CN116334271A - TaNAC71-4B gene, dCAPS molecular marker and application thereof in identification of wheat potassium absorption and utilization capacity - Google Patents
TaNAC71-4B gene, dCAPS molecular marker and application thereof in identification of wheat potassium absorption and utilization capacity Download PDFInfo
- Publication number
- CN116334271A CN116334271A CN202211022340.5A CN202211022340A CN116334271A CN 116334271 A CN116334271 A CN 116334271A CN 202211022340 A CN202211022340 A CN 202211022340A CN 116334271 A CN116334271 A CN 116334271A
- Authority
- CN
- China
- Prior art keywords
- wheat
- tanac71
- potassium
- gene
- snp locus
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
- 241000209140 Triticum Species 0.000 title claims abstract description 135
- 235000021307 Triticum Nutrition 0.000 title claims abstract description 133
- 229910052700 potassium Inorganic materials 0.000 title claims abstract description 81
- 239000011591 potassium Substances 0.000 title claims abstract description 81
- ZLMJMSJWJFRBEC-UHFFFAOYSA-N Potassium Chemical compound [K] ZLMJMSJWJFRBEC-UHFFFAOYSA-N 0.000 title claims abstract description 77
- 108090000623 proteins and genes Proteins 0.000 title claims abstract description 48
- 238000010521 absorption reaction Methods 0.000 title claims abstract description 32
- 239000003147 molecular marker Substances 0.000 title claims abstract description 31
- 102000054766 genetic haplotypes Human genes 0.000 claims abstract description 68
- 101150009243 HAP1 gene Proteins 0.000 claims abstract description 31
- 108020004414 DNA Proteins 0.000 claims description 31
- 239000012634 fragment Substances 0.000 claims description 25
- 238000012408 PCR amplification Methods 0.000 claims description 23
- 238000001976 enzyme digestion Methods 0.000 claims description 23
- 108091026890 Coding region Proteins 0.000 claims description 22
- 238000000034 method Methods 0.000 claims description 19
- 238000003776 cleavage reaction Methods 0.000 claims description 17
- 230000007017 scission Effects 0.000 claims description 17
- 108700039691 Genetic Promoter Regions Proteins 0.000 claims description 16
- 238000011144 upstream manufacturing Methods 0.000 claims description 16
- 108091008146 restriction endonucleases Proteins 0.000 claims description 12
- 239000003153 chemical reaction reagent Substances 0.000 claims description 10
- 239000000463 material Substances 0.000 claims description 10
- 239000002773 nucleotide Substances 0.000 claims description 10
- 125000003729 nucleotide group Chemical group 0.000 claims description 10
- 238000009395 breeding Methods 0.000 claims description 5
- 230000001488 breeding effect Effects 0.000 claims description 5
- 108700026220 vif Genes Proteins 0.000 abstract description 3
- 239000000047 product Substances 0.000 description 23
- 241000196324 Embryophyta Species 0.000 description 16
- 238000011282 treatment Methods 0.000 description 11
- 230000003321 amplification Effects 0.000 description 8
- 230000012010 growth Effects 0.000 description 8
- 238000003199 nucleic acid amplification method Methods 0.000 description 8
- 239000000203 mixture Substances 0.000 description 6
- 239000013598 vector Substances 0.000 description 6
- HEDRZPFGACZZDS-UHFFFAOYSA-N Chloroform Chemical compound ClC(Cl)Cl HEDRZPFGACZZDS-UHFFFAOYSA-N 0.000 description 4
- 108090000790 Enzymes Proteins 0.000 description 4
- 102000004190 Enzymes Human genes 0.000 description 4
- LFQSCWFLJHTTHZ-UHFFFAOYSA-N Ethanol Chemical compound CCO LFQSCWFLJHTTHZ-UHFFFAOYSA-N 0.000 description 4
- 244000098338 Triticum aestivum Species 0.000 description 4
- 238000000137 annealing Methods 0.000 description 4
- 238000006243 chemical reaction Methods 0.000 description 4
- 238000004925 denaturation Methods 0.000 description 4
- 230000036425 denaturation Effects 0.000 description 4
- 230000029087 digestion Effects 0.000 description 4
- PHTQWCKDNZKARW-UHFFFAOYSA-N isoamylol Chemical compound CC(C)CCO PHTQWCKDNZKARW-UHFFFAOYSA-N 0.000 description 4
- 239000003550 marker Substances 0.000 description 4
- 238000012257 pre-denaturation Methods 0.000 description 4
- 238000012163 sequencing technique Methods 0.000 description 4
- 238000004458 analytical method Methods 0.000 description 3
- 238000013461 design Methods 0.000 description 3
- 238000011161 development Methods 0.000 description 3
- 238000001962 electrophoresis Methods 0.000 description 3
- 238000002474 experimental method Methods 0.000 description 3
- 230000035772 mutation Effects 0.000 description 3
- 239000006228 supernatant Substances 0.000 description 3
- XLYOFNOQVPJJNP-UHFFFAOYSA-N water Substances O XLYOFNOQVPJJNP-UHFFFAOYSA-N 0.000 description 3
- IJGRMHOSHXDMSA-UHFFFAOYSA-N Atomic nitrogen Chemical compound N#N IJGRMHOSHXDMSA-UHFFFAOYSA-N 0.000 description 2
- LZZYPRNAOMGNLH-UHFFFAOYSA-M Cetrimonium bromide Chemical compound [Br-].CCCCCCCCCCCCCCCC[N+](C)(C)C LZZYPRNAOMGNLH-UHFFFAOYSA-M 0.000 description 2
- 238000009825 accumulation Methods 0.000 description 2
- 238000004364 calculation method Methods 0.000 description 2
- 235000013339 cereals Nutrition 0.000 description 2
- 239000013599 cloning vector Substances 0.000 description 2
- 239000011259 mixed solution Substances 0.000 description 2
- 229910001414 potassium ion Inorganic materials 0.000 description 2
- 238000011160 research Methods 0.000 description 2
- 238000012216 screening Methods 0.000 description 2
- 230000035945 sensitivity Effects 0.000 description 2
- 239000000243 solution Substances 0.000 description 2
- 230000009469 supplementation Effects 0.000 description 2
- 238000012360 testing method Methods 0.000 description 2
- 238000004260 weight control Methods 0.000 description 2
- 241000588724 Escherichia coli Species 0.000 description 1
- 244000208060 Lawsonia inermis Species 0.000 description 1
- 108091026898 Leader sequence (mRNA) Proteins 0.000 description 1
- KWYUFKZDYYNOTN-UHFFFAOYSA-M Potassium hydroxide Chemical compound [OH-].[K+] KWYUFKZDYYNOTN-UHFFFAOYSA-M 0.000 description 1
- NPYPAHLBTDXSSS-UHFFFAOYSA-N Potassium ion Chemical compound [K+] NPYPAHLBTDXSSS-UHFFFAOYSA-N 0.000 description 1
- 108091036066 Three prime untranslated region Proteins 0.000 description 1
- 230000002411 adverse Effects 0.000 description 1
- 238000007605 air drying Methods 0.000 description 1
- 230000001651 autotrophic effect Effects 0.000 description 1
- 230000009286 beneficial effect Effects 0.000 description 1
- 230000015572 biosynthetic process Effects 0.000 description 1
- 238000007796 conventional method Methods 0.000 description 1
- 230000010485 coping Effects 0.000 description 1
- 238000010219 correlation analysis Methods 0.000 description 1
- 238000001514 detection method Methods 0.000 description 1
- 229940079593 drug Drugs 0.000 description 1
- 239000003814 drug Substances 0.000 description 1
- 238000005516 engineering process Methods 0.000 description 1
- 235000019441 ethanol Nutrition 0.000 description 1
- 238000000605 extraction Methods 0.000 description 1
- 239000003337 fertilizer Substances 0.000 description 1
- 235000013305 food Nutrition 0.000 description 1
- 230000002068 genetic effect Effects 0.000 description 1
- PCHJSUWPFVWCPO-UHFFFAOYSA-N gold Chemical compound [Au] PCHJSUWPFVWCPO-UHFFFAOYSA-N 0.000 description 1
- 239000010931 gold Substances 0.000 description 1
- 229910052737 gold Inorganic materials 0.000 description 1
- 238000002789 length control Methods 0.000 description 1
- 239000007788 liquid Substances 0.000 description 1
- 238000004519 manufacturing process Methods 0.000 description 1
- 238000005259 measurement Methods 0.000 description 1
- 238000002156 mixing Methods 0.000 description 1
- 238000012986 modification Methods 0.000 description 1
- 230000004048 modification Effects 0.000 description 1
- 229910052757 nitrogen Inorganic materials 0.000 description 1
- 230000010355 oscillation Effects 0.000 description 1
- 230000008635 plant growth Effects 0.000 description 1
- 239000013612 plasmid Substances 0.000 description 1
- 229940072033 potash Drugs 0.000 description 1
- 235000015320 potassium carbonate Nutrition 0.000 description 1
- BWHMMNNQKKPAPP-UHFFFAOYSA-L potassium carbonate Substances [K+].[K+].[O-]C([O-])=O BWHMMNNQKKPAPP-UHFFFAOYSA-L 0.000 description 1
- 238000002864 sequence alignment Methods 0.000 description 1
- 238000004904 shortening Methods 0.000 description 1
- 238000011895 specific detection Methods 0.000 description 1
- 239000008223 sterile water Substances 0.000 description 1
- 208000024891 symptom Diseases 0.000 description 1
- 238000003786 synthesis reaction Methods 0.000 description 1
- 230000009466 transformation Effects 0.000 description 1
- 238000011426 transformation method Methods 0.000 description 1
- 238000010792 warming Methods 0.000 description 1
- 238000005406 washing Methods 0.000 description 1
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6858—Allele-specific amplification
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/13—Plant traits
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/172—Haplotypes
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A40/00—Adaptation technologies in agriculture, forestry, livestock or agroalimentary production
- Y02A40/10—Adaptation technologies in agriculture, forestry, livestock or agroalimentary production in agriculture
Abstract
The invention relates to the field of biological molecular markers, in particular to a TaNAC71-4B gene, a dCAPS molecular marker and application thereof in identifying the potassium absorption and utilization capacity of wheat. The invention provides the use of the TaNAC71-4B gene in the identification of wheat haplotypes, including Hap1 and Hap2. The gene can accurately distinguish haplotypes of wheat and accurately identify potassium absorption and utilization capacity of the wheat.
Description
Technical Field
The invention relates to the field of biological molecular markers, in particular to a TaNAC71-4B gene, a dCAPS molecular marker and application thereof in identifying the potassium absorption and utilization capacity of wheat.
Background
Wheat (Triticum aestivum l.) is an important food crop that provides humans with about 20% of their calories. Wheat is the main grain crop in the world, however, adverse conditions such as drought, commercial temperature and the like are always the main problems restricting the production and development of wheat. With global warming, extreme climate events such as drought, high temperature and the like frequently occur, and the daily growth of people is carried out, the grain containing safety is facing serious challenges. In coping with the counter-stress countermeasure, besides improving the cultivation condition, the breeding of the wheat variety with stress resistance, high yield and stable yield by utilizing the modern molecular biology technology is an economic and effective way.
At present, research on improving the efficient absorption and utilization of the wheat to potassium is not yet carried out, functional markers are developed based on TaNAC71, haplotype analysis is carried out, and correlation analysis is carried out with the efficient absorption and utilization of the potassium to find excellent haplotypes, so that the method has extremely important significance for improving the stress resistance of the wheat and obtaining new varieties of high-yield wheat.
No report has been found to identify wheat haplotypes using the TaNAC71-4B gene.
Disclosure of Invention
In order to solve the problems, the invention provides a TaNAC71-4B gene, a dCAPS molecular marker and application thereof in identifying the potassium absorbing and utilizing capacity of wheat, wherein the gene can accurately distinguish the Hap1 and Hap2 varieties of the wheat.
In order to achieve the above object, the present invention provides the following technical solutions:
the invention provides the use of the TaNAC71-4B gene in the identification of wheat haplotypes, including Hap1 and Hap2.
The invention provides SNP loci related to wheat potassium high-efficiency absorption, wherein the SNP loci comprise one or more of a first SNP locus, a second SNP locus, a third SNP locus, a fourth SNP locus and a fifth SNP locus;
the first SNP locus is positioned at the-1029 bp position of the promoter region of the TaNAC71-4B gene, and the polymorphism is T/C;
the second SNP locus is positioned at the 792bp of the promoter region of the TaNAC71-4B gene, and the polymorphism is G/C;
the third SNP locus is positioned at 651bp of the coding region of the TaNAC71-4B gene, and the polymorphism is C/A;
the fourth SNP locus is positioned at 895bp of the coding region of the TaNAC71-4B gene, and the polymorphism is G/A;
the fifth SNP locus is positioned at 1421bp of the coding region of the TaNAC71-4B gene, and the polymorphism is C/T.
The invention provides application of the SNP locus in the technical scheme in identifying Shan Bei type wheat and/or potassium absorption and utilization capacity of wheat.
The invention provides a dCAPS molecular marker for identifying the Shan Bei type wheat and/or the potassium absorption and utilization capacity of wheat, and the sequence of the dCAPS molecular marker is shown as SEQ ID NO. 1.
The invention provides a dCAPS molecular marker primer pair for identifying the Shan Bei type wheat and/or the potassium absorption and utilization capacity of wheat, wherein the primer pair comprises an upstream primer and a downstream primer; the nucleotide sequence of the upstream primer is shown as SEQ ID NO. 2; the nucleotide sequence of the downstream primer is shown as SEQ ID NO. 3.
The invention provides a kit for identifying the Shan Bei type wheat and/or the potassium absorption and utilization capacity of wheat, which comprises the primer pair of claim 5.
Preferably, the kit further comprises a reagent for PCR amplification and a reagent for enzyme digestion.
The invention provides application of the dCAPS molecular marker or the primer pair or the kit in the technical scheme in wheat breeding and/or identification of Shan Bei type wheat and/or wheat potassium absorption and utilization capacity.
The invention provides a method for identifying the potassium absorption and utilization capacity of wheat, which comprises the following steps:
taking DNA of a sample to be detected as template DNA, and carrying out PCR amplification on the template DNA by utilizing the primer pair in the technical scheme or the primer pair in the kit to obtain a PCR product;
double-enzyme digestion is carried out on the PCR amplification product by using restriction enzymes XhoI and XbaI to obtain an enzyme digestion product;
when the enzyme digestion product is a single 3086bp band, the sample to be detected is a wheat variety which is not potassium and is efficiently absorbed and utilized;
when the enzyme digestion product comprises 2718bp and 368bp short fragments, the material to be detected is a wheat variety with high-efficiency potassium absorption and utilization.
The invention provides a method for identifying wheat haplotype, which comprises the following steps:
taking DNA of a sample to be detected as template DNA, and carrying out PCR amplification on the template DNA by utilizing the primer pair in the technical scheme or the primer pair in the kit to obtain a PCR product;
double-enzyme digestion is carried out on the PCR amplification product by using restriction enzymes XhoI and XbaI to obtain an enzyme digestion product;
when the enzyme digestion product is a single 3086bp band, the haplotype of the sample to be detected is Hap1;
when the cleavage product comprises a 2718bp short fragment and a 368bp short fragment, the haplotype of the material to be detected is Hap2.
The beneficial effects are that:
the invention provides application of TaNAC71-4B gene in identifying wheat genotype. The TaNAC71-4B gene can accurately distinguish the Hap1 and Hap2 varieties of wheat.
The TaNAC71-4B promoter region (-1162 bp to-1 bp) has 2 SNP (-1029T/G, -792G/C) polymorphism mutation sites, and the coding region (1 bp to 1509 bp) has 3 SNP (651C/A, 895G/A, 1421C/T) polymorphism mutation sites. These 5 SNPs were closely linked to form two haplotypes, designated Hap1 and Hap2, respectively, and the Hap2 sequence was found to contain 5 SNPs, with the Hap1 sequence as a control.
The SNP provided by the invention can rapidly and accurately identify the haplotype of wheat; and the wheat variety with high-efficiency potassium can be rapidly and accurately screened out.
The invention provides a dCAPS molecular marker primer pair for identifying Shan Bei type wheat and/or potassium absorption and utilization capacity of wheat. The primer pair can accurately distinguish haplotypes of wheat and accurately identify potassium absorption and utilization capacities of the wheat.
Moreover, the identification method provided by the invention is relatively simple and is easy to use in practical application.
Drawings
FIG. 1 shows the results of amplification of different segments of the TaNAC71-4B gene;
FIG. 2-1 shows SNP sites present in the promoter region (-1162 bp to-1 bp) of TaNAC 71-4B;
FIG. 2-2 shows SNP sites present in the coding region of TaNAC71-4B (1 bp to 1509 bp);
FIGS. 2-3 are associations of SNP sites present in the coding region of TaNAC71-4B (1 bp to 1509 bp) with 5 SNP sites of the TaNAC71-4B promoter and coding region;
the numbers 1 to 30 in FIGS. 2-1 to 2-3 are 30 wheat varieties corresponding to Table 1;
FIG. 3-1 shows the phenotype of different haplotype wheat varieties of TaNAC71-4B under potassium stress conditions;
FIG. 3-2 shows the growth parameters of different haplotype wheat varieties of TaNAC71-4B under potassium stress conditions;
FIG. 4 shows potassium content variation in different tissues of TaNAC71-4B different haplotype wheat varieties under potassium stress conditions;
FIG. 5 shows the discrimination of the different types of haplotype cleavage sites by TaNAC 71-4B;
FIG. 6 is an electrophoretogram of TaNAC71-4B different types of haplotype amplification and their corresponding sequences XhoI and XbaI double-digested.
Detailed Description
The invention provides the use of the TaNAC71-4B gene in the identification of wheat haplotypes, including Hap1 and Hap2. The gene can accurately determine the haplotype of wheat; in a specific embodiment of the invention, haplotypes of 30 wheat varieties were determined using the gene.
The invention provides SNP loci related to wheat potassium high-efficiency absorption, wherein the SNP loci comprise one or more of a first SNP locus, a second SNP locus, a third SNP locus, a fourth SNP locus and a fifth SNP locus; the first SNP locus is positioned at the-1029 bp position of the promoter region of the TaNAC71-4B gene, and the polymorphism is T/C; the second SNP locus is positioned at the 792bp of the promoter region of the TaNAC71-4B gene, and the polymorphism is G/C; the third SNP locus is positioned at 651bp of the coding region of the TaNAC71-4B gene, and the polymorphism is C/A; the fourth SNP locus is positioned at 895bp of the coding region of the TaNAC71-4B gene, and the polymorphism is G/A; the fifth SNP site is positioned at 1421bp of the coding region of the TaNAC71-4B gene, and the polymorphism is C/T, more preferably, the second SNP site is positioned at-792 bp of the promoter region of the TaNAC71-4B gene, and the polymorphism is G/C. The SNP locus can accurately distinguish wheat haplotypes Hap1 and Hap2 and accurately identify whether wheat is a variety of wheat with high potassium absorption efficiency.
According to the advantages of the SNP locus, the invention provides the application of the SNP locus in identifying the Shan Bei wheat and/or the wheat potassium high-efficiency absorption advantage.
The invention provides a dCAPS molecular marker for identifying Shan Bei type wheat and/or potassium absorption and utilization capacity of wheat, wherein the nucleotide sequence of the dCAPS molecular marker is shown as SEQ ID NO. 1, in particular
The invention also provides a primer pair for dCAPS molecular markers in the technical scheme, which comprises an upstream primer and a downstream primer; the nucleotide sequence of the upstream primer is shown as SEQ ID NO. 2, and is specifically GAGGCATGTTGCGCGGGGCCCT; the nucleotide sequence of the downstream primer is shown in SEQ ID NO. 3, and is specifically GTGAAAATACATTTTTTTTATTATGCT. The primers of the invention are respectively designed at the upstream and downstream of the SNP identified by the dCAPS molecular marker in the technical scheme. The primer group has strong specificity and high sensitivity.
The primer pair is preferably designed based on a second SNP locus in the SNP loci in the technical scheme, and the invention also preferably mutates the base T at the-790 bp position of the promoter region of the TaNAC71-4B gene into A before designing the primer pair.
The nucleotide sequence of the coding region of the TaNAC71-4B gene is preferably shown as SEQ ID NO. 4, and specifically comprises the following steps: ATGGACTACGGCTTCGACGGCGCTCTCCAGCTGCCCCCGGGGTTCAGGTTCCACCCCACGGACGAGGAGCTGGTGATGTACTACCTGTGCCGCAAGTGCGGCGGCCTGCCCATCGCCGCGCCGGTGATCGCCGAGGTCGACCTGTACAAGTTCGAGCCGTGGAGGCTGCCGGAGAAGGCGGCGGGAGGCGGGCCGGACTCCAAGGAGTGGTACTTCTTCTCGCCGCGGGACCGCAAGTACCCCAACGGGTCGCGGCCGAACCGCGCCGCCGGGACCGGGTACTGGAAGGCCACGGGCGCCGACAAGCCCGTGGGGTCGCCGCGCCCCGTGGCCATCAAGAAGGCTCTCGTCTTCTACGCCGGCAAGCCCCCCAAGGGCGTCAAGACCAACTGGATCATGCACGAGTACCGCCTCGCCGACGTCGACCGCTCCGCCGCCGCCCGCAAGAAGTCCAACAACGCTCTCAGGGTAACCACCTTGCCTGCCTGCCCACCGCCCCCGTCCCCTCTCTGTCAGTCTGCGCTGATGCTTGGCTGTCTCGTTTAATCCCTTCCTATTTTAGCATTAGCGAGAGATTTACCGTGCATTTAGTATAGAAATCAAGCGAGAGATCTTTCTTGAAATAGCAAGCTGTATTTTAGCTTTAGAAAAGTCAATTGGCAGGTTAGGTGCGTCGTGGCCATGCGAAAAAGAACAAGGGAAAAGGGTCAAAGTTGCAGCACGCTCAAGTTGTCCCTTTCGTCACAGCCTGTAGTTTGGCAGCGACGTGCGGAAAGCAATTGCGGCGGTCGCATGGCGTCATGGCTCACGCACCACGGGATGGAGACAACGGCGCCCGCCTCATCGCCCGCCCTCCCCATCTCCCGTCCACGTACACGTACACTAGCTTTAGTTACTTTTCAAATAAAAAATCTTGCTCGATCGATCTATCGCCGTCGCTGAGACTTTTCTCCTCCTGATCTTTGCAGCTGGATGACTGGGTGCTCTGCCGAATCTACAACAAGAAGGGCGTCATCGAGCGGTACGACACGCCGGACTCCGACGTCGCCGACGTTAAGCCGGCGCCGCCGCCGGCTGCCAAGATCCCGCGGCAAGGCCAGTACCACGCTGGGCCAGCGATGAAGGTCGAGCTGTCCGACTACGGGTTCTACCAGCAGCCGTCGCCGCCGGCCACGGAGATGCTCTGCTTCGACCGGTCCGGGTCGGCGGACCGGGACTCGAACTCGAACCACTCCATGCCGCGCCTGCACACGGACTCCAGCTCCTCGGAGCGCGCGCTGTCCTCGCCGTCGCCCGACTTCCCGAGCGACATGGACTACGCGGAGAGCCAGCACGCCGCCGGCCTCGCCGGGGGGTGGCCGGGCGACGACTGGGGCGGCGTCATAGACGACGACGGGTTCGTCATCGACGGCTCGCTGATTTTCGACCCGCCCTCGCCGGGCGCCTTCGCCCGCGACGCCGCCGCGTTCGGCGACATGCTCACGTACCTGCAGAAACCGTTCTGAATGA;
the nucleotide sequence of the promoter region of the TaNAC71-4B gene is preferably shown in SEQ ID NO. 5, and is specifically CTTTCGATCTTCTCGCTGAGGTTTAAATCTGTTTCGAAAGATTAGATTTACCATTGCACAAAAAAGCAGAAAGATTAAACTTGCCCAAAAAGTTACCCTAGGGACCTACACCTACCGGGCACTTAGTCGCCTAGGAGTACGTGACAATACAGATTTCAATCAGAAGACGATTTTAACCTACCCTAAAAGCTGACCACAAGGCGCCTAGATATCATCGACGGTGGCGATCGATGCAAGTTTTAAACTTGAAATCCGCGGAATCCGCAACGAAACACTTTTTTTTTTTTTACCCTACGAGCTGAGAGATCGACCAAGTGGACGATGGGAATCTCGACGACCCGTACAATTATCCCAAGGGGCGCAAGCACCTCGTGGGCCCCGCGCAACATGCCTCCCTTCCTAACCCTGGGCCCCACCACACAGGCAGGAGTACTACGGACCGCCCTCGTCATATCTCACGGGCTCGGATGCTCCCTCGCCATCCCAGACGGCGACATAACTGCTGACGTCATCCATGACAATTGAGCTCCCCCTCTGGCCCCACGCCTTCATCCGACGGCTCACACGTCTCGTCGCCCGTCCGATGATCGACACGTGACCTATAATCCTACAGTCAACCAGCCCCCTCCTCTCCCAACTTGCACGTGCGTCACATCTTGCCCTCCCCGTCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNACTGATAACCAATCTCCCGAGCGCTCCCTCCGAGCTCAACCCCCCGTTCACCGGACGCGA.
The invention provides a kit for identifying Shan Bei type wheat and/or potassium absorption and utilization capacity of wheat, which comprises the primer pair in the technical scheme. The kit of the invention also preferably comprises a reagent for PCR amplification and a reagent for enzyme digestion; the reagent for cleavage preferably includes restriction enzymes XhoI and XbaI. The sources of the PCR amplification reagent and the cleavage reagent are not particularly limited, and those skilled in the art can routinely purchase the reagents. The primer set has the advantages of strong specificity and high sensitivity, so that the kit can identify the haplotype of wheat and whether the wheat variety is efficiently absorbed and utilized by potassium.
According to the advantages of the dCAPS molecular marker primer pair, the invention provides the primer pair according to the technical scheme or the application of the kit according to the technical scheme in wheat breeding, and also provides the application of the primer pair according to the technical scheme or the kit according to the technical scheme in the identification of the Shan Bei type wheat and/or the potassium absorption and utilization capacity of wheat.
The invention provides a method for identifying wheat with high-efficiency absorption and utilization of potassium, which comprises the following steps:
taking DNA of a sample to be detected as template DNA, and carrying out PCR amplification on the template DNA with the primer pair in the technical scheme or the primer pair in the kit in the technical scheme to obtain a PCR product;
double-enzyme digestion is carried out on the PCR amplification product by using restriction enzymes XhoI and XbaI to obtain an enzyme digestion product;
when the enzyme digestion product is a single 3086bp band, the sample to be detected is a wheat variety which is not potassium and is efficiently absorbed and utilized;
when the enzyme digestion product comprises 2718bp and 368bp short fragments, the material to be detected is a wheat variety with high-efficiency potassium absorption and utilization.
The sample to be tested according to the invention preferably comprises wheat leaves. The volume of PCR amplification of the present invention is preferably 50. Mu.L, including 25. Mu.L of 2X KOD OneTM PCR Master Mix, 0.3. Mu.L of upstream primer, 0.3. Mu.L of downstream primer, 200ng of template DNA and the balance ddH 2 O; the working concentration of the upstream primer is preferably 0.3. Mu.M, the working concentration of the downstream primer is preferably 0.3. Mu.M, and the concentration of the template DNA is preferably 150ng. The reaction procedure of the PCR amplification is preferably 94 ℃ pre-denaturation for 3min; denaturation at 98℃for 10s, annealing at 55℃for 30s, extension at 68℃for 3min, and circulation for 32 times; 68 DEG CExtending for 5min.
The method for extracting, amplifying and digestion of the template DNA is not limited in the present invention, and may be performed in a manner known to those skilled in the art. Therefore, the invention can accurately determine whether the wheat is a wheat variety with high-efficiency potassium absorption and utilization by adopting a conventional method, and the method is simple.
The invention provides a method for identifying wheat haplotype, which comprises the following steps:
taking DNA of a sample to be detected as template DNA, and carrying out PCR amplification on the template DNA by utilizing the dCAPS molecular marker primer pair in the technical scheme or the primer pair in the kit in the technical scheme to obtain a PCR product;
double-enzyme digestion is carried out on the PCR amplification product by using restriction enzymes XhoI and XbaI to obtain an enzyme digestion product;
when the enzyme digestion product is a single 3086bp band, the haplotype of the sample to be detected is Hap1;
when the cleavage product comprises a 2718bp short fragment and a 368bp short fragment, the haplotype of the material to be detected is Hap2.
The sample to be tested according to the invention preferably comprises wheat leaves. The volume of PCR amplification of the present invention is preferably 50. Mu.L, and comprises 25. Mu.L of 2X KOD OneTM PCR Master Mix, 0.3. Mu.L of upstream primer, 0.3. Mu.L of downstream primer, 200ng of template DNA and the balance ddDH 2 O; the working concentration of the upstream primer is preferably 0.3. Mu.M, the working concentration of the downstream primer is preferably 0.3. Mu.M, and the concentration of the template DNA is preferably 150ng. The reaction procedure of the PCR amplification is preferably 94 ℃ pre-denaturation for 3min; denaturation at 98℃for 10s, annealing at 56℃for 30s, extension at 68℃for 3min, and circulation for 32 times; extending at 68℃for 5min.
For further explanation of the present invention, the TaNAC71-4B gene, dCAPS molecular marker and its application in identifying potassium uptake and utilization ability of wheat provided by the present invention will be described in detail with reference to the accompanying drawings and examples, but they should not be construed as limiting the scope of the present invention.
Example 1 selection of excellent haplotypes in Potassium uptake by TaNAC71 Gene
1. Materials and methods
1.1 test materials
The invention selects 30 common wheat varieties (commercial modern cultivars) stored in the laboratory (Henan agricultural university first laboratory, henan 317 laboratory), and the detailed information is shown in Table 1.
TABLE 1 hexaploid wheat varieties used in the present invention
1.2 Experimental methods
The high-fidelity PCR enzyme KOD OneTM PCR Master Mix for PCR amplification is purchased from Toyo-yo, the blunt end cloning vector PMD 19-TVEctor is purchased from full-scale gold biosystems, xhoI and XbaI restriction enzymes are purchased from NEB, and other medicines are made analytically pure.
1.3 primer design
To investigate the genetic diversity of the TaNAC71 gene, the present example sequenced and aligned three copies 4A, 4B, 4D of the TaNAC71 gene sequences, including promoter, 5'utr, exon, intron and 3' utr, from 30 common wheat varieties TaNAC71 from a number of different regions using the re-sequencing results, and further haplotypes were partitioned using software Haploview. Through the SNP locus sequences, taNAC71-4B is found to have more SNP loci, so that the TaNAC71-4B sequence is selected as a research object, and the detailed information of 30 common wheat varieties is shown in Table 1.
First, primers were designed for the 4B copy segment based on the sequence differences of the TaNAC71 gene three copies 4A, 4B, 4D in the wheat genome database (table 2), and primer synthesis and sequencing were performed by henna Shang Ya biotechnology company.
TABLE 2 4B copy segment design primers
1.4 extraction of total DNA from wheat
Total DNA from wheat was extracted by the CTAB method, which is described in the laboratory mature method (Li et al, 2021;J Pineal Res.70 (4): e 12727). Firstly, wheat leaves are quickly frozen and ground by liquid nitrogen, 1mL of preheated CTAB extract is added, and water bath is carried out at 65 ℃ for 1h. Then 12000g is centrifugated for 5min, the supernatant is taken and added with a mixed solution of chloroform and isoamyl alcohol with equal volume for oscillation, and the volume ratio of the chloroform to the isoamyl alcohol in the mixed solution is 24:1; centrifuging 12000g for 10min again, transferring the supernatant to a new tube, adding 2 times of absolute ethyl alcohol, mixing, and standing at-20deg.C for 30min; centrifuging, removing supernatant, washing twice with 75% ethanol solution, naturally air drying, and adding 100 μl sterile water to dissolve DNA.
1.5 determination of different haplotype physiological indicators under Low Potassium treatment
Six varieties of wheat with different haplotypes of Hap1 and Hap2 in table 1 are selected, wherein Hap1 is He 1-He 6, hap2 is He 11-He 16, water culture treatment is carried out (Li et al, 2021;J Pineal Res.70 (4): e 12727), wheat seedlings with consistent growth vigor among varieties are selected when the wheat seedlings grow to a two-leaf period, and endosperm is removed before potassium treatment in order to eliminate the difference among varieties caused by the autotrophic growth of the wheat seedlings; then, wheat seedlings with consistent growth vigor of different varieties are subjected to potassium stress treatment, and the specific conditions are as follows: the normal potassium treatment is marked as +K, and can also be expressed by CK, and the concentration of potassium ions is 2mmol/L; the low potassium treatment was denoted as LK and the potassium ion concentration was 0.1mmol/L. After 35d, phenotypes appear among different treatments, different haplotype wheat varieties are photographed, and the samples are taken to determine relevant indexes. Wherein the calculation formula of the potassium accumulation amount is as follows: potassium accumulation = plant dry weight x plant potassium concentration (mg/plant); potassium utilization index = plant dry weight/plant potassium concentration (mg/plant).
2. Major results of experiments
2.1 amplification and sequencing of the TaNAC71-4B Gene promoter
Using TaNAC71-4B-1 to 3-F/R primers (table 2), 30 hexaploid wheat DNA as template, and high fidelity PCR enzyme (KOD OneTM PCRMaster Mix) to amplify the promoter sequence of TaNAC 71-4B;
the PCR system comprises: 25 mu L KOD OneTM PCR Master Mix (2X), 0.3 mu L (10 mu M) of each of the upstream and downstream primers, 200ng of DNA template, and ddH supplementation 2 O to a total volume of 50. Mu.L;
the PCR reaction procedure was: pre-denaturation at 94℃for 3min; denaturation at 98℃for 10s, annealing at 56℃for 30s, extension at 68℃for 3min,32 cycles; extending at 68deg.C for 5min;
the results are shown in FIG. 1, wherein A is the promoter and coding domain fragment of the TaNAC71-4B gene and primers TaNAC71-4B-F1 and TaNAC71-4B-R1, taNAC71-4B-F2 and TaNAC71-4B-R2, taNAC71-4B-F3 and TaNAC71-4B-R3, B is the result of the fragment amplification of the promoter and coding domain fragment of the different primers TaNAC71-4B gene, wherein the primers used in the first row are TaNAC71-4B-F1 and TaNAC71-4B-R1, the primers used in the second row are TaNAC71-4B-F2 and TaNAC71-4B-F2, the primers used in the third row are TaNAC71-4B-F3 and TaNAC71-4B-R3, the TaNAC71-4B gene is amplified by using primers TaNAC71-4B-F1, taNAC71-4B-R1, taNAC71-4B-F2, taNAC71-4B-R2, taNAC71-4B-F3 and TaNAC71-4B-R3 respectively, promoters and coding domains of different fragments of 1162bp, 1509bp and 1091bp are obtained respectively, M is Mark2000, lanes 1-5 respectively use Loarid 13, yunong 516, lomai 26, yunong 908 and Jinmai 88 as amplification templates, and lanes 6-15 respectively use Ebei wheat 12, round 987, shashan 229, yangmai 23, xinong 529, yangmai 4, 352566, ning Mai, shiyou 20 and Hedy136 as amplification templates.
On the basis, the target fragments of the PCR amplification are respectively recovered, the three fragments are respectively connected with a PMD 19-TVEctor cloning vector and then transformed into escherichia coli, more than three positive clones are respectively picked, and the sequences of the three positive clones are sequenced by using universal primers M13-F and M13-R (table 2).
2.2 Sequence alignment and haplotype analysis of TaNAC71-4B Gene promoter
The sequencing results were spliced and aligned using DNAMAN software (http:// www.lynnon.com).
As a result, as shown in FIGS. 2-1 to 2-3, wherein A in FIG. 2-1 is one of SNP sites present in the promoter region of TaNAC71-4B, which is-1029 bp (T/G), B is another SNP site present in the promoter region of TaNAC71-4B, which is-792 bp (G/C), 2 SNP sites were found in the promoter region (-1162 bp to-1 bp) of 30 wheat varieties of TaNAC71-4B, which are respectively present in-1029 bp (T/G) and-792 bp (G/C), C in FIG. 2-2 is one of SNP sites present in the coding region of TaNAC71-4B, which is 651bp (C/A), D is the second SNP site present in the coding region of TaNAC71-4B, which is 895bp (G/A), and E in FIG. 2-3 is the third SNP site present in the coding region of TaNAC71-4B, which is located in-895 bp (G/A), which is one of SNP sites present in the coding region of-1421 bp (C/C1 bp), which is located in the coding region of 15 bp (C/C1-20 bp), and C is located in the coding region of 15 bp (C1-20 bp (C/C).
The TaNAC71-4B promoter and coding region were haplotyped by DnaSP 5.10 software (http:// www.ub.edu/DnaSP), and as a result, as shown in FIGS. 2-3, F was the TaNAC71-4B promoter and 5 SNP sites of the coding region were associated to form 2 haplotypes of TaNAC71-4B-Hap1 and TaNAC71-4B-Hap2, it was found that these 5 SNPs were closely linked to form two haplotypes, designated as TaNAC71-4B-Hap1 and TaNAC71-4B-Hap2, hereinafter referred to as Hap1 and Hap2, respectively, and the sequence of Hap1 was used as a control, and it was found that the Hap2 sequence contained 5 SNPs.
2.3 Comparison of tolerance of different haplotype wheat varieties of TaNAC71-4B Gene to Low Potassium stress
6 varieties are respectively selected from different TaNAC71-4B haplotype wheat varieties, wherein Hap1 is Lo 13, yunong 516, lo 26, yunong 908, jinmai 88, zheng 7698 and Hap2 is the variety: ebei wheat No. 12, round selection 987, shaan 229, yangmai 23, xinong 529, yangmai No. 4, hap1 also known as Hap-4B-1 or TaNAC71-4B-Hap1, hap2 also known as Hap-4B-2 or TaNAC71-4B-Hap2; wheat seedlings of the variety are cultivated to a two-leaf one-heart period, low-potassium treatment is carried out on the wheat seedlings, and specific steps are shown in a 1.5 low-potassium treatment for determining parts of different haplotype biological indexes, and the phenotype is shown in a figure 3-1: under the low-potassium condition, the plant growth vigor of the Hap2 haplotype wheat variety of TaNAC71-4B is better than that of the Hap1 haplotype wheat variety, and the symptoms of obvious root shortening, leaf wilting and the like do not occur.
The growth parameters of the plant height, root length, fresh weight, dry weight and the like are measured by using a ruler and an electronic balance, and the calculation formula used in the measurement is as follows: relative elongation of roots = treated plant root length-control plant root elongation; relative increase in root dry weight = treatment plant root dry weight-control plant root dry weight; relative increase in aerial plants = upper height of treated plants-upper aerial height of control plants; relative increase in aerial plant dry weight = treated plant aerial dry weight-control plant aerial dry weight.
As shown in fig. 3-2, the relative elongation of root in the subsurface of Hap2 haplotype was found to be significantly higher than that of Hap1 haplotype, and the root dry weight also found a similar trend; in addition, the relative growth of the aerial parts and the trend of the underground parts are the same, and the strain height and the dry matter increment of the Hap2 haplotype are obviously higher than those of the Hap1 haplotype in comparison with the control treatment. The haplotype Hap2 wheat variety has strong tolerance to potassium under the condition of low potassium stress compared with the Hap1 wheat variety.
In order to deeply distinguish the utilization efficiency of different varieties on potash fertilizers, the embodiment dries the wheat plants of different types, and the wheat plants are digested by referring to the early-stage method of the test (Li et al, 2021;JPineal Res.70 (4): e 12727), the potassium concentrations of different tissues on the ground and underground parts are measured, and the potassium content and the utilization index of the plants are calculated. As shown in FIG. 4, A is the concentration of potassium in the above-ground part, B is the potassium content in the above-ground part, C is the potassium utilization index in the above-ground part, D is the potassium concentration in the below-ground part, E is the potassium utilization index in the below-ground part, F is the potassium utilization index in the below-ground part, and under low-potassium conditions, the potassium content and the utilization index in the Hap2 haplotype wheat variety containing TaNAC71-4B are significantly increased, which means that the potassium absorption capacity of the Hap2 haplotype wheat variety under potassium stress conditions is enhanced, a large amount of potassium elements are absorbed, and the potassium elements are further transported to the above-ground part to adapt to the normal growth and development of wheat under the potassium stress conditions. Further illustrated is that the TaNAC71-4B gene comprises a Hap2 haplotype that is an excellent haplotype under wheat potassium stress conditions.
Example 2
Development of TaNAC71-4B gene dCAPS molecular marker and screening of wheat varieties by efficient potassium utilization
1. Experimental materials and methods
The same as in example 1, materials and methods.
2. Major results of experiments
2.1 determination of dCAPS-792 molecular markers
Since the difference between the two haplotype promoters of TaNAC71-4B is a single base difference (SNP), a Cut Amplified Polymorphism (CAPS) molecular marker can be developed based on these differences. Sequence differences between the Hap 2-excellent haplotype promoter and the Hap1 haplotype promoter were analyzed using dCAPS Finder 2.0 (http:// helix. Wust. Edu/dCAPS. Html) and found that the-792 bit sequence was in both G/C forms, A in FIG. 5 being the analysis of the sequence differences between the Hap2 haplotype promoter and the Hap1 haplotype promoter, wherein Hap1 comprises the variety sequence AAGCACCTGGtGGGCC, SEQ ID NO:14, sequence of Hap2 type wheat variety AAGCACCTCGtGGGCC, SEQ ID NO:15, SEQ ID NO:14 and the underlined part in SEQ ID NO:15 are the-792 position, and the lowercase part is the-790 position. To distinguish the above differences, a mutation of T to A at position-790 of the above sequence was designed as a dCAPS primer containing a restriction enzyme XhoI cleavage site, including CTCGAG, SEQ ID NO:16, distinguishing Hap-4B-1 from Hap-4B-2, where B in FIG. 5 is the case where after mutating a single nucleotide site, the Hap2 haplotype is recognized by restriction enzyme XhoI from the Hap1 haplotype, hap2 contains a CTCGAG sequence which is recognized and cleaved by restriction enzyme XhoI, whereas Hap1 contains the sequence CTGGAG and thus cannot be cleaved by restriction enzyme XhoI. Therefore, based on the sequence differences, a dCAPS molecular marker can be developed to distinguish between Hap2 and Hap1 haplotypes and the marker is designated dCAPS-792.
Primers dCAPS-F are respectively designed at the upstream and downstream of the SNP identified by the dCAPS-792 mark, and SEQ ID NO. 2: GAGGCATGTTGCGCGGGGCCCT and dCAPS-R, SEQ ID NO:3: GTGAAAATACATTTTTTTTATTATGCT for distinguishing different haplotypes, and providing basis for screening different varieties by using the subsequent potassium efficiently.
2.2 Application of dCAPS-792 molecular marker
In order to further detect the usability of developing molecular markers, the present embodiment selects the different types of haplotype wheat varieties described above, wherein the wheat varieties of Hap1 are: the wheat varieties of Lo 13, yunong 516, lo No. 26, yunong 908, jin wheat 88, zheng 7698 and Hap2 are: the genome DNA of the varieties are extracted respectively from Ebei wheat No. 12, round selection 987, shaan 229, yangmai 23, xinong 529 and Yangtze wheat No. 4; respectively PCR-amplifying dCAPS-792 molecular markers in different wheat varieties by using the DNA as a template and utilizing the developed dCAPS-792 marker upstream and downstream primers; and (3) configuring a reaction system: 25 μL2× KOD OneTM PCR Master Mix, 0.3 μM each of the upstream and downstream primers, 200ng of DNA template, and ddDH supplementation 2 O was added to a total volume of 50. Mu.L, and the PCR amplification was performed as follows: pre-denaturation at 94℃for 3min; denaturation at 98℃for 10s, annealing at 55℃for 30s, extension at 68℃for 3min, and circulation for 32 times; extending at 68℃for 5min.
In order to obtain the purer SNP fragment with higher concentration, referring to the conventional gene fragment transformation method (Li et al, 2021;J Pineal Res.70 (4): e 12727), recovering PCR products of TaNAC71 in different varieties obtained by the amplification, respectively connecting 19T vectors, transferring into DH5 alpha strain, and extracting plasmids containing target SNP fragments of different varieties after overnight culture for 16 h; and double cleavage was performed using XhoI enzyme (New England Biolabs) and the self-contained XbaI enzyme on the 19T vector. Then, electrophoresis detection is performed.
As shown in FIG. 6, A is TaNAC71 promoter fragment in different haplotypes of wheat, B is an electrophoresis chart of TaNAC71XhoI and XbaI double cleavage in different haplotypes of wheat, M2000 is Marker 2000, lanes 1-6 respectively represent Lo 13, yunong 516, lo No. 26, yunong 908, jinmai 88, zheng 7698, lanes 3086bp are XhoI and XbaI double cleavage, no cleavage of the band comprises vector 2692bp and fragment 394bp, lanes 7-12 represent Ebei 12, round 987, shaanxi 229, yangma 23, xnong 529, yangzhi No. 4, lanes 2718bp and 368bp are XhoI and XbaI double cleavage after cleavage, respectively represent vector 2692bp and primer to cleavage site 26bp fragment, double cleavage of 368bp.
As can be seen from A in FIG. 6, the TaNAC71 promoter fragments in different haplotypes of wheat, namely-1162 bp to-792 bp, can all obtain a single amplified band at 394 bp.
As can be seen from B in FIG. 6, the transformation product of the Hap1 haplotype wheat variety is found to be a single band 3086bp (vector 2692 bp+394 bp) after double digestion, while the amplification product of the Hap2 haplotype wheat variety is changed into two fragments, namely 2718bp (vector 2692 bp+26 bp fragment from the digestion site) and 368bp (fragment) after double digestion.
From the above description, the molecular marker dCAPS-792 can distinguish Hap2 haplotypes from Hap1 haplotypes, and can be applied to molecular design breeding of new varieties of potassium-efficient wheat.
While the invention has been described in terms of preferred embodiments, it is not intended to be limited thereto, but rather to enable any person skilled in the art to make various changes and modifications without departing from the spirit and scope of the present invention, which is therefore to be limited only by the appended claims.
Claims (10)
- Use of tanac71-4B gene for identifying wheat haplotypes, including Hap1 and Hap2.
- 2. SNP loci related to wheat potassium high-efficiency absorption, characterized in that the SNP loci comprise one or more of a first SNP locus, a second SNP locus, a third SNP locus, a fourth SNP locus and a fifth SNP locus;the first SNP locus is positioned at the-1029 bp position of the promoter region of the TaNAC71-4B gene, and the polymorphism is T/C;the second SNP locus is positioned at the 792bp of the promoter region of the TaNAC71-4B gene, and the polymorphism is G/C;the third SNP locus is positioned at 651bp of the coding region of the TaNAC71-4B gene, and the polymorphism is C/A;the fourth SNP locus is positioned at 895bp of the coding region of the TaNAC71-4B gene, and the polymorphism is G/A;the fifth SNP locus is positioned at 1421bp of the coding region of the TaNAC71-4B gene, and the polymorphism is C/T.
- 3. The use of the SNP locus as set forth in claim 2 for identifying Shan Bei type wheat and/or potassium absorbing and utilizing capacity of wheat.
- 4. A dCAPS molecular marker for identifying the Shan Bei type wheat and/or the potassium absorption and utilization capacity of wheat is characterized in that the sequence of the dCAPS molecular marker is shown as SEQ ID NO. 1.
- 5. A dCAPS molecular marker primer pair for identifying wheat Shan Bei type and/or wheat potassium uptake capacity, said primer pair comprising an upstream primer and a downstream primer; the nucleotide sequence of the upstream primer is shown as SEQ ID NO. 2; the nucleotide sequence of the downstream primer is shown as SEQ ID NO. 3.
- 6. A kit for identifying wheat Shan Bei type and/or wheat potassium uptake capacity comprising the primer pair of claim 5.
- 7. The kit of claim 6, further comprising reagents for PCR amplification and reagents for cleavage.
- 8. Use of the dCAPS molecular marker of claim 4 or the primer pair of claim 5 or the kit of claim 6 or 7 in wheat breeding and/or for identifying wheat Shan Bei type and/or wheat potassium uptake capacity.
- 9. A method for identifying the potassium absorption and utilization capacity of wheat, which is characterized by comprising the following steps:using the DNA of a sample to be detected as template DNA, and carrying out PCR amplification on the template DNA by using the primer pair of claim 5 or the primer pair in the kit of claim 6 or 7 to obtain a PCR product;double-enzyme digestion is carried out on the PCR amplification product by using restriction enzymes XhoI and XbaI to obtain an enzyme digestion product;when the enzyme digestion product is a single 3086bp band, the sample to be detected is a wheat variety which is not potassium and is efficiently absorbed and utilized;when the enzyme digestion product comprises 2718bp and 368bp short fragments, the material to be detected is a wheat variety with high-efficiency potassium absorption and utilization.
- 10. A method for identifying a wheat haplotype comprising the steps of:using the DNA of a sample to be detected as template DNA, and carrying out PCR amplification on the template DNA by using the primer pair of claim 5 or the primer pair in the kit of claim 6 or 7 to obtain a PCR product;double-enzyme digestion is carried out on the PCR amplification product by using restriction enzymes XhoI and XbaI to obtain an enzyme digestion product;when the enzyme digestion product is a single 3086bp band, the haplotype of the sample to be detected is Hap1;when the cleavage product comprises a 2718bp short fragment and a 368bp short fragment, the haplotype of the material to be detected is Hap2.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202211022340.5A CN116334271A (en) | 2022-08-25 | 2022-08-25 | TaNAC71-4B gene, dCAPS molecular marker and application thereof in identification of wheat potassium absorption and utilization capacity |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202211022340.5A CN116334271A (en) | 2022-08-25 | 2022-08-25 | TaNAC71-4B gene, dCAPS molecular marker and application thereof in identification of wheat potassium absorption and utilization capacity |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN116334271A true CN116334271A (en) | 2023-06-27 |
Family
ID=86890377
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202211022340.5A Pending CN116334271A (en) | 2022-08-25 | 2022-08-25 | TaNAC71-4B gene, dCAPS molecular marker and application thereof in identification of wheat potassium absorption and utilization capacity |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN116334271A (en) |
-
2022
- 2022-08-25 CN CN202211022340.5A patent/CN116334271A/en active Pending
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN103305510B (en) | Rice blast resistance gene Pi9 gene specificity molecular marker Pi9SNP as well as preparation and application thereof | |
| KR101095220B1 (en) | DNA marker associated with resistance of cabbage clubroot disease and uses thereof | |
| CN105950747A (en) | Rice blast resistance gene Pi1 functional specificity molecular marker and application thereof | |
| CN109628628B (en) | Development and application of SNP (single nucleotide polymorphism) marker of rice blast resistance gene Pi2 | |
| Wang et al. | Developments of functional markers for Fom-2-mediated fusarium wilt resistance based on single nucleotide polymorphism in melon (Cucumis melo L.) | |
| CN104789654A (en) | Molecular marker for rice blast resistance gene Pita and application thereof | |
| CN113046467B (en) | SNP locus obviously associated with wheat stripe rust resistance and application thereof in genetic breeding | |
| CN108456743B (en) | SNP (Single nucleotide polymorphism) marker related to flowering period and mature period of soybean as well as detection primer, method and application thereof | |
| CN104805081A (en) | Wheat grain heavy molecular marker and application thereof | |
| CN113046466B (en) | SNP locus obviously associated with wheat powdery mildew resistance and application of SNP locus in genetic breeding | |
| CN111334597B (en) | SNP (Single nucleotide polymorphism) site and KASP (Kaempferi protein) marker for detecting powdery mildew resistance of watermelon and application thereof | |
| CN111607664B (en) | Application of SNP molecular marker on 1DS chromosome related to wheat stripe rust | |
| CN116334271A (en) | TaNAC71-4B gene, dCAPS molecular marker and application thereof in identification of wheat potassium absorption and utilization capacity | |
| CN102094091B (en) | Method for separating and detecting spontaneous mutation gene based on agarose gel denaturation and renaturation and biotin affinity adsorption | |
| CN110257553A (en) | A kind of KASP molecule labelling method for identifying resistance gene of rice blast Pigm | |
| CN109797235A (en) | With the molecular labeling R112823 of resistance gene of rice blast Pi1 close linkage | |
| CN114736981B (en) | Functional specificity PCR molecular marker of rice blast resistance gene Pi25 and application thereof | |
| CN109825619A (en) | With the molecular labeling R060939 of resistance gene of rice blast Pigm close linkage | |
| CN115927734B (en) | KASP molecular marker for identifying hardness of pear fruit, KASP primer and application thereof | |
| CN111235292B (en) | Rye 4RS chromosome arm specific KASP molecular marker and application thereof | |
| CN116814841B (en) | Primer group for identifying rice black brown glume gene HK4, and method and application thereof | |
| KR100973181B1 (en) | Qualitative analysis methods for LM watermelon using DIP-1 as an endogenous gene | |
| KR101236316B1 (en) | SSR primer and kits derived from Acanthopanax senticosus, and use of there | |
| CN107130018A (en) | Nitrogen in Rice efficiently utilizes gene qngr9 detection method and application | |
| CN106350514A (en) | Molecular marker OSb1b-SV4 closely linked with genes of resistant bacterial blight of rice |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination |