21) And Xumai 32 (without)Pm21) The results of typing in the material were 16 replicates each. Wherein the dots near the area A of the transverse axis arePm21Yangmai 18 of the gene, dots near the longitudinal axis B are freePm21Genetic Xumai 32; the dots in the C region are NTC blank controls.
FIG. 3 shows a cross-sectional view of a polycarbonate resin prepared from 2013BP24 (containingPm21) Xumai 32F2:3The population verified the typing results for the KASP-QPm21_6A marker. Wherein the dots near the horizontal axis A represent the R (powdery mildew resistance) genotype, the dots near the vertical axis B represent the S (powdery mildew resistance) genotype, the dots between the powdery mildew resistance genotype and the susceptible genotype (D region) represent the heterozygous genotype, and the dots near the C region represent the NTC blank control.
FIG. 4 shows the use ofPm21Closely linked SSR markers were detected in the natural population to contain 6 sharesPm21Wheat variety with disease-resistant gene.
FIG. 5 shows the results of the typing of KASP-QPm21_6A markers in the natural population. The dots near the area A of the horizontal axis represent dots containingPm21The material of the gene, the dots near the longitudinal axis B representing the absence ofPm21The material of the gene; the dots in the C region represent NTC blank.
Detailed Description
The present invention will be further described with reference to the following examples, which are provided for the purpose of illustration and are not intended to limit the scope of the present invention.
Example 1Pm21And polymorphic SNP analysis and marker development among wheat homologous genes thereof
1.1 materials
Is known to containPm21Transgenic wheat variety Yanmai 18 and does not containPm21The genetic variety Xumai 32.
1.2 methods
1.2.1 DNA sequence alignment and SNP site selection for KASP primer design
Pm21The gene is determined to be a powdery mildew resistant gene from the haynaldia of the wheat family, is successfully introduced into common wheat through a 6VS/6AL translocation line, and is efficiently utilized. We used GenBank accession number (MF 370199) in the literature to obtain on NCBI websitePm21The gene sequence of (a) is searched by a wheat multigroup databasePm21The homologous genes in common wheat in Chinese spring are named as three genes of Pm21-6A, Pm21-6B and Pm21-6D respectively according to the position of a chromosome. The total lengths of the three genes are 13948bp, 15337bp and 7155bp respectively, and the total lengths of the CDS are 2529bp, 2697bp and 2352bp respectively. Using DNAMAN software pairsPm21And the sequence comparison analysis of the coding region of the homologous gene in common wheat finds outPm2173.75 percent of sequence similarity with Pm21-6A,Pm2186.64 percent of sequence similarity with Pm21-6B,Pm21the sequence similarity with Pm21-6D is 69.62%.
By further combiningPm21Comparing with the coding region sequence of homologous gene in common wheat, finding out the SNP locus suitable for KASP primer design,Pm21with homologous genes located on 6APm21-6AThe coding region has 16 polymorphic SNP sites, and is homologous to the gene located at 6BPm21-6BThe coding region has 29 polymorphic SNP sites, and is homologous to the 6D-located homologous genePm21-6DThere were 15 polymorphic SNP sites in the coding region (see Table 1).
1.2.2 extraction of total DNA by CTAB method;
a) placing young leaf of wheat in 2mL centrifuge tube, freezing with liquid nitrogen, and placing in tissue powderGrinding into powder on a grinder; (b) adding 800 μ L CTAB into 2mL tube, placing in 65 deg.C water bath for 90min, and shaking gently for 5-8 times during the water bath period to fully crack DNA; (c) adding 800 μ L chloroform isoamyl alcohol (volume ratio 24: 1) and shaking for 10 min; (d) centrifuging at 12000rpm for 10min, and placing 600 μ L of supernatant in a new 2mL tube (note corresponding number); (e) add 60. mu.L of 3M sodium acetate (pH = 5.2) and 600. mu.L of isopropanol (frozen at-20 ℃ C. in advance), mix with gentle shaking to see the generation of white DNA flocs, and put in a refrigerator at-20 ℃ for 1h to increase DNA yield. (f) Centrifuging at 12000rpm for 10min, pouring out supernatant, washing the precipitate with 70% ethanol (freezing in a refrigerator at-20 deg.C in advance) for 2-3 times, standing in a fume hood, and air drying; (g) add 200. mu.L of ddH2O dissolving the DNA, sucking 2. mu.L of DNA and detecting the quality of the DNA by agarose gel electrophoresis, and storing at-20 ℃ for later use.
1.2.3 design of primers
Comparing the differential SNP sites in a wheat multi-group chemical database to obtain sequences of 150bp (301 bp including SNP) at two ends of the differential SNP sites, and developing KASP primers by using a Polymarker website (http:// www.polymarker.info). The SNP sequence is submitted to a website for processing, chromosome specific SNP is selected from output results, FAM or HEX fluorescent linker sequences are respectively added to the 5' ends of two forward primers according to primer design results, and the primers are delivered to Beijing Rui Boxing Ke biotechnology limited to synthesize KASP.
1.2.4 PCR amplification and fluorescent Signal detection
The primers designed and synthesized according to the above description and the genomic DNA extracted in the previous step were used to perform PCR amplification on a Q-Cycler 96 PCR instrument (Hain Life-science UK ltd. UK), and after the amplification, SNP detection was performed by an Omega SNP typing instrument. The detection judgment standard is mainly determined by the color of a dot and the position on a gathering coordinate axis: the dots are blue, are gathered near the transverse axis and are gathered together with the powdery mildew resistant material, and then the disease-resistant genotype is judged; the dots are red, gather near the vertical axis and gather with the powdery mildew material, and then the disease susceptibility genotype is judged. The specific operation is as follows:
primer dilution and mixing, namely diluting the three primers to 10 mu.M by using ultrapure water/buffer solution, uniformly mixing the three primers according to the proportion of KASP-QPm21_6A-F-FAM, KASP-QPm21_6A-F-HEX, KASP-QPm21_6A-R and ultrapure water/buffer solution =6:6:15:23, and storing the mixture to-20 ℃ for later use.
The PCR amplification system and procedure used were as follows:
a. wheat DNA is used as a PCR amplification template, KASP-QPm21_6A is used as a primer, and PCR amplification is carried out, wherein the reaction system is about 6 mu L. The reaction system specifically comprises: 20-50 ng/. mu.L of DNA 3. mu.L, 2 XKASP Master 3. mu.L, KASP Assay mix (upstream and downstream primer mix) 0.0825. mu.L. Amplified in 384-well PCR instrument.
The PCR amplification procedure is: pre-denaturation at 94 ℃ for 15 min; denaturation at 94 ℃ for 20s, renaturation at 65-57 ℃ for 60s (0.8 ℃ per cycle), 10 cycles; denaturation at 94 ℃ for 20s, renaturation at 57 ℃ for 60s, 35 cycles; storing at 10 deg.C;
c. after the PCR is finished, the PCR typing result is detected in an Omega SNP typing instrument.
1.3 results
1.3.1Pm21Screening of SNP sites corresponding to polymorphism between homologous genes on 6AS
The previous study shows that the wheat is common wheatPm21The loss of resistance of homologous genes is due toPm21All have retrotransposon insertions of different lengths, resulting in gene disruption.
Due to the fact thatPm21After the wheat is transferred, the wheat and 6A chromosome are translocated, and 6AS is replaced by 6 VS. ComprisesPm21The wheat contains 6VS, 6AS and 6ASPm21The wheat of (4) contained 6AS and no 6 VS. Thus, as long as we have designed diagnostic markers that can be distinguishedPm21And the homologous gene on 6AS can distinguish whether the gene containsPm21。
Due to the inclusion ofPm21The disease-resistant materials are 6VS/6AL translocation lines, so that successful identification is requiredPm21In the presence of genes in wheat, the selected differential SNP loci simultaneously meet the following three conditions: (1) the site is simultaneously atPm21AndPm21- 6A、Pm21-6B、Pm21-6Dpolymorphism exists among genes; (2) the site is atPm21-6BAndPm21-6Dabsence of polymorphism; (3) the site is atPm21-6AAndPm21-6BandPm21-6Dpolymorphisms are present. Using the above criteria, SNP sites having only 2 polymorphisms were found by screening, i.e., located respectively atPm21Two SNPs at 802bp and 851bp of the coding region of the gene (Table 1).
TABLE 1 Pm21And SNP types among 6A, 6B and 6D homologous gene cDNA sequences thereofPm21Location of coding region
1.3.2 KASP primer design and genotyping
These two SNPs were converted to KASP markers according to the method described in 1.2.3, and then containedPm21Gene variety Yanmai 18, does not containPm21The genetic cultivar Xumai 32 was subjected to a typing test. Amplifying 16 samples of Yangmai 18 and Xugmai 32 respectively, and carrying out SNP fluorescence signal detection on the amplified samples by using an Omega SNP typing instrument. The typing results showed that the SNP sites (Chr 6A-91870805, i.e.Pm21Coding region 802 position) can separate all 16 Yangmai 18 and Xumai 32 samples, 16 Yangmai 18 are close to the horizontal axis and are disease-resistant genotypes; all 16 of the Xumai 32 samples were near the vertical axis and were genotyped for disease. As shown in FIG. 2, where dots near the horizontal axis represent the R (powdery mildew resistance) genotype and dots near the vertical axis represent the S (powdery mildew resistance) genotype; the black dots represent NTC. Thus, the mark can be accurately distinguished to containPm21Gene and gene do notPm21The gene variety, this marker being preliminarily usedPm21The diagnostic marker of (1), which is designated as KASP-QPm21_ 6A.
According to another SNP site (Chr 6A-91870854, i.e.Pm21Position 851 coding region) were designed so that amplification of the KASP primers did not separate Yangmai 18 from Xugmai 32, possibly the reference genomic sequence from the reference genomic sequencePm21The recipient parent of (a) is not different at this site, so this KASP primer is not effective.
Example 2 validation of diagnostic markers in a segregating population
2.1 materials
ComprisesPm21The wheat germplasm2013BP24 and does not containPm21F constructed by the Xumai 32 hybridization2:3And (4) a group.
2.2 methods
2.2.1 Total DNA extraction CTAB method was used (see example 1 for details)
2.2.2 identification of powdery mildew resistance
F is to be2The colony is planted in a small plastic pot and is placed in an illumination incubator. The conditions are set as follows: the temperature is 19 ℃, the humidity is 80 percent, the illumination is 2000LUX for 12 hours, the temperature is 17 ℃, the humidity is 80 percent, and the darkness is 12 hours. The cells were inoculated with E09 strain at one leaf and one heart stage. The inoculation method is a sweeping method. The disease condition is investigated in the stage of excessive onset. The disease resistance is classified by a 4-grade classification method:
type 0, immunity, no disease spot of the plant;
0; type, necrosis reaction, withered and dead disease spots on leaves;
type 1, the diameter of the disease spot is less than 1mm, the hypha layer is thin, a large disease spot is occasionally seen, and the spore production is very little;
type 2, the diameter of the lesion is less than 1mm, the hypha layer is thicker, and a certain amount of spores are produced;
type 3, many scabs and a diameter larger than 1mm, but no connection, thick hypha layer and large spore yield;
type 4, lesion diameter greater than 1mm, connected slices, thick hypha layer and high spore yield.
Grading the disease resistance: grade 0-2 is classified as disease-resistant type, grade 3-4 is classified as susceptible type.
2.2.3 PCR amplification and detection of fluorescent signals (see example 1 for details)
2.3 results
2.3.1 identification of powdery mildew resistance
F in 181 2013BP24 XXumai 322:3In the family, 41 homozygous disease-resistant lines, 90 heterozygous lines and 50 susceptible lines are provided, and p =0.64 (p)>0.05); the separation ratio of homozygous disease resistance, separation and homozygous susceptible disease is shown to meet the ratio of 1:2: 1.
2.3.2 validation of the segregating population Using the diagnostic marker KASP-QPm21_6A
Pan-wheat 32F with 2013BP24 x using KASP-QPm21_6A2:3The population was genotyped. The results show that the method has the advantages of high yield,the homozygous disease-resistant strains are all close to the transverse axis and are of powdery mildew resistant genotypes; the homozygous susceptible strains are all close to the longitudinal axis and are susceptible genotypes; the gene type is heterozygous between the powdery mildew resistant gene type and the susceptible gene type. Indicating that the marker is effective in distinguishing between different genotypes in a segregating population. In FIG. 3, dots close to the horizontal axis are anti-powdery mildew genotypes R (2013 BP 24), and dots close to the vertical axis are susceptible genotypes S (Xumai 32); the gene type is heterozygous between the powdery mildew resistant gene type and the susceptible gene type.
Example 3 validation of diagnostic markers in the Natural population
3.1 materials
80 wheat varieties are randomly selected to further verify the KASP-QPm21_6A mark.
3.2 methods
3.2.1 Total DNA extraction CTAB method was used (see example 1 for details)
3.2.2 PCR amplification and detection of fluorescent signals (see example 1 for details)
3.2.3 detection of SSR molecular markers
The experiment was well-defined using the previous studyPm21The molecular marker 6VS-09b (Dv-PP 2C) with the closely linked genes was used for genotyping 80 natural populations. The upstream sequence Dv-PP2C-F of the primer is as follows: GCAGGATAGAAATCCATGGCAT, the downstream sequence Dv-PP2C-R is: CAACATCATCCACTCTTGTCTCGTAG are provided.
The specific steps of the marker detection are as follows:
using wheat DNA as PCR amplification template, using 6VS-09b (Dv-PP 2C) SSR as primer to make PCR amplification, its reaction system is 10. mu.L, said reaction system specifically includes 50-100 ng/. mu.L DNA 1. mu.L, 5. mu.L 2 × PCR Mix, upper and lower primers respectively 1. mu.L, 2. mu. L H2O；
b. The PCR amplification procedure is pre-denaturation at 95 ℃ for 3 min; denaturation at 94 ℃ for 30s, renaturation at 64 ℃ for 30s, and extension at 72 ℃ for 60s for 30 cycles; finally, extending for 10min at 72 ℃; storing at 4 deg.C;
c. the electrophoresis is 8% non-denaturing polyacrylamide gel electrophoresis, 0.5 mu L of PCR product is spotted, 120V electrophoresis is carried out for 3h, and silver nitrate staining is carried out for photographing;
d. and (5) counting the banding pattern difference of the natural population.
3.3 results
3.3.1 detection of Natural populations Using SSR markers
By detecting molecular markers in natural population, only 6 fractions containingPm21Wheat variety with disease-resistant gene. As shown in fig. 4, 2013BP24, tulathon 142, tobacco 1212, gumai 301, gumai 09x12, gumai 09x15, respectively.
3.3.2 verification of Natural populations Using diagnostic marker KASP-QPm21_6A
The results of typing of the natural population verified by the KASP-QPm21_6A marker are shown in FIG. 5, and only 6 natural populations containing 80 natural populations were selectedPm21The variety of the disease-resistant gene is completely consistent with the detection result of the SSR marker. Thus, the above verification result indicates that KASP-QPm21_6A isPm21Diagnostic markers for a gene can be used directly for screening of the gene in population material and prediction of resistance performance.
Finally, it should be noted that the above embodiments are only used for illustrating the technical solutions of the present invention and not for limiting, and although the present invention is described in detail with reference to the embodiments, it should be understood by those skilled in the art that modifications or equivalent substitutions can be made on the technical solutions of the present invention without departing from the spirit and scope of the technical solutions of the present invention, and all of them should be covered by the claims of the present invention.
Claims (4)
1. Wheat powdery mildew resistance genePm21The high-throughput SNP diagnostic marker of (1), characterized by: the marker is positioned on the short arm of the 6A chromosome of the common wheat and shows resistance to wheat powdery mildew in the whole growth period, the molecular marker is a single nucleotide polymorphism site, and G/C mutation is carried out at the SNP site;
the marker is a high-throughput SNP marker and comprises 2 forward primers and 1 reverse primer; the primer sequences are as follows:
the nucleotide sequence of the forward primer KASP-QPm21_6A-F-FAM combined with the disease-resistant site is shown as SEQ ID NO: 1:
5＇-ACAATATCTGACGGGATGCTTG- 3＇；
the upstream sequence KASP-QPm21_6A-F-HEX combined with the susceptible site has the nucleotide sequence shown in SEQ ID NO. 2:
5＇-ACAATATCTGACGGGATGCTTC- 3＇；
the reverse primer KASP-QPm21_6A-R has the nucleotide sequence shown in SEQ ID NO. 3:
5＇-CRRGCTTGTTCATTTGGAGAC- 3＇。
2. the wheat powdery mildew resistance gene according to claim 1Pm21The use of a high-throughput SNP diagnostic marker according to (1), characterized in that the marker is used for identification or detectionPm21And whether the current time exists or not, the steps are as follows:
(1) wheat DNA is used as a PCR amplification template, KASP-QPm21_6A is used as a primer, PCR amplification is carried out, the reaction system is 6 mu L, and the reaction system specifically comprises: 20-50 ng/. mu.L of DNA 3. mu.L, 2 XKASP Master mix 3. mu.L, and KASP Assaymix (upstream and downstream primer mixture) 0.0825. mu.L, placing in 384-hole PCR instrument for amplification;
(2) the PCR amplification program is pre-denaturation at 94 ℃ for 15 min; denaturation at 94 ℃ for 20s, renaturation at 65-57 ℃ for 60s (0.8 ℃ per cycle), 10 cycles; denaturation at 94 ℃ for 20s, renaturation at 57 ℃ for 60s, 30 cycles; storing at 10 deg.C;
(3) after the PCR is finished, placing the sample in an Omega SNP typing instrument to detect the PCR typing result;
(4) analyzing and identifying, wherein if the typing result is 'X: X', the typing result containsPm21If the typing of the disease-resistant gene is Y: Y, the disease-resistant gene is not contained.
3. The wheat powdery mildew resistance gene according to claim 2Pm21The use of a high-throughput SNP diagnostic marker of (1), characterized by: the use of said markers in marker assisted breeding.
4. The wheat powdery mildew resistance gene according to claim 2Pm21The use of a high-throughput SNP diagnostic marker of (1), characterized by: the marker is used for screening the powdery mildew resistance gene of wheatPm21The use of (1).
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202010119048.XA CN111719010A (en) | 2020-02-26 | 2020-02-26 | High-throughput SNP diagnostic marker of wheat powdery mildew resistance gene Pm21 and application thereof in breeding |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202010119048.XA CN111719010A (en) | 2020-02-26 | 2020-02-26 | High-throughput SNP diagnostic marker of wheat powdery mildew resistance gene Pm21 and application thereof in breeding |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN111719010A true CN111719010A (en) | 2020-09-29 |
Family
ID=72564059
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202010119048.XA Withdrawn CN111719010A (en) | 2020-02-26 | 2020-02-26 | High-throughput SNP diagnostic marker of wheat powdery mildew resistance gene Pm21 and application thereof in breeding |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN111719010A (en) |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN112410451A (en) * | 2020-11-11 | 2021-02-26 | 中国科学院成都生物研究所 | Primer, detection method and application for specific KASP marker detection of diploid haynaldia villosa 3V chromosome |
| CN113005222A (en) * | 2021-05-12 | 2021-06-22 | 江苏省农业科学院 | Multiplex PCR (polymerase chain reaction) marker primer group for simultaneously detecting wheat scab-resistant gene and powdery mildew-resistant gene and application thereof |
| CN113046466A (en) * | 2020-12-23 | 2021-06-29 | 山东农业大学 | SNP loci significantly associated with wheat powdery mildew resistance and application thereof in genetic breeding |
| CN113106165A (en) * | 2021-04-16 | 2021-07-13 | 烟台大学 | Functional KASP molecular marker of wheat powdery mildew resistance gene Pm12 and application thereof |
-
2020
- 2020-02-26 CN CN202010119048.XA patent/CN111719010A/en not_active Withdrawn
Cited By (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN112410451A (en) * | 2020-11-11 | 2021-02-26 | 中国科学院成都生物研究所 | Primer, detection method and application for specific KASP marker detection of diploid haynaldia villosa 3V chromosome |
| CN112410451B (en) * | 2020-11-11 | 2023-06-09 | 中国科学院成都生物研究所 | Primer for detecting diploid Haynaldia villosa 3V chromosome specific KASP marker, detection method and application |
| CN113046466A (en) * | 2020-12-23 | 2021-06-29 | 山东农业大学 | SNP loci significantly associated with wheat powdery mildew resistance and application thereof in genetic breeding |
| CN113106165A (en) * | 2021-04-16 | 2021-07-13 | 烟台大学 | Functional KASP molecular marker of wheat powdery mildew resistance gene Pm12 and application thereof |
| CN113005222A (en) * | 2021-05-12 | 2021-06-22 | 江苏省农业科学院 | Multiplex PCR (polymerase chain reaction) marker primer group for simultaneously detecting wheat scab-resistant gene and powdery mildew-resistant gene and application thereof |
| CN113005222B (en) * | 2021-05-12 | 2024-01-26 | 江苏省农业科学院 | Multiplex PCR (polymerase chain reaction) labeled primer group for simultaneously detecting wheat scab resistance gene and powdery mildew resistance gene and application thereof |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN111719010A (en) | High-throughput SNP diagnostic marker of wheat powdery mildew resistance gene Pm21 and application thereof in breeding | |
| CN109735652B (en) | Wheat stripe rust resistant gene QYr.nwafu-6BL.2 linked KASP molecular marker, primer and application | |
| CN109468315B (en) | Rice flooding-resistant gene Sub1 codominant molecular marker and application thereof | |
| CN110923352B (en) | KASP marker of wheat powdery mildew resistance gene PmDTM and application thereof | |
| US8809623B2 (en) | Genetic loci associated with resistance to tropical rust in maize | |
| Simko et al. | Association mapping and marker-assisted selection of the lettuce dieback resistance gene Tvr1 | |
| CN113249509B (en) | Identification primer and identification method for interspecific hybrid progeny of populus jaborandi and populus microphylla | |
| Hu et al. | Fine mapping of a major quantitative trait locus, qgnp7 (t), controlling grain number per panicle in African rice (Oryza glaberrima S.) | |
| CN114480709B (en) | Molecular marker for detecting wheat leaf rust resistance gene Lr47, detection method and application thereof | |
| CN114457091B (en) | Gene Taxip affecting quality of wheat grains and application thereof | |
| CN113046464B (en) | Molecular marker for screening soybean material, screening method, breeding method and application | |
| CN113046466B (en) | SNP locus obviously associated with wheat powdery mildew resistance and application of SNP locus in genetic breeding | |
| TIAN et al. | Genetic analysis and QTL mapping of mature seed culturability in indica rice | |
| CN108546778B (en) | SNP molecular marker for detecting powdery mildew resistance of cucumber and application thereof | |
| CN113046465A (en) | SNP loci obviously associated with cold resistance of wheat and application of SNP loci in genetic breeding | |
| JP3999254B2 (en) | Genetic markers linked to loci involved in resistance to barley stripe dwarf disease and their utilization | |
| CN115820895B (en) | Molecular marker closely linked with chlorophyll content of corn and application thereof | |
| CN112980993B (en) | SNP molecular marker linked with major QTL site qPSIIB10 for resisting aspergillus flavus infection of peanuts and application thereof | |
| CN114902957B (en) | DNA molecule for improving induction rate of corn haploid induction line | |
| CN109338001B (en) | Molecular marker for identifying rice semi-dwarf gene sd1 allele and dwarf gene identification method | |
| CN109468400B (en) | Rice blast resistance gene Pi36 codominant molecular marker and application thereof | |
| Hu | Genetic linkage maps: strategies, resources and achievements | |
| CN108060246B (en) | Haplotype related to upland cotton No. 7 chromosome fiber strength | |
| Lee et al. | QTL Analysis of Rice Grain Size Using Segregating Populations Derived from the Large Grain Line. Agriculture 2021, 11, 565 | |
| Yaoyao et al. | Simultaneously mapping loci related to two plant architecture traits by Phenotypic Recombination BSA/BSR in peanut (Arachis hypogaea L.) |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| WW01 | Invention patent application withdrawn after publication | ||
| WW01 | Invention patent application withdrawn after publication |
Application publication date: 20200929 |