CN113046466A - SNP loci significantly associated with wheat powdery mildew resistance and application thereof in genetic breeding - Google Patents
SNP loci significantly associated with wheat powdery mildew resistance and application thereof in genetic breeding Download PDFInfo
- Publication number
- CN113046466A CN113046466A CN202110397651.9A CN202110397651A CN113046466A CN 113046466 A CN113046466 A CN 113046466A CN 202110397651 A CN202110397651 A CN 202110397651A CN 113046466 A CN113046466 A CN 113046466A
- Authority
- CN
- China
- Prior art keywords
- wheat
- dna
- powdery mildew
- snp
- triticum aestivum
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6858—Allele-specific amplification
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/13—Plant traits
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
- Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change
Abstract
The invention discloses a group of (58) SNP loci which are obviously associated with wheat powdery mildew resistance and an application method thereof in genetic breeding. These SNPs were identified by simplified genome sequencing (GBS) discovery of Single Nucleotide Polymorphism Sites (SNPs) for 768 wheat varieties and elite lines, followed by disease resistance identification and whole genome association analysis. The SNP locus has high accuracy, can be converted into KASP markers and SNP chips, and is used for the positioning, fine mapping and candidate gene identification of wheat powdery mildew resistant genes and the selective breeding of wheat powdery mildew resistant whole genomes.
Description
Technical Field
The invention relates to the technical field of plant molecular markers, in particular to a group of SNP (Single nucleotide polymorphism) which are obviously associated with powdery mildew resistance gene loci of wheat and application thereof in inheritance and molecular breeding of powdery mildew resistance.
Background
Wheat powdery mildew is caused by powdery mildew (Buchner's Blumeria graminis: (A)Blumeria graminis f. sp. tritici) The caused aerofacsimile bacterial disease is a worldwide disease and is distributed in all major wheat producing countries. In recent years, with the adjustment of farming systems and the continuous change of climate, the disease is increasingly serious in several main wheat areas such as northeast, north China, Huang-Huai and southwest of China. The disease mainly occurs in seedling stage and adult stage, mainly affects leaves and leaf sheaths, and can also affect glumes and miscanthus sinensis when the disease is serious. Wheat powdery mildew generally causes 5% -45% of yield loss in popular years, and the field with serious disease can reach 50% or even be out of production. Therefore, the method for mining the powdery mildew resistance gene of the wheat and applying the powdery mildew resistance gene to wheat breeding has important significance for preventing and treating the powdery mildew of the wheat, improving the quality of the wheat and ensuring the high and stable yield of the wheat.
Chemical prevention and breeding of disease-resistant varieties is an effective means for resisting powdery mildew. However, long-term use of the medicament for prevention and treatment can cause a series of problems of drug resistance of pathogenic bacteria, environmental pollution and the like; the identification utilizes the powdery mildew resistance gene to breed disease-resistant varieties, not only solves the problem of environmental pollution, but also improves the genetic composition of wheat and increases the yield of wheat, thus being the most economical, safe and effective measure for preventing and treating the powdery mildew of wheat.
The genetic research of wheat powdery mildew resistance is carried out, the genetic structure for knowing the powdery mildew resistance, the mapping and cloning of disease-resistant genes and the purposeful selection of the disease-resistant genes in breeding are carried out, and the genetic research plays an important role in improving the powdery mildew resistance of bred varieties. The molecular marker technology is the most commonly used technology for breeding researches such as inheritance of wheat related traits, gene mapping, marker-assisted breeding, genome selective breeding and the like. The commonly used DNA molecular markers include RFLP (restriction fragment length polymorphism), SSR (simple repeat sequence), SNP (single nucleotide polymorphism), and the like. The traditional molecular markers such as RFLP, SSR and the like have the limitations of low flux, small quantity, complicated operation process and the like, and can not meet the requirements of genetic and breeding research. The SNP markers are extremely abundant in the genome, have two-state property, are easy to carry out high-throughput automatic detection, and are the molecular marker technology with the greatest application prospect in genetic research and breeding.
Currently, the high-throughput detection technology for SNPs mainly includes sequencing and DNA chip technology. The high density of SNP markers can be obtained by DNA resequencing of sample materials using sequencing techniques, but the cost of resequencing is high. The simplified genome sequencing-by-sequencing (GBS) is to firstly perform enzyme digestion and other methods on genome DNA to reduce the complexity of the genome, construct a low-complexity genome DNA library, and then perform deep sequencing by using a second-generation sequencing technology, thereby reducing the sequencing cost to a certain extent. The technology of constructing a DNA library by treating genomic DNA with two restriction enzymes and identifying SNPs by sequencing in wheat has been developed. However, the deep sequencing cost is still high for the huge genome (16G) relative to wheat, and the process of GBS data processing, sequence alignment, genotyping and the like has high requirements on data analysis, and the process can be completed only by personnel with professional bioinformatics background, so that the deep sequencing cost is difficult for general breeders to master and utilize.
Disclosure of Invention
The development of molecular markers is needed in the processes of mapping, gene cloning and molecular marker assisted selection breeding for controlling important Quantitative Trait Loci (QTL) of wheat. The traditional SSR marker has low flux and small quantity, and is a KASP (Kompetitive Allele Specific PCR) marker based on the transformation of SNP sites, namely a competitive Allele Specific PCR technology, which can carry out accurate double Allele judgment on SNPs and InDels on Specific sites in a wide range of genome DNA samples. The method has the characteristics of high stability, accuracy, low cost and high flux, can be widely applied to gene positioning, fine mapping and cloning of genes and high-flux screening of large-scale breeding materials, and has important utilization value in genetic research, molecular marker-assisted breeding and genome selective breeding.
Aiming at the defects in the prior art, the invention utilizes GBS technology to carry out simplified genome sequencing on 768 wheat varieties (lines) from the main production area of wheat in China, obtains SNP sites with high density throughout the whole genome, identifies the SNP sites obviously associated with powdery mildew resistance through field disease resistance identification and whole genome association analysis, can be widely applied to the development of KASP markers, the location of powdery mildew resistance genes, mapping, marker auxiliary selection and whole genome selection, and lays an important foundation for genetic research and molecular breeding of the powdery mildew resistance genes of wheat.
The invention provides a set of SNP (Single nucleotide polymorphism) which is obviously related to wheat powdery mildew resistance, can be used for developing KASP (Kasan protein polymorphism) markers and SNP chips, and is widely applied to marker-assisted selection and whole genome selection of single or multiple disease-resistant QTL (quantitative trait loci) in mapping, fine mapping and cloning of wheat powdery mildew resistance genes and breeding.
The technical scheme adopted by the invention is as follows:
the invention provides a group of (58) Single Nucleotide Polymorphism (SNP) sites which are obviously related to the disease resistance of wheat powdery mildew, comprising SNP flanking sequences, SNP site information and base mutation information, wherein the SNPs are positioned on 17 chromosomes of common wheat.
The group of SNP loci which are obviously associated with wheat powdery mildew resistance provided by the invention comprises 58 SNP loci, the number of the SNP loci is respectively 01-58, and the information of the SNP loci is as follows:
the physical position in the table takes the Chinese spring genome IWGSC reference genome v1.1 (IWGSC, 2018) as a reference sequence;
the sequences listed in the table are shown in sequence tables SEQ ID NO. 1-SEQ ID NO. 116.
The SNP loci obviously associated with wheat powdery mildew resistance provided by the invention can be applied to identification of wheat powdery mildew resistance.
The SNP loci obviously associated with wheat powdery mildew resistance provided by the invention can be applied to preparation of a wheat powdery mildew resistance identification kit.
The SNP loci which are obviously associated with wheat powdery mildew resistance and provided by the invention can be applied to the preparation of a single detectable SNP marker or a gene chip.
The SNP loci obviously associated with wheat powdery mildew resistance provided by the invention can be applied to the preparation of KASP marker k6A86486 co-separated from powdery mildew resistant gene locus qPm6A.3.
The SNP loci obviously associated with wheat powdery mildew resistance provided by the invention can be applied to a wheat powdery mildew resistance identification and detection method.
In the application of the detection method, KASP primers can be designed according to SNP sites, and are designed according to DNA short sequences which comprise 50bp of the upstream and downstream of the SNP sites. Specifically, a website PolyMarker (http:// www.polymarker.info /) is used for primer design, and default parameter setting of the website is adopted. The primer is added with a joint, the FAM sequence is GAAGGTGACCAAGTTCATGCT, and the HEX sequence is GAAGGTCGGAGTCAACGGATT.
After the primers are designed and synthesized, the effectiveness detection can be carried out by utilizing a separation population or a natural population, and whether the QTL identified by GWAS exists or not is verified, and the using methods are respectively as follows:
(1) wheat DNA is used as a PCR amplification template, and a synthesized KASP primer is designed to carry out PCR amplification, wherein the reaction system is 6 mu L. The reaction system specifically comprises: 20-50 ng/. mu.L of DNA 3. mu.L, 2 XKASP Master mix 3. mu.L, and KASP Assay mix (upstream and downstream primer mix) 0.0825. mu.L. Amplified in 384-well PCR instrument.
(2) The PCR amplification program is pre-denaturation at 94 ℃ for 15 min; denaturation at 94 ℃ for 20s, renaturation at 65-57 ℃ for 60s (0.8 ℃ per cycle), 10 cycles; denaturation at 94 ℃ for 20s, renaturation at 57 ℃ for 60s, 30 cycles; storing at 10 deg.C;
(3) after the PCR is finished, placing the sample in an Omega SNP typing instrument to detect the PCR typing result;
(4) analyzing and identifying, and analyzing the genotype according to the typing result.
The invention has the beneficial effects that:
(1) the present invention identifies a set of (58) SNPs that are significantly associated with wheat powdery mildew resistance. Basically covers most of powdery mildew resistant gene loci contained in wheat germplasm in China at present.
(2) The SNP can be further converted into KASP markers, and is used for fine mapping and cloning of powdery mildew resistance genes, and molecular marker assisted selection and gene polymerization which are applied to breeding materials in a large scale, so that the efficiency of molecular breeding is improved.
(3) The SNPs can also be made into gene chips, and can be applied to the whole genome selection of powdery mildew disease resistance of breeding materials, so that the efficiency and accuracy of molecular breeding are further improved.
(4) Develops the gene locus resisting powdery mildewqPm6A.3The co-isolated KASP marker k6A86486, not only proved that the SNP we identified was very effective, but also wasqPm6A.3The marker assisted selection provides good high-throughput identification markers。
Drawings
FIG. 1 is a Manhattan plot (left) and a QQ plot (right) of a whole genome association analysis for powdery mildew resistance.
Detailed Description
Example 1 identification of SNPs by simplified genomic sequencing
1.1 sequencing materials
768 wheat varieties (lines) are selected for simplified genome sequencing and SNP identification. The wheat varieties (lines) mainly come from the main wheat producing areas of China, including Huang-Huai wheat areas, northern winter wheat areas, Yangtze river middle and lower wheat areas and southwest wheat areas.
Research method
1.2.1 extraction of wheat genomic DNA
Seedling leaves were used to provide genomic DNA. The DNA extraction adopts a modified CTAB method. The method comprises the following specific operations: taking young and tender wheat leaves in a 2mL centrifuge tube, freezing by using liquid nitrogen, and grinding into powder on a tissue grinder; (b) adding 800 μ L CTAB into 2mL tube, placing in 65 deg.C water bath for 90min, and shaking gently for 5-8 times during the water bath period to fully crack DNA; (c) adding 800 μ L chloroform isoamyl alcohol (volume ratio 24: 1) and shaking for 10 min; (d) centrifuging at 12000rpm for 10min, and placing 600 μ L of supernatant in a new 2mL tube (note corresponding number); (e) add 60. mu.L of 3M sodium acetate (pH = 5.2) and 600. mu.L of isopropanol (frozen at-20 ℃ C. in advance), mix with gentle shaking to see the generation of white DNA flocs, and put in a refrigerator at-20 ℃ for 1h to increase DNA yield. (f) Centrifuging at 12000rpm for 10min, pouring out supernatant, washing the precipitate with 70% ethanol (freezing in a refrigerator at-20 deg.C in advance) for 2-3 times, standing in a fume hood, and air drying; (g) add 200. mu.L of ddH2O dissolves the DNA.
Sample quality detection
And detecting by using agarose gel electrophoresis with the mass fraction of 1%, and checking an electrophoresis result by using a gel imaging system to ensure the integrity of the genome DNA. The ratio of A260/280 of the genomic DNA should be between 1.8 and 2.0, and the ratio of A260/230 should be between 1.8 and 2.2. The DNA was diluted to a working concentration of 20 ng/ul. Storing at-20 deg.C for use.
Library construction and GBS sequencing
Construction of GBS DNA libraries was performed with reference to Poland et al. (2012 b). Genomic DNA was digested with two restriction enzymes PstI and MspI (New England BioLabs, Inc., Ipswich, MA, United States). The barcode sequence was ligated to the digested DNA fragment using T4(New England BioLabs, Inc., Ipswich, MA, United States) ligase. All products from each plate were mixed and purified using QIAq rapid PCR purification kit (Qiagen, inc., Valencia, CA, United States). PCR amplification was performed using primers complementary to the barcode sequence. The PCR products were again purified using the QIAquick PCR purification kit and the concentration was determined using the Qubit ™ double-stranded DNA high-sensitivity fluorescent quantitation kit (Life Technologies, Inc., Grand Island, NY, United States). The 200-size 300-size DNA fragments were screened by agarose gel electrophoresis (Life Technologies, Inc., Grand Island, NY, United States), and the concentration of each DNA library was estimated using the Qubit 2.0 fluorescent agent and the Qubit double-stranded DNA high sensitivity fluorescence quantification kit. Fragment size-screened DNA libraries were loaded onto P1v3 chips using an Ion CHEF instrument (Ion PI Hi-Q CHEF Kit) and sequenced using an Ion Proton sequencer (Life Technologies, Inc., Grand Island, NY, United States, software version 5.10.1). This Ion Torrent system can produce sequences of various read lengths.
Site identification
The sequencing sequence was sequenced by adding 80 poly-A bases to its 3' end and then using TASSEL 5.0, so that it was possible to process sequences shorter than 64 bases by the train Analysis by Association, Evolution and Linkage (TASSEL) pipeline 5.0 (TASSEL 5.0) (Bradbury et al, 2007) rather than just discarding these short sequences. Sequence alignment is carried out by taking the IWGSC reference gene v1.1 (IWGSC, 2018) of the Chinese spring genome as a reference sequence and using TASSEL 5.0 (Bradbury et al, 2007) to identify SNP sites. All parameters are set to default settings of TASSEL 5.0. A total of 432,588 SNP sites were obtained covering approximately 14Gb of the whole genome, with an average distance between markers of 34.0 kb. Wherein 150784 sites on the A genome are spaced at an average distance of 32.9 kb; 182192 loci on the B genome with an average spacing of 28.9 kb; the D genome has 99612 sites and the average distance is 40.3 kb. The number of SNP markers on each chromosome is 10177 to 31149, and the variation range of the marker interval is 26.1-50.1 kb. These SNPs were mainly located in the intergenic region, 364203, accounting for 84.1, followed by the CDS region, 39901 (9.2%), the intron region 22215 (5.1%), the 5 'UTR region 3543 (0.8%), and the 3' UTR region 3300 (0.8%).
TABLE 1 distribution of SNP sites identified by GBS in wheat genome
Example 2 Whole genome identification of anti-powdery mildew genetic loci
2.1 materials
768 wheat varieties (lines) from the main wheat producing areas of China including Huang-Huai wheat areas, northern winter wheat areas, the middle and lower reaches of Yangtze river and the southwest wheat areas are the same as the example 1.
2.2 methods
2.2.1 identification of powdery mildew resistance
In order to identify the resistance of the material to powdery mildew, 768 wheat varieties (lines) are planted in a disease identification nursery of a Taian Shandong agriculture university laboratory station in the years of 2017-2018 (TA17), 2018-2019 (TA18) and 2019-2020 (TA19) for identifying the resistance to powdery mildew through artificial inoculation identification. Meanwhile, the materials are planted in tobacco stage (YT), Luoyang (LY) and Guiyang (GY) in 2017-2018, and the resistance to powdery mildew is identified by using natural disease conditions of the field. Gabby red and majoram 169 were used as susceptibility control materials under all experimental conditions. Each material was planted in 1 row, 3m long, 25 cm row spacing.
The artificial inoculation identification and identification of powdery mildew resistance is to inoculate a physiological race E09 of powdery mildew of wheat which is popular in northern China after wheat in spring begins. The inoculation mode is to inoculate powdery mildew by shaking the powdery mildew spores on the susceptible control materials directly on the plants.
In the middle and late 5 months, 768 materials were identified for disease resistance when the disease-affected material was sufficiently diseased. Identification of resistance using a 0-4 scale method, 0 = no overt symptoms or necrotic spots; 1 = little and very small clumps of spores; 2 = small or medium, relatively dispersed sporangium; 3 = moderate to very large in sporangium, large in number; 4 = widespread megaspore pile.
2.2.2 Whole genome Association analysis
And (3) further screening the SNP sites with the Minimum Allele Frequency (MAF) of more than 0.01 and the deletion rate of less than 80% of all the identified 432588 SNP sites to obtain 327609 SNPs. Genome-wide association analysis was performed for powdery mildew resistance. The GAPIT v.3 package was used, which uses EMMA, a Compressed Mixed Linear Model (CMLM) and a population parameters previous determined (P3D) to improve the efficiency of GWAS operation. Kinship was analyzed using EMMA algorithm, using the first 3 principal components to control population structure. Significance threshold was set at 1.0 × 10-5。
2.3 results
2.3.1 Whole genome Association analysis of disease resistance genes
By carrying out GWAS on resistance reaction of powdery mildew under multiple environments, 158 associated loci (MTAs) are identified in total, and 53 powdery mildew resistant QTLs are combined according to LD. 26 of these QTLs were located within the 1.0Mb interval, each containing less than 10 annotated genes. The GWAS can position the powdery mildew resistance QTL in a smaller physical interval by using the high-density SNP marker identified by the inventor, thereby greatly facilitating the fine positioning of the follow-up QTL, gene cloning and molecular marker-assisted breeding. See fig. 1.
For the powdery mildew resistance QTL intervals identified by GWAS, one SNP most significantly associated in each environment is selected in each interval, and 58 powdery mildew resistance SNP loci are obtained in total, which is shown in Table 2. In the table, a QTL column indicates the name of the SNP-linked powdery mildew resistant QTL; in the table, a list of 'chromosomes and physical positions of SNPs' indicates the chromosomes and the physical positions of the SNPs, and the physical positions refer to IWGSC reference gene v1.1 (IWGSC, 2018) of the Chinese spring genome; in the table, "sequence and SNP variation site" is listed, and "base" in "[ ]" indicates a variation site, and some sites have only one base, indicating that the base is deleted after variation.
TABLE 2 SNP site information significantly associated with wheat powdery mildew resistance
Example 3 wheat powdery mildew resistance GeneqPm6A.3Verification and mapping of
3.1 materials
The research material comprises a parent 2013BP24 resisting powdery mildew, a susceptible parent Xumai 32 and F constructed by hybridization of the two6A population of recombinant inbred lines, comprising a total of 126 recombinant inbred lines. Hui county red and Mingxian 169 are used as susceptible controls.
3.2 methods
3.2.1 phenotypic identification of disease resistance
In the same manner as in example 1, identification method of powdery mildew resistance
3.2.2 DNA extraction
The same as in example 1.
3.2.3 KASP primer design, dilution:
according to the GWAS analysis result, the gene is related to the powdery mildew resistant QTL locusqPm6A.3The significantly associated SNP (6A _ 86486561) designed a set of (three in total) KASP primers k6A86486 based on the SNP site information. The three primers of the group of primers are diluted to 100 mu M by ultrapure water, and then the volume ratio of the forward primer-FAM-R: forward primer-HEX-S: reverse primer: ultrapure water = 6: 6: 15: 23, and storing the mixture to-20 ℃ for later use.
3.2.4 KASP PCR amplification System and procedure are as follows:
the KASP reaction system used a 6 μ L system:
the system was prepared on ice according to the following table, 3. mu.L (about 20 ng/. mu.L) of template DNA, 2 × Master mix 3. mu.L (LGC Group UK), and 0.0825. mu.L of KASP assay primer (synthesized by Shanghai Biotech).
The PCR procedure was as follows:
pre-denaturation at 1.94 ℃ for 5 min;
denaturation at 2.94 ℃ for 20 s;
3.65 ℃ for 30s (0.8 ℃ per cycle), and steps 2-3 are cycled 10 times.
Denaturation at 4.94 ℃ for 20 s;
annealing at 5.57 deg.C for 30s, and circulating step 4-5 for 35 times.
Storing at 6.10 deg.C. And (5) signal detection.
3.3 results
3.3.1 isolation of powdery mildew resistance in RIL population
The results of the GWAS analysis show that,qPm6A.3is a QTL for controlling the wheat powdery mildew resistance and is positioned in the interval of 63.9-107.7 Mb on 6 AS. To further validate this QTL and develop KASP markers linked to it, hybridization of 2013BP24 with xumai 32 was used to construct F6A population of recombinant inbred lines.
The identification of powdery mildew resistance of the population shows that F6The resistance of the powdery mildew has obvious separation of resistance and infection. Wherein 64 RILs are used for disease resistance, 62 RILs are used for disease susceptibility, and the chi Fang test meets the following requirements: feeling = ratio of 1:1 (P ≦ 0.001).
4.3.2 genotype vs. disease resistance in RIL populations
After converting the GBS-SNP (6A _ 86486561) most significantly associated with the QTL into a KASP (k 6A 86486) marker, the population was genotyped, indicating that this KASP marker was able to type the RIL population. Analysis of genotype and disease resistance expression shows that the marker completely corresponds to disease resistance, RIL with the same genotype as that of the disease resistant parent expresses disease resistance, and RIL with the same genotype as that of the susceptible parent expresses susceptible disease. The interval and cloned powdery mildew resistant genePm21Are overlapping, using one found in predecessors andPm21co-segregating SSR markers6VS-09bGenotyping was also performed in this population, with the results being identical to those of k6A5846, and co-segregating with resistance to powdery mildew, indicatingqPm6A.3May be thatPm21Has important utilization value in breeding.
The foregoing is only a preferred embodiment of this patent, and it should be noted that, for those skilled in the art, various modifications and substitutions can be made without departing from the technical principle of this patent, and these modifications and substitutions should also be regarded as the protection scope of this patent.
Sequence listing
<110> Shandong university of agriculture
<120> a group of SNP loci significantly associated with wheat powdery mildew resistance and application thereof in genetic breeding
<150> 2020115449733
<151> 2020-12-23
<160> 116
<170> SIPOSequenceListing 1.0
<210> 1
<211> 101
<212> DNA
<213> wheat (Triticum aestivum)
<400> 1
gcggtagcat accatccagc ccatcgtggt ggctgcacgc tgcagccatg atggccttct 60
tgtgagcagc acaccatact gtacctgatt ttgcagctcc g 101
<210> 2
<211> 101
<212> DNA
<213> wheat (Triticum aestivum)
<400> 2
gcggtagcat accatccagc ccatcgtggt ggctgcacgc tgcagccatg ttggccttct 60
tgtgagcagc acaccatact gtacctgatt ttgcagctcc g 101
<210> 3
<211> 101
<212> DNA
<213> wheat (Triticum aestivum)
<400> 3
gccaccatgt ctgaccctca tgggacgcag tcatgccgct gcttaatctc cctgcacctc 60
gtcgcttgct gctaggccct gcagctccag tcatcccatg c 101
<210> 4
<211> 101
<212> DNA
<213> wheat (Triticum aestivum)
<400> 4
gccaccatgt ctgaccctca tgggacgcag tcatgccgct gcttaatctc tctgcacctc 60
gtcgcttgct gctaggccct gcagctccag tcatcccatg c 101
<210> 5
<211> 101
<212> DNA
<213> wheat (Triticum aestivum)
<400> 5
tctttctaat gccgcataca accctgcagt ccacccaagg aggatcttcc cgcttcgtcg 60
agcgggtcct tgggtgcgtc ggatatggat tcccttccga c 101
<210> 6
<211> 101
<212> DNA
<213> wheat (Triticum aestivum)
<400> 6
tctttctaat gccgcataca accctgcagt ccacccaagg aggatcttcc agcttcgtcg 60
agcgggtcct tgggtgcgtc ggatatggat tcccttccga c 101
<210> 7
<211> 101
<212> DNA
<213> wheat (Triticum aestivum)
<400> 7
aacaacaaca gcacgagctg cagctgcaag ctgaatcaac gcagcagcaa tggcagtagg 60
cggtgcaggg actgcgggcg gcggcttcag cagaagcagc a 101
<210> 8
<211> 101
<212> DNA
<213> wheat (Triticum aestivum)
<400> 8
aacaacaaca gcacgagctg cagctgcaag ctgaatcaac gcagcagcaa cggcagtagg 60
cggtgcaggg actgcgggcg gcggcttcag cagaagcagc a 101
<210> 9
<211> 102
<212> DNA
<213> wheat (Triticum aestivum)
<400> 9
agatgaacgc gagcagcccg acggcgacga tgtacctgac gagccagccg ccaacacgta 60
cgcaccaaat gttagttgac tacgctcaca cgccacgcaa cc 102
<210> 10
<211> 101
<212> DNA
<213> wheat (Triticum aestivum)
<400> 10
agatgaacgc gagcagcccg acggcgacga tgtacctgac gagccagccg caacacgtac 60
gcaccaaatg ttagttgact acgctcacac gccacgcaac c 101
<210> 11
<211> 101
<212> DNA
<213> wheat (Triticum aestivum)
<400> 11
tccactgtgt gatgcaatgt gatccacctc tggatataat ctctcagggt ctcattcgac 60
ttttgcacac aaacctgcag ctctgtcaac ccttatggtc g 101
<210> 12
<211> 101
<212> DNA
<213> wheat (Triticum aestivum)
<400> 12
tccactgtgt gatgcaatgt gatccacctc tggatataat ctctcagggt atcattcgac 60
ttttgcacac aaacctgcag ctctgtcaac ccttatggtc g 101
<210> 13
<211> 101
<212> DNA
<213> wheat (Triticum aestivum)
<400> 13
ggcctcttcc tctccatctt gaccacacca gagcatcacc cacctcccca cgaccatcac 60
ccgagctcca tttcttcctc tccgcggctg catcttcgtg t 101
<210> 14
<211> 101
<212> DNA
<213> wheat (Triticum aestivum)
<400> 14
ggcctcttcc tctccatctt gaccacacca gagcatcacc cacctcccca tgaccatcac 60
ccgagctcca tttcttcctc tccgcggctg catcttcgtg t 101
<210> 15
<211> 101
<212> DNA
<213> wheat (Triticum aestivum)
<400> 15
actctcgacc tcgcccgtcc aagccgaacg aaaacgatga tctgcagaag aagaacctgg 60
aggagtctaa ctctcgcgcc gaggtagatt aatccgaccg g 101
<210> 16
<211> 101
<212> DNA
<213> wheat (Triticum aestivum)
<400> 16
actctcgacc tcgcccgtcc aagccgaacg aaaacgatga tctgcagaag cagaacctgg 60
aggagtctaa ctctcgcgcc gaggtagatt aatccgaccg g 101
<210> 17
<211> 101
<212> DNA
<213> wheat (Triticum aestivum)
<400> 17
aacctgttcc agaaggacat ctacacggcg gtggagtggc tgccgagggc ggacaccatg 60
aacgcgctgc aggagatgtt caagatctcg cgcgcgcaga c 101
<210> 18
<211> 101
<212> DNA
<213> wheat (Triticum aestivum)
<400> 18
aacctgttcc agaaggacat ctacacggcg gtggagtggc tgccgagggc agacaccatg 60
aacgcgctgc aggagatgtt caagatctcg cgcgcgcaga c 101
<210> 19
<211> 101
<212> DNA
<213> wheat (Triticum aestivum)
<400> 19
gatcttcagt ctcaaggctg ctgctgctgc tgcagagtgg ggctgatggt ttgatcctgt 60
atctcattaa agacgccatc tcgtccatct gcacacagag c 101
<210> 20
<211> 101
<212> DNA
<213> wheat (Triticum aestivum)
<400> 20
gatcttcagt ctcaaggctg ctgctgctgc tgcagagtgg ggctgatggt atgatcctgt 60
atctcattaa agacgccatc tcgtccatct gcacacagag c 101
<210> 21
<211> 101
<212> DNA
<213> wheat (Triticum aestivum)
<400> 21
agacgtagct tcagggtcga agagcgggtt attgaaaggc gcgatcttgc caggaagatt 60
gcggcggact ggaggactta tgagagtcct gcccgccaca g 101
<210> 22
<211> 101
<212> DNA
<213> wheat (Triticum aestivum)
<400> 22
agacgtagct tcagggtcga agagcgggtt attgaaaggc gcgatcttgc gaggaagatt 60
gcggcggact ggaggactta tgagagtcct gcccgccaca g 101
<210> 23
<211> 102
<212> DNA
<213> wheat (Triticum aestivum)
<400> 23
cgacagtgct aacctgcagt aaatcgccgt ccataaaaag cataccccag aaaaagatca 60
agctagcaca acacacacac caactacatt catgaaaaag ga 102
<210> 24
<211> 101
<212> DNA
<213> wheat (Triticum aestivum)
<400> 24
cgacagtgct aacctgcagt aaatcgccgt ccataaaaag cataccccag aaaagatcaa 60
gctagcacaa cacacacacc aactacattc atgaaaaagg a 101
<210> 25
<211> 101
<212> DNA
<213> wheat (Triticum aestivum)
<400> 25
caacacgagg acggtgaaag cgtccaagcc ggcgccagcc ttgcggactc aggcgtcagc 60
agtcctgttg ggaggagctt gccgaccgtc gaagaacagc c 101
<210> 26
<211> 101
<212> DNA
<213> wheat (Triticum aestivum)
<400> 26
caacacgagg acggtgaaag cgtccaagcc ggcgccagcc ttgcggactc gggcgtcagc 60
agtcctgttg ggaggagctt gccgaccgtc gaagaacagc c 101
<210> 27
<211> 101
<212> DNA
<213> wheat (Triticum aestivum)
<400> 27
ttctaatcta atgctgcagc catttagacc cttcagtttt ggtgccatca gccggacaac 60
agaggctgcg ccgtaacctc cctgttcggc taccaccact t 101
<210> 28
<211> 101
<212> DNA
<213> wheat (Triticum aestivum)
<400> 28
ttctaatcta atgctgcagc catttagacc cttcagtttt ggtgccatca accggacaac 60
agaggctgcg ccgtaacctc cctgttcggc taccaccact t 101
<210> 29
<211> 101
<212> DNA
<213> wheat (Triticum aestivum)
<400> 29
gtgtccacct ccacctccgc cacgtcctca tcttgcgccg ccgccaactg atatttctgc 60
agctccaaca tctgacagcg gatggattgc atgataattc t 101
<210> 30
<211> 101
<212> DNA
<213> wheat (Triticum aestivum)
<400> 30
gtgtccacct ccacctccgc cacgtcctca tcttgcgccg ccgccaactg gtatttctgc 60
agctccaaca tctgacagcg gatggattgc atgataattc t 101
<210> 31
<211> 101
<212> DNA
<213> wheat (Triticum aestivum)
<400> 31
ccgccgcccg accccgacgg ccccatggcg ttcccgggcc acctgcagcc actcttcgac 60
gcgttctgcg accacgccgc ggccccgctc gggcgcctcc t 101
<210> 32
<211> 101
<212> DNA
<213> wheat (Triticum aestivum)
<400> 32
ccgccgcccg accccgacgg ccccatggcg ttcccgggcc acctgcagcc gctcttcgac 60
gcgttctgcg accacgccgc ggccccgctc gggcgcctcc t 101
<210> 33
<211> 102
<212> DNA
<213> wheat (Triticum aestivum)
<400> 33
atgtgattac tgcagtctct ggcagcgtcg acggcctgtg agaggtcgcc agtgaaatca 60
ctctgcttga cagccccttc accttctgtc actgtggcct gc 102
<210> 34
<211> 101
<212> DNA
<213> wheat (Triticum aestivum)
<400> 34
atgtgattac tgcagtctct ggcagcgtcg acggcctgtg agaggtcgcc gtgaaatcac 60
tctgcttgac agccccttca ccttctgtca ctgtggcctg c 101
<210> 35
<211> 101
<212> DNA
<213> wheat (Triticum aestivum)
<400> 35
accgcgatgg cgacgctggt gctctccccg ccgtcgagcc cgcgcgccat cgtcatgctc 60
cgccacaggt gcgccaccac gcactgcagg gtgctgcacg g 101
<210> 36
<211> 101
<212> DNA
<213> wheat (Triticum aestivum)
<400> 36
accgcgatgg cgacgctggt gctctccccg ccgtcgagcc cgcgcgccat tgtcatgctc 60
cgccacaggt gcgccaccac gcactgcagg gtgctgcacg g 101
<210> 37
<211> 102
<212> DNA
<213> wheat (Triticum aestivum)
<400> 37
cgtcgatgtc ggcactccac agcactttgg agctccctgt ggacgatgat gacaggtcat 60
cgacaacata ggcgatggag tcgtaggggt tccagatgag gg 102
<210> 38
<211> 101
<212> DNA
<213> wheat (Triticum aestivum)
<400> 38
cgtcgatgtc ggcactccac agcactttgg agctccctgt ggacgatgat acaggtcatc 60
gacaacatag gcgatggagt cgtaggggtt ccagatgagg g 101
<210> 39
<211> 101
<212> DNA
<213> wheat (Triticum aestivum)
<400> 39
catcccggtg gcctggttgg tgaggctcag gttgtagagc gccctgacca cggatttctt 60
gctctgcagc tcgacgcaca ctgaaacata gtctttggtg t 101
<210> 40
<211> 101
<212> DNA
<213> wheat (Triticum aestivum)
<400> 40
catcccggtg gcctggttgg tgaggctcag gttgtagagc gccctgacca tggatttctt 60
gctctgcagc tcgacgcaca ctgaaacata gtctttggtg t 101
<210> 41
<211> 101
<212> DNA
<213> wheat (Triticum aestivum)
<400> 41
ccctgatgat ggtgaggcgg ccataagaga ggaaaatgat ttctcctcca atgttgtagc 60
cttgagcgac tccttgaggg acgaagacac atctgcaggt t 101
<210> 42
<211> 101
<212> DNA
<213> wheat (Triticum aestivum)
<400> 42
ccctgatgat ggtgaggcgg ccataagaga ggaaaatgat ttctcctcca gtgttgtagc 60
cttgagcgac tccttgaggg acgaagacac atctgcaggt t 101
<210> 43
<211> 101
<212> DNA
<213> wheat (Triticum aestivum)
<400> 43
ggggaagcag cggtttctac tggcatattc tagatgttgc ttgctgcacg gagtgtgaga 60
cgaatggact actcgggctg cagcgttgac gaacaagacg a 101
<210> 44
<211> 101
<212> DNA
<213> wheat (Triticum aestivum)
<400> 44
ggggaagcag cggtttctac tggcatattc tagatgttgc ttgctgcacg gagtgtgaga 60
cgaatggact actcgggctg cagcgttgac gaacaagacg a 101
<210> 45
<211> 101
<212> DNA
<213> wheat (Triticum aestivum)
<400> 45
tgctttgatt atgagggtgg tcattacaag tcggatctgc ctcactctga ttacgactcg 60
gatgctgatg acgactggaa tgctgattac acggattctg c 101
<210> 46
<211> 101
<212> DNA
<213> wheat (Triticum aestivum)
<400> 46
tgctttgatt atgagggtgg tcattacaag tcggatctgc ctcactctga ttacgactcg 60
gatgctgatg acgactggaa tgctgattac acggattctg c 101
<210> 47
<211> 101
<212> DNA
<213> wheat (Triticum aestivum)
<400> 47
tgtaccaaag atggcagacc ggaagtttcc aagccaccac gactctgcag aagaactaca 60
gccaagatcc aagtcaacgg taccgacacg acatgtttct t 101
<210> 48
<211> 101
<212> DNA
<213> wheat (Triticum aestivum)
<400> 48
tgtaccaaag atggcagacc ggaagtttcc aagccaccac gactctgcag aagaactaca 60
gccaagatcc aagtcaacgg taccgacacg acatgtttct t 101
<210> 49
<211> 101
<212> DNA
<213> wheat (Triticum aestivum)
<400> 49
gcgttcgtgt caaaggtgtt ggagaaatca aactgcagac ggacgtcgaa ctgccaacaa 60
gttcactgta cgctgccatc ggtctggtga ccatggatca t 101
<210> 50
<211> 101
<212> DNA
<213> wheat (Triticum aestivum)
<400> 50
gcgttcgtgt caaaggtgtt ggagaaatca aactgcagac ggacgtcgaa gtgccaacaa 60
gttcactgta cgctgccatc ggtctggtga ccatggatca t 101
<210> 51
<211> 101
<212> DNA
<213> wheat (Triticum aestivum)
<400> 51
actgcagggc cctgttggtc aagctgcact tccccacggg cagtactgca tgcccgtgtg 60
cagagttaga atccttcgac ggcatgggca gaactgcagg t 101
<210> 52
<211> 101
<212> DNA
<213> wheat (Triticum aestivum)
<400> 52
actgcagggc cctgttggtc aagctgcact tccccacggg cagtactgca cgcccgtgtg 60
cagagttaga atccttcgac ggcatgggca gaactgcagg t 101
<210> 53
<211> 101
<212> DNA
<213> wheat (Triticum aestivum)
<400> 53
tctatacata cactgcaggt tgcagcacta ggtcggggcc cctagtttgg ctgggccccg 60
ggccgtcgcc cctgctgccc tggcccaggg tcggccctgc g 101
<210> 54
<211> 101
<212> DNA
<213> wheat (Triticum aestivum)
<400> 54
tctatacata cactgcaggt tgcagcacta ggtcggggcc cctagtttgg ttgggccccg 60
ggccgtcgcc cctgctgccc tggcccaggg tcggccctgc g 101
<210> 55
<211> 101
<212> DNA
<213> wheat (Triticum aestivum)
<400> 55
gacgagatga aggaggtgga gaaggagcaa ccctacgcag gcactaaatc gttggaaggg 60
gggcgaggag ggagatgaag tgtttacagt ttgctgcaga t 101
<210> 56
<211> 101
<212> DNA
<213> wheat (Triticum aestivum)
<400> 56
gacgagatga aggaggtgga gaaggagcaa ccctacgcag gcactaaatc tttggaaggg 60
gggcgaggag ggagatgaag tgtttacagt ttgctgcaga t 101
<210> 57
<211> 101
<212> DNA
<213> wheat (Triticum aestivum)
<400> 57
ggcgggttcc acctccgaat actccaagat aaattccgaa cacaaggacc gtgtctagct 60
ctgcaggata atcattccat atatcaccgt agagagaaca a 101
<210> 58
<211> 101
<212> DNA
<213> wheat (Triticum aestivum)
<400> 58
ggcgggttcc acctccgaat actccaagat aaattccgaa cacaaggacc atgtctagct 60
ctgcaggata atcattccat atatcaccgt agagagaaca a 101
<210> 59
<211> 102
<212> DNA
<213> wheat (Triticum aestivum)
<400> 59
ttattctaaa ttgtactcca tacaagtaaa tcttctgcag caaataaaaa acagtaaatg 60
atatgttcca caaactgact ggctagtgtt gaaaaaggag ag 102
<210> 60
<211> 101
<212> DNA
<213> wheat (Triticum aestivum)
<400> 60
ttattctaaa ttgtactcca tacaagtaaa tcttctgcag caaataaaaa cagtaaatga 60
tatgttccac aaactgactg gctagtgttg aaaaaggaga g 101
<210> 61
<211> 101
<212> DNA
<213> wheat (Triticum aestivum)
<400> 61
ggtgcccggg tgcggctgca gccagccgca gtggggcgga cccgtcggtg ttgtaggagc 60
acggggcggc cggtcgcgag gctgagcacg caggcgctgg g 101
<210> 62
<211> 101
<212> DNA
<213> wheat (Triticum aestivum)
<400> 62
ggtgcccggg tgcggctgca gccagccgca gtggggcgga cccgtcggtg ctgtaggagc 60
acggggcggc cggtcgcgag gctgagcacg caggcgctgg g 101
<210> 63
<211> 101
<212> DNA
<213> wheat (Triticum aestivum)
<400> 63
ggtggactgg tgattcgtga cctacaccgc accggagttg ctttacgcac acgctggctc 60
tggctgcagc acactgacct cgcacgcacc tggaaacatc t 101
<210> 64
<211> 101
<212> DNA
<213> wheat (Triticum aestivum)
<400> 64
ggtggactgg tgattcgtga cctacaccgc accggagttg ctttacgcac gcgctggctc 60
tggctgcagc acactgacct cgcacgcacc tggaaacatc t 101
<210> 65
<211> 101
<212> DNA
<213> wheat (Triticum aestivum)
<400> 65
ggagttcggc gatgtgccag cgatagtact gctggacctg aacggcgttt acataggttt 60
gagcttgtcg gcgaccaact tggaccagtc aacggtcaag g 101
<210> 66
<211> 101
<212> DNA
<213> wheat (Triticum aestivum)
<400> 66
ggagttcggc gatgtgccag cgatagtact gctggacctg aacggcgttt gcataggttt 60
gagcttgtcg gcgaccaact tggaccagtc aacggtcaag g 101
<210> 67
<211> 101
<212> DNA
<213> wheat (Triticum aestivum)
<400> 67
gcaccctctg ttgatgatgg tatgggtgct actgcagcta ttatacggga cgaaaaagat 60
aatttccttg ctgcctaatg caaatttata gattatgcgg g 101
<210> 68
<211> 101
<212> DNA
<213> wheat (Triticum aestivum)
<400> 68
gcaccctctg ttgatgatgg tatgggtgct actgcagcta ttatacggga tgaaaaagat 60
aatttccttg ctgcctaatg caaatttata gattatgcgg g 101
<210> 69
<211> 101
<212> DNA
<213> wheat (Triticum aestivum)
<400> 69
caggcgttgt cctcctgccg ccgcctcgac cacgtccgcc acgtcacggc aaggcccacg 60
gcgaccagca gcgttgtgcc gacgcatatc gccgccacga c 101
<210> 70
<211> 101
<212> DNA
<213> wheat (Triticum aestivum)
<400> 70
caggcgttgt cctcctgccg ccgcctcgac cacgtccgcc acgtcacggc gaggcccacg 60
gcgaccagca gcgttgtgcc gacgcatatc gccgccacga c 101
<210> 71
<211> 101
<212> DNA
<213> wheat (Triticum aestivum)
<400> 71
ttttcggatt tggtgtcctc cattatttgt attaagggcc cgggagatgc gctcaagttt 60
ttgaatgcgc tgcagcccct tttcatggag ttcctactac t 101
<210> 72
<211> 101
<212> DNA
<213> wheat (Triticum aestivum)
<400> 72
ttttcggatt tggtgtcctc cattatttgt attaagggcc cgggagatgc tctcaagttt 60
ttgaatgcgc tgcagcccct tttcatggag ttcctactac t 101
<210> 73
<211> 101
<212> DNA
<213> wheat (Triticum aestivum)
<400> 73
aagtatgccg tccgcgtcgc ggtacctctc gccgtggtgc accatccagc agtaggcgtc 60
gctggtcctg tcctggagcg gctgcaggat gtcggcgccg g 101
<210> 74
<211> 101
<212> DNA
<213> wheat (Triticum aestivum)
<400> 74
aagtatgccg tccgcgtcgc ggtacctctc gccgtggtgc accatccagc ggtaggcgtc 60
gctggtcctg tcctggagcg gctgcaggat gtcggcgccg g 101
<210> 75
<211> 101
<212> DNA
<213> wheat (Triticum aestivum)
<400> 75
gtggataaca aggcgtccaa aggacatggt tactgcagat gggaaagaat ggcaatggca 60
ctcctgaaac tcaaccttgc gaccccaaac tgaaccctgg a 101
<210> 76
<211> 101
<212> DNA
<213> wheat (Triticum aestivum)
<400> 76
gtggataaca aggcgtccaa aggacatggt tactgcagat gggaaagaat agcaatggca 60
ctcctgaaac tcaaccttgc gaccccaaac tgaaccctgg a 101
<210> 77
<211> 101
<212> DNA
<213> wheat (Triticum aestivum)
<400> 77
caactccagc ctctcctgct gcagtctcgc acgcagtcct cgttgacctt cgaggcttcg 60
atcccctgcc cgacgccaag atcgcagctc catgtcctcg t 101
<210> 78
<211> 101
<212> DNA
<213> wheat (Triticum aestivum)
<400> 78
caactccagc ctctcctgct gcagtctcgc acgcagtcct cgttgacctt tgaggcttcg 60
atcccctgcc cgacgccaag atcgcagctc catgtcctcg t 101
<210> 79
<211> 101
<212> DNA
<213> wheat (Triticum aestivum)
<400> 79
gtcaccctgc agcctcttat tttccgtcac agagtcagcc agctgggccc gcacatcttt 60
cagttcttcg tgcagctggg tgttggaatc ctggagtttg t 101
<210> 80
<211> 101
<212> DNA
<213> wheat (Triticum aestivum)
<400> 80
gtcaccctgc agcctcttat tttccgtcac agagtcagcc agctgggccc acacatcttt 60
cagttcttcg tgcagctggg tgttggaatc ctggagtttg t 101
<210> 81
<211> 101
<212> DNA
<213> wheat (Triticum aestivum)
<400> 81
gggagctcac ctcggtagcc atcggggagc gcgacggtgg cgccctgcag gttcctcccg 60
cggaagaagg cctcctccac cttcacccca tccacctcca c 101
<210> 82
<211> 101
<212> DNA
<213> wheat (Triticum aestivum)
<400> 82
gggagctcac ctcggtagcc atcggggagc gcgacggtgg cgccctgcag cttcctcccg 60
cggaagaagg cctcctccac cttcacccca tccacctcca c 101
<210> 83
<211> 101
<212> DNA
<213> wheat (Triticum aestivum)
<400> 83
tcctctcgcg agcttgtgct tcacgccgcc atgcctcctc gatcttggat tcgccttcct 60
ccctccttca ccttcgagat tccaccgagg gggcctcggg a 101
<210> 84
<211> 101
<212> DNA
<213> wheat (Triticum aestivum)
<400> 84
tcctctcgcg agcttgtgct tcacgccgcc atgcctcctc gatcttggat ccgccttcct 60
ccctccttca ccttcgagat tccaccgagg gggcctcggg a 101
<210> 85
<211> 101
<212> DNA
<213> wheat (Triticum aestivum)
<400> 85
aggatctcca cgtcgctgca ggtatctttg tgctcttttc tagtgggggc gcgctagcgc 60
acccactggg tgtagccccc gagattcggg ccaactgtgt a 101
<210> 86
<211> 101
<212> DNA
<213> wheat (Triticum aestivum)
<400> 86
aggatctcca cgtcgctgca ggtatctttg tgctcttttc tagtgggggc acgctagcgc 60
acccactggg tgtagccccc gagattcggg ccaactgtgt a 101
<210> 87
<211> 101
<212> DNA
<213> wheat (Triticum aestivum)
<400> 87
tgcagctgcc ttctcgccgt cgctgctgcc gcgaagttac tgctcgatag cagagctagc 60
tagagccaaa gagctgatcg agaggtgtgt ggtgcagtgt g 101
<210> 88
<211> 101
<212> DNA
<213> wheat (Triticum aestivum)
<400> 88
tgcagctgcc ttctcgccgt cgctgctgcc gcgaagttac tgctcgatag aagagctagc 60
tagagccaaa gagctgatcg agaggtgtgt ggtgcagtgt g 101
<210> 89
<211> 102
<212> DNA
<213> wheat (Triticum aestivum)
<400> 89
cacacaccgt gatcaatcag ctgaagttcg tggcggagta tgccttctcg aggaaagcaa 60
aaaagcttca cggagccgtc caaagacgag gtctaattaa gc 102
<210> 90
<211> 101
<212> DNA
<213> wheat (Triticum aestivum)
<400> 90
cacacaccgt gatcaatcag ctgaagttcg tggcggagta tgccttctcg ggaaagcaaa 60
aaagcttcac ggagccgtcc aaagacgagg tctaattaag c 101
<210> 91
<211> 101
<212> DNA
<213> wheat (Triticum aestivum)
<400> 91
ctgttcctgc agggcgggac gcagatgatc atctcgcaga tcctggtggg caccttcatc 60
gggctccagt tcgggctgag cgggacgggg gccatctcgg a 101
<210> 92
<211> 101
<212> DNA
<213> wheat (Triticum aestivum)
<400> 92
ctgttcctgc agggcgggac gcagatgatc atctcgcaga tcctggtggg aaccttcatc 60
gggctccagt tcgggctgag cgggacgggg gccatctcgg a 101
<210> 93
<211> 101
<212> DNA
<213> wheat (Triticum aestivum)
<400> 93
ggtaccagtt ggagtcaact ccttaggagg tgtctgctgc agttgcaact tgtttcctct 60
gagaattgtc ctctgcgtaa cgccatttgc actcctttgc g 101
<210> 94
<211> 101
<212> DNA
<213> wheat (Triticum aestivum)
<400> 94
ggtaccagtt ggagtcaact ccttaggagg tgtctgctgc agttgcaact cgtttcctct 60
gagaattgtc ctctgcgtaa cgccatttgc actcctttgc g 101
<210> 95
<211> 101
<212> DNA
<213> wheat (Triticum aestivum)
<400> 95
tttcatgtgt gctgaacctg caggaaggaa caacttggca tgtctacaaa agctacaaac 60
aaatactaca aaaactcaag caaagacgac cttgttttga g 101
<210> 96
<211> 101
<212> DNA
<213> wheat (Triticum aestivum)
<400> 96
tttcatgtgt gctgaacctg caggaaggaa caacttggca tgtctacaaa tgctacaaac 60
aaatactaca aaaactcaag caaagacgac cttgttttga g 101
<210> 97
<211> 101
<212> DNA
<213> wheat (Triticum aestivum)
<400> 97
gtaagatact gcagtgcccc agcgaggcga cggtagtgag tcggatcact gtaagggaca 60
ccaatgacac cagaaagctt gctgcaggca tcgacggggg t 101
<210> 98
<211> 101
<212> DNA
<213> wheat (Triticum aestivum)
<400> 98
gtaagatact gcagtgcccc agcgaggcga cggtagtgag tcggatcact ataagggaca 60
ccaatgacac cagaaagctt gctgcaggca tcgacggggg t 101
<210> 99
<211> 101
<212> DNA
<213> wheat (Triticum aestivum)
<400> 99
ggttcgacgc ctcacacaaa cttttgtttt tgagagtttt tctgcaaaac tgtgtttaag 60
ttttgccgct gccgtttgtt tctttaagta tcgcgctgca g 101
<210> 100
<211> 101
<212> DNA
<213> wheat (Triticum aestivum)
<400> 100
ggttcgacgc ctcacacaaa cttttgtttt tgagagtttt tctgcaaaac cgtgtttaag 60
ttttgccgct gccgtttgtt tctttaagta tcgcgctgca g 101
<210> 101
<211> 101
<212> DNA
<213> wheat (Triticum aestivum)
<400> 101
gcaaaactgt gtttaagttt tgccgctgcc gtttgtttct ttaagtatcg cgctgcagat 60
ctagcactag aggttgtctg tcgcggcggc tcgcggcagc a 101
<210> 102
<211> 101
<212> DNA
<213> wheat (Triticum aestivum)
<400> 102
gcaaaactgt gtttaagttt tgccgctgcc gtttgtttct ttaagtatcg tgctgcagat 60
ctagcactag aggttgtctg tcgcggcggc tcgcggcagc a 101
<210> 103
<211> 101
<212> DNA
<213> wheat (Triticum aestivum)
<400> 103
atccccctcg ctcgtgctgc ttctctgctc ttgctctcgc tcccgctgct gatgctggta 60
cacgggctgc tgcagctaca caagttgctg ctctggctct a 101
<210> 104
<211> 101
<212> DNA
<213> wheat (Triticum aestivum)
<400> 104
atccccctcg ctcgtgctgc ttctctgctc ttgctctcgc tcccgctgct aatgctggta 60
cacgggctgc tgcagctaca caagttgctg ctctggctct a 101
<210> 105
<211> 101
<212> DNA
<213> wheat (Triticum aestivum)
<400> 105
cgggcgctgc agcagcggcg gagggatcgg cggtcggcgt agcgcctggc gctcctgtgg 60
cctcggggcc gtcagtgcga tcgccggatt ccttgccagc t 101
<210> 106
<211> 101
<212> DNA
<213> wheat (Triticum aestivum)
<400> 106
cgggcgctgc agcagcggcg gagggatcgg cggtcggcgt agcgcctggc cctcctgtgg 60
cctcggggcc gtcagtgcga tcgccggatt ccttgccagc t 101
<210> 107
<211> 101
<212> DNA
<213> wheat (Triticum aestivum)
<400> 107
gctagccgtc cttcatcaag atgtgcttgt tcctgcagtt ggaggagcag agtctcagtc 60
gggaagcccg cgtcgctgct cgcacggccc tcctcgctca a 101
<210> 108
<211> 101
<212> DNA
<213> wheat (Triticum aestivum)
<400> 108
gctagccgtc cttcatcaag atgtgcttgt tcctgcagtt ggaggagcag cgtctcagtc 60
gggaagcccg cgtcgctgct cgcacggccc tcctcgctca a 101
<210> 109
<211> 101
<212> DNA
<213> wheat (Triticum aestivum)
<400> 109
catgcacacc gctgcaggcg ctcctcctcc tcccgctcca gctgcatgcg tcgcttacat 60
tcggctccct cccccgcgac cgtgtggggc ctccattggg c 101
<210> 110
<211> 101
<212> DNA
<213> wheat (Triticum aestivum)
<400> 110
catgcacacc gctgcaggcg ctcctcctcc tcccgctcca gctgcatgcg ccgcttacat 60
tcggctccct cccccgcgac cgtgtggggc ctccattggg c 101
<210> 111
<211> 101
<212> DNA
<213> wheat (Triticum aestivum)
<400> 111
ctgcacgttc tggcagctgg tgggcttctg cactggtgta tgcgggaatg gcactgtcat 60
tggcctacat tgatgttgta ggaatgtcgc acacggtttt a 101
<210> 112
<211> 101
<212> DNA
<213> wheat (Triticum aestivum)
<400> 112
ctgcacgttc tggcagctgg tgggcttctg cactggtgta tgcgggaatg acactgtcat 60
tggcctacat tgatgttgta ggaatgtcgc acacggtttt a 101
<210> 113
<211> 101
<212> DNA
<213> wheat (Triticum aestivum)
<400> 113
gaactgctgc agcccatctg tgacagagca gactcctgcg aatttgccca gctaggtaca 60
tcctctacat ggtagcaact tgaagaaaat tcttcctttt t 101
<210> 114
<211> 101
<212> DNA
<213> wheat (Triticum aestivum)
<400> 114
gaactgctgc agcccatctg tgacagagca gactcctgcg aatttgccca tctaggtaca 60
tcctctacat ggtagcaact tgaagaaaat tcttcctttt t 101
<210> 115
<211> 102
<212> DNA
<213> wheat (Triticum aestivum)
<400> 115
gcggcgacgt gggggagaga gcgggacgcg ggattcgcag tgggggatga ggaattggcg 60
gcggcatcgg cgcgggagtg gacgacgcgc gcgcgcggct gg 102
<210> 116
<211> 101
<212> DNA
<213> wheat (Triticum aestivum)
<400> 116
gcggcgacgt gggggagaga gcgggacgcg ggattcgcag tgggggatga gaattggcgg 60
cggcatcggc gcgggagtgg acgacgcgcg cgcgcggctg g 101
Claims (7)
1. A group of SNP sites which are obviously related to wheat powdery mildew resistance, and is characterized in that: the SNP loci comprise 58 SNP loci with the numbers of SNP 01-SNP 58, and the information is as follows:
the physical position in the table takes the Chinese spring genome IWGSC reference genome v1.1 (IWGSC, 2018) as a reference sequence;
the sequences listed in the table are shown in sequence tables SEQ ID NO. 1-SEQ ID NO. 116.
2. Use of the set of SNP sites significantly associated with wheat powdery mildew resistance according to claim 1 in the identification of wheat powdery mildew resistance.
3. Use of a set of SNP sites significantly associated with wheat powdery mildew resistance according to claim 1 in the preparation of a wheat powdery mildew resistance identification kit.
4. Use of a set of SNP sites significantly associated with wheat powdery mildew resistance according to claim 1 for the preparation of a single detectable SNP marker or gene chip.
5. Use of a set of SNP sites significantly associated with wheat powdery mildew resistance according to claim 1 for the preparation of KASP marker k6a86486 co-segregated with powdery mildew resistance gene site qpm6a.3.
6. The use of the set of SNP sites according to claim 1, wherein the SNP sites are significantly associated with wheat powdery mildew resistance in a wheat powdery mildew resistance identification detection method.
7. Use in a detection method according to claim 6, characterized in that the detection method comprises the steps of:
designing KASP primers according to the SNP sites, and designing KASP primers according to DNA short sequences containing 50bp of upstream and downstream of the SNP sites; specifically, a website http:// www.polymarker.info/is used for primer design, and default parameter setting of the website is adopted; adding a joint in front of the primer, wherein the FAM sequence is GAAGGTGACCAAGTTCATGCT, and the HEX sequence is GAAGGTCGGAGTCAACGGATT;
after the primers are designed and synthesized, the effectiveness detection can be carried out by utilizing a separation population or a natural population, and whether the QTL identified by GWAS exists or not is verified, and the using methods are respectively as follows:
(1) using wheat DNA as a PCR amplification template, designing a synthesized KASP primer, and carrying out PCR amplification with a reaction system of 6 mu L; the reaction system specifically comprises: 20-50 ng/. mu.L of DNA 3. mu.L, 2 XKASP Master mix 3. mu.L, and KASP Assay mix upstream and downstream primer mixture 0.0825. mu.L; amplifying in a 384-well PCR instrument;
(2) the PCR amplification program is pre-denaturation at 94 ℃ for 15 min; denaturation at 94 deg.C for 20s, and renaturation at 65-57 deg.C for 60 s; the reduction per cycle is 0.8 ℃; 10 cycles; denaturation at 94 ℃ for 20s, renaturation at 57 ℃ for 60s, 30 cycles; storing at 10 deg.C;
(3) after the PCR is finished, placing the sample in an Omega SNP typing instrument to detect the PCR typing result;
(4) analyzing and identifying, and analyzing the genotype according to the typing result.
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2020115449733 | 2020-12-23 | ||
| CN202011544973.3A CN112501345A (en) | 2020-12-23 | 2020-12-23 | SNP loci significantly associated with wheat powdery mildew resistance and application thereof in genetic breeding |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN113046466A true CN113046466A (en) | 2021-06-29 |
| CN113046466B CN113046466B (en) | 2023-07-21 |
Family
ID=74923161
Family Applications (2)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202011544973.3A Withdrawn CN112501345A (en) | 2020-12-23 | 2020-12-23 | SNP loci significantly associated with wheat powdery mildew resistance and application thereof in genetic breeding |
| CN202110397651.9A Active CN113046466B (en) | 2020-12-23 | 2021-04-14 | SNP locus obviously associated with wheat powdery mildew resistance and application of SNP locus in genetic breeding |
Family Applications Before (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202011544973.3A Withdrawn CN112501345A (en) | 2020-12-23 | 2020-12-23 | SNP loci significantly associated with wheat powdery mildew resistance and application thereof in genetic breeding |
Country Status (1)
| Country | Link |
|---|---|
| CN (2) | CN112501345A (en) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN113234852B (en) * | 2021-06-30 | 2022-11-04 | 四川省农业科学院作物研究所 | Molecular marker and primer group for identifying wheat powdery mildew resistance and application |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108977572A (en) * | 2018-09-05 | 2018-12-11 | 中国农业科学院作物科学研究所 | Mildew-resistance gene label and application based on 895 genetic background of wheat in wheat breed |
| CN111118208A (en) * | 2020-03-06 | 2020-05-08 | 河南省农业科学院 | Molecular marker of wheat grain zinc content QTL qZn-5A |
| CN111719010A (en) * | 2020-02-26 | 2020-09-29 | 山东农业大学 | High-throughput SNP diagnostic marker of wheat powdery mildew resistance gene Pm21 and application thereof in breeding |
-
2020
- 2020-12-23 CN CN202011544973.3A patent/CN112501345A/en not_active Withdrawn
-
2021
- 2021-04-14 CN CN202110397651.9A patent/CN113046466B/en active Active
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108977572A (en) * | 2018-09-05 | 2018-12-11 | 中国农业科学院作物科学研究所 | Mildew-resistance gene label and application based on 895 genetic background of wheat in wheat breed |
| CN111719010A (en) * | 2020-02-26 | 2020-09-29 | 山东农业大学 | High-throughput SNP diagnostic marker of wheat powdery mildew resistance gene Pm21 and application thereof in breeding |
| CN111118208A (en) * | 2020-03-06 | 2020-05-08 | 河南省农业科学院 | Molecular marker of wheat grain zinc content QTL qZn-5A |
Also Published As
| Publication number | Publication date |
|---|---|
| CN113046466B (en) | 2023-07-21 |
| CN112501345A (en) | 2021-03-16 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Lisch | How important are transposons for plant evolution? | |
| US20050032056A1 (en) | Identification and use of conserved noncoding sequences | |
| CN111172294B (en) | Co-dominant SSR marker closely linked with tobacco nicotine synthesis major regulatory gene nic1 and application thereof | |
| CN113046467B (en) | SNP locus obviously associated with wheat stripe rust resistance and application thereof in genetic breeding | |
| CN113684300A (en) | SNP loci obviously associated with wheat ear number and application thereof in wheat genetic breeding | |
| CN113046466B (en) | SNP locus obviously associated with wheat powdery mildew resistance and application of SNP locus in genetic breeding | |
| CN117106967A (en) | Functional KASP molecular marker of rice blast resistance gene and application thereof | |
| Hu et al. | Fine mapping of a major quantitative trait locus, qgnp7 (t), controlling grain number per panicle in African rice (Oryza glaberrima S.) | |
| CN111607664B (en) | Application of SNP molecular marker on 1DS chromosome related to wheat stripe rust | |
| Kumaraswamy et al. | Genome mapping tools: current research and future prospects | |
| KR101401980B1 (en) | Specific primer for selecting Phytophthora blight resistant pepper and uses thereof | |
| CN101824417A (en) | Porcine reproductive trait related gene NCOA1 and application thereof in porcine marker-assisted selection | |
| CN113046465B (en) | SNP locus obviously associated with cold resistance of wheat and application of SNP locus in genetic breeding | |
| Zhang et al. | RNA-seq analysis revealed considerable genetic diversity and enabled the development of specific KASP markers for Psathyrostachys huashanica | |
| Wang et al. | Genome variation and LTR-RT analyses of an ancient peach landrace reveal mechanism of blood-flesh fruit color formation and fruit maturity date advancement | |
| CN108315333B (en) | Rice black-streaked dwarf disease resistance gene RBSDV-6c and coding protein thereof | |
| KR101439448B1 (en) | A High-density Genetic linkage map of Capsicum sp. | |
| CN110699484A (en) | SNP molecular marker for detecting rice stripe disease resistant STV11 gene and application | |
| KR101439454B1 (en) | A High-density Genetic linkage map of Capsicum sp. | |
| KR101439459B1 (en) | A High-density Genetic linkage map of Capsicum sp. | |
| KR101439456B1 (en) | A High-density Genetic linkage map of Capsicum sp. | |
| CN116334271A (en) | TaNAC71-4B gene, dCAPS molecular marker and application thereof in identification of wheat potassium absorption and utilization capacity | |
| KR101439449B1 (en) | A High-density Genetic linkage map of Capsicum sp. | |
| KR101439450B1 (en) | A High-density Genetic linkage map of Capsicum sp. | |
| KR101439455B1 (en) | A High-density Genetic linkage map of Capsicum sp. |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |