CN109554503B

CN109554503B - Molecular marker for early sex identification of actinidia arguta seedlings and application of molecular marker

Info

Publication number: CN109554503B
Application number: CN201910097176.6A
Authority: CN
Inventors: 齐秀娟; 方金豹; 钟云鹏; 郭丹丹; 林苗苗; 孙雷明; 王然; 陈锦永; 顾红
Original assignee: Zhengzhou Fruit Research Institute CAAS
Current assignee: Zhengzhou Fruit Research Institute CAAS
Priority date: 2019-01-31
Filing date: 2019-01-31
Publication date: 2022-01-07
Anticipated expiration: 2039-01-31
Also published as: CN109554503A

Abstract

The invention belongs to the field of actinidia arguta artificial cultivation and molecular biology, and particularly relates to a actinidia arguta seedling sex early-stage identification molecular marker and application thereof. As most of actinidia arguta belong to male and female different plants, the economic value of the female plants is obviously higher than that of the male plants, the juvenile period of seedlings in the breeding process is too long, and the male and female plants can be distinguished by naked eyes only in 5-7 years, so that the breeding cost can be greatly saved if the sex of the seedlings is identified in the early stage. The invention provides a molecular marker for early sex identification of actinidia arguta seedlings, and establishes an actinidia arguta sex-assisted breeding kit and an actinidia arguta sex early identification method on the basis of the molecular marker.

Description

Molecular marker for early sex identification of actinidia arguta seedlings and application of molecular marker

Technical Field

The invention belongs to the field of actinidia arguta artificial cultivation and molecular biology, and particularly relates to a actinidia arguta seedling sex early-stage identification molecular marker and application thereof.

Background

The world's kiwi industry development originates in the beginning of the twentieth century, while the Chinese kiwi industry development begins at the end of the seventies of the last century. The early cultivated varieties mainly come from original kiwi varieties (Actinidia chinensis planch. var. chinensis) and delicious kiwi varieties (A. chinensis planch. var. deliciosa A. chev.) in Actinidia chinensis planch. Actinidia arguta (a. arguta (Siebold & Zucc.) planch.ex Miq.) is the emerging cultivar that has developed most rapidly in recent years.

Morphologically, the flower type of actinidia is a perfect flower, with most species belonging to functional hermaphrodite. In the seedling breeding process of the actinidia plants, the juvenile period is generally 5-7 years, and due to the special genetic background, the offspring is usually more male than female. As is known, as fruit tree economic crops, the cultivation value, economic value and production demand of female plants are obviously greater than those of male plants, and the current artificial breeding work is mainly focused on the breeding aspect of female varieties. Therefore, if a marker or a method for early sex determination of seedlings can be developed, a great amount of breeding cost such as manpower, material resources and time can be saved, and the breeding process is accelerated.

Similar studies have been conducted by researchers, such as lissaka, etc., attempting to identify sex by methods such as physiological and biochemical identification (lissaka, canawanwan, minium, etc.: actinidia arguta sex identification study based on morphological observation and physiological and biochemical methods, northern horticulture, 2014(24): 6-9.); chengning et al used isozyme assay to identify sex (Chengning, Lianghong, Zhudonghua: different sex peroxidase and esterase isozyme assay of Kiwi berry, agriculture and technology, 2004,24(1):40-43.), but the above method results are easily affected by environmental factors and the accuracy is generally low.

The DNA molecular marker is based on nucleotide sequence variation among individuals, is a direct reflection of individual genetic variation of organisms, can detect the difference on the nucleotide sequence among the organisms by utilizing the DNA molecular marker, and provides a new way for the early sex identification of the hermaphrodite plants.

At present, some reports on the sex identification molecular marker research of actinidia plants are available. For example, SmX and SmY1 are SCAR (sequence characterized amplified region) markers developed by Gill et al by group segregation Analysis (BSA), using diploid Actinidia chinensis fruiting population (GILL GP, HARVEY CF, GARDNER RC, et al. development of a segment-linked PCR markers for gene identification in active & Applied Genetics,1998,97(3): 439. 445.), where SmX is a female specific marker and SmY1 is a male specific marker; through tests, SmX can only identify the sex of 1 family in 3 families, but can not be used for other 2 families, and the identification accuracy of SMY1 reaches 88%, so that the sex of Chinese kiwi fruits can be effectively distinguished. As another example, A001, A002 and A003 are SSR (simple sequence repeat) markers (ZHANG Q, LIU CY, LIU YF, et al. high-intensity interactive genetic maps of kit and the identification of sequence-specific markers. DNA Research,2015,22(5): 367) developed by RAD-seq technique using the interspecies cross F1 population of Kiwi-Kiwi and Zhang Kiwi et al, the reliability of which was verified in 174F 1 individuals of the population used in the study; a001 is a female specific marker, which not only shows higher accuracy in the F1 generation, but also can identify the sex of another 3 parts of actinidia sorbifolia germplasm resources ('sorb 3', 'sorb 4' and 'sorb 5'); differential fragments with different sizes are respectively amplified from A002 and A003 in female individuals and male individuals and can be used for identifying the sex of plants; however, tests have found that the sex of all actinidia sinensis and actinidia sorboso plants used in the study can be identified only with a003 or with a001 and a002 together. However, the markers found in the current research are only verified in the report of the research material sample, and none of the markers has sex specificity through the previous test on the variety or single plant of actinidia arguta with known sex.

Although researches on actinidia arguta sex markers have been reported (Lixu, Wu pine right, Jiang Bright, etc.: actinidia arguta sex-related SRAP molecular markers, Jiangsu agricultural science, 2016,44(8): 69-71), no strip with sex specificity is found in related researches, complex cluster analysis needs to be carried out on a plurality of unstable polymorphic strips to obtain a test result, and the sex matching rate of the obtained cluster analysis result and a sample can only reach 70%. Moreover, the test method has poor universality, complex operation in the test process, high cost of required manpower and time, and low accuracy of test results due to the fact that the stability of the results is easily influenced by test operation. In view of this, the development of the molecular marker for early identification of the actinidia arguta seedling sex, which has the advantages of good universality, simple operation, good stability and high accuracy, has important practical significance for the actinidia arguta artificial cultivation industry.

Disclosure of Invention

The invention aims to provide a novel and effective molecular marker for early sex determination of actinidia arguta seedlings.

Firstly, the invention provides a actinidia arguta seedling sex early stage identification molecular marker, wherein the forward primer sequence of the molecular marker is as follows: 5'-TCTTCCTCTTGGTGCCCG-3', the reverse primer sequence is: 5'-TCAAAGAACCGCTAATCCCAT-3' are provided.

Further, the molecular-labeled forward primer and reverse primer are used for amplifying the actinidia arguta genomic DNA, the length of an amplification product is 609bp, and the sequence is as follows:

TCTTCCTCTTGGTGCCCGGTGTTTCCCCATGGGGTATATGAATTTCCACTTGAAGATCCGGAACTCTGACGCTTTGAATTTTGTCCTCTACTTGGACTCCCTCCAGATCGCTTCTTATTGCTCTCCCGATATTGGGACATCTCATCTAATGCTCTCTCAAAAATTATTGCTCATTGAAGGACCTCTTGATGGTTTGGCAATCGTAATATGTCTACTTTGTTGTGGATGTTTCACTACAACCCTACTTCAAACTTTCTCACCTTGCGAGATTTTGTCAAAATAATATGCGGGGCATAACAAGATAATTCTATGAACTTGGCATTGTACTCTACTACAGTCGTATTTCCTTGCACCAAATTAATAAATTCTACAATTTACTGATCCCTGACAGTTTCGAGAAAATACTCTTTGTTGAACACTTCTAAAACCCTAGGCCACAACCATAACGGCTCCAGTAGCTTTTTCAACTACCACCAAACTAGTGCGGCTTCCTCAAAAGTAAAGGTGGCAAGCGTCCCTTTCTGGTCATCAGTGCAAGGTAGGACTTCGAACACTCTCTCAAATCCCAAGAGCCAAGATTCCGCGGTCATGGGATTAGCGGTTCTTTGA。

further, the invention also relates to application of the molecular marker in auxiliary sex breeding of actinidia arguta.

Meanwhile, the invention also relates to application of the molecular marker in auxiliary breeding of kiwi fruit sex.

In addition, the invention also provides a actinidia arguta sex-assisted breeding kit, and the kit contains the primer pair with the molecular marker.

Finally, the invention also provides an early identification method of the actinidia arguta sex, which comprises the following steps:

(1) extracting actinidia arguta genome DNA:

picking young leaves of Actinidia arguta, freezing in liquid nitrogen, and storing in a refrigerator at-80 deg.C; taking 100-200 mg of frozen leaf tissue, putting the frozen leaf tissue into a 2ml EP tube containing 1 steel ball, freezing the frozen leaf tissue in liquid nitrogen again, grinding the frozen leaf tissue into fine powder by using a sample grinder, extracting the sample genome DNA by using a plant genome DNA extraction kit, diluting the concentration of the template DNA to 20 ng/mu L, and storing the sample genome DNA in a refrigerator at the temperature of-20 ℃ for later use;

(2) labeling the primer sequence:

forward primer sequence: 5'-TCTTCCTCTTGGTGCCCG-3' the flow of the air in the air conditioner,

reverse primer sequence: 5'-TCAAAGAACCGCTAATCCCAT-3', respectively;

(3) and (3) PCR reaction system:

the concentration is 400 nmol.L ^-11 μ l of the forward primer of (1),

the concentration is 400 nmol.L ^-11 μ l of the reverse primer of (1),

ddH₂O——6μl，

PCR mix——10μl，

DNA template with concentration of 20 ng/. mu.l-2. mu.l;

(4) PCR amplification procedure:

(5) and (4) judging a result:

the male sample showed a specific band, and the female sample showed no band.

Further, in the early sex identification method of actinidia arguta, the PCR mix in the PCR reaction system is 2 xTaq PCR Mastermix containing dye.

By detecting 95 parts of actinidia arguta single plants with known sex, the test accuracy of the molecular marker and identification method can reach 95.7%, the molecular marker and method are good in universality, simple to operate and good in stability, and have good application prospects.

Drawings

In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings used in the description of the embodiments or the prior art will be briefly described below, it is obvious that the drawings in the following description are only some embodiments of the present invention, and for those skilled in the art, other drawings can be obtained according to the drawings without creative efforts.

FIG. 1 is a graph of kmer distribution specific for male and female pools.

FIG. 2 is a diagram showing the results of sex determination of Actinidia arguta by using the molecular marker of the present invention.

FIG. 3 is a graph showing the results of sexing actinidia arguta using SmY1 marker at an annealing temperature of 67 ℃.

FIG. 4 is a graph showing the results of sex determination of Actinidia arguta using A001 marker at an annealing temperature of 67 ℃.

FIG. 5 is a graph showing the results of sex determination of Actinidia arguta by A002 marker at 65 deg.C.

FIG. 6 shows the amplification result of A001 marker in actinidia arguta genomic DNA.

FIG. 7 shows the amplification result of A002 marker in actinidia arguta genomic DNA.

Detailed Description

The embodiments of the present invention are described below with reference to specific embodiments, and other advantages and effects of the present invention will be easily understood by those skilled in the art from the disclosure of the present specification. The invention is capable of other and different embodiments and of being practiced or of being carried out in various ways, and its several details are capable of modification in various respects, all without departing from the spirit and scope of the present invention.

Before the present embodiments are further described, it is to be understood that the scope of the invention is not limited to the particular embodiments described below; it is also to be understood that the terminology used in the examples is for the purpose of describing particular embodiments only, and is not intended to limit the scope of the present invention.

Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. In addition to the specific methods, devices, and materials used in the examples, any methods, devices, and materials similar or equivalent to those described in the examples may be used in the practice of the invention, in addition to the specific methods, devices, and materials used in the examples, in keeping with the knowledge of one skilled in the art and with the description of the invention.

Example 1: development of actinidia arguta specific sex marker primers

Firstly, adding 2 male and female plant parents into 15 male and female plants of a hybrid seedling group of a ruby star (actinidia arguta variety) multiplied by 11-17 (male actinidia arguta), extracting DNA and establishing a BSA mixed pool; sequencing by using an Illumina HiSeq sequencing technology platform, performing bioinformatics analysis, including genome assembly and comparison statistics with a reference genome, SNP detection and annotation, Small InDel detection and annotation, performing sex determination gene association analysis and developing primer sequences.

The sequencing obtains Raw Data of 31Gbp in total, clear Data obtained after filtering is 30Gbp, Q30 reaches 92.67%, and the average sequencing depth of each individual is 15X. The average alignment of the sample to the reference genome was 87.42%, the average depth of coverage was 15X, and the genome coverage was 74.81% (at least 1X coverage).

About 2510 SNPs were obtained between 2 samples and the reference genome, 698 indels, 47917 obtained from R01, and 54913 SV variations obtained from R02. The genes of SNP nonsynonymous mutation, InDel mutation and SV are detected between a sample and a reference genome, and the genes with DNA level variation are annotated by KEGG, GO, COG, NR and SwissProt databases.

(II) sex-determining Gene Association analysis and development of primer sequences

(1) Gender specific kmer (fragment) analysis

In order to obtain gender-related candidate reads, quality filtering is firstly carried out on a male and female mixed pool through perl scripts to obtain a high-quality sequence. The resulting high quality sequences are then subjected to kmer analysis to obtain candidate gender specific reads in preparation for subsequent assembly. The sequences of the two pools are cut by 35kmer, and kmer starting from AG is selected, so that the total number of kmer is reduced, and the purposes of optimizing calculation speed and shortening analysis time period are achieved on the premise of not influencing sex determination accuracy.

Next, calculating the frequency of each kmer in the male mixed pool and the female mixed pool, and filtering according to the sum of the frequencies of the two mixed pools, wherein if the lowest frequency of the male mixed pool and the female mixed pool is more than 2 and less than 200, the kmer is left for identifying the gender-specific reads.

And after obtaining the kmers meeting the filtering conditions, comparing the frequency of each kmer of the male mixing pool and the female mixing pool, if the frequency of the kmer in the female mixing pool is 0, reserving the kmer as a male mixing pool specific kmer, and finally obtaining a male mixing pool specific kmer library shown in the attached drawing 1, and extracting the double-end reads of the male mixing pool corresponding to the library for subsequent assembly.

(2) Raw data specific to candidate males

By the first analysis, 14,052,363 reads were obtained as candidate male-specific paired-end sequencing data.

(3) Candidate male specific sequence assembly

The candidate male specific paired-end sequencing data were assembled using the saopDenovo2 software, which uses default parameters to finally assemble 5786 sequences. However, as can be seen from the male-binary and the female-binary sequences in FIG. 2, reads corresponding to the male-specific kmer may also be present in the female pool, i.e., 5786 sequences obtained by assembly contain both male-specific and non-specific sequences, and therefore further filtering is required.

(4) Male specific sequence identification

By means of bowtie alignment (mismatch is not allowed), original reads of the male mixed pool and the female mixed pool are respectively aligned to the assembly sequence obtained in the step 3, and the alignment of the reads of the two mixed pools is analyzed, so that the assembly sequence can be divided into two parts: male specific sequences and sequences to be identified. If the assembled sequence has a sequencing depth in the male mixed pool and no alignment data in the female mixed pool, the sequence is a male specific sequence, and the sequences which do not meet the conditions are collectively called sequences to be identified, and 19 pairs of male specific sequences are obtained.

(5) Male specific gene prediction and functional annotation thereof

The 38 male specific sequences were subjected to gene prediction, and 9 genes were obtained by web page analysis using Augustus gene prediction software. Finally, Nr, COG, GO, Pfam, TrEMBL and Swissprot annotations were made for these 9 genes.

(III) designing a primer according to the male specific gene, and carrying out PCR verification

And respectively designing 9 pairs of primers according to 9 male specific sequences obtained by sequencing, and detecting PCR products by 1% agarose gel electrophoresis. After PCR verification of 95 strains of the pool-building population and other wild nature populations, the applicability of the developed primers was determined.

9 male specific fragments are obtained by sequencing and respectively correspond to 9 pairs of primers. Screening all 9 pairs of primers to obtain 2 pairs of primers with male specificity, namely primer5.1 and primer 11; of the remaining 7 primer pairs, primers 1.1, primer2.2 and primer6.1 did not amplify any clear bands; primers primer3.1 and primer4.1 gave clear bands but no sex specificity.

Example 2: early sex identification method for actinidia arguta

(I) extraction of actinidia arguta leaf genome DNA

(1) Sampling and storing: placing young leaves of Actinidia arguta in liquid nitrogen for freezing, and storing in a refrigerator at-80 deg.C.

(2) Extracting and storing leaf genome DNA: and (3) taking 100-200 mg of frozen leaf tissue, putting the frozen leaf tissue into a 2ml EP tube containing 1 steel ball, freezing the frozen leaf tissue in liquid nitrogen again, and grinding the frozen leaf tissue into fine powder by using a sample grinder. A plant genome DNA rapid extraction kit (full name: DH08CTAB plant genome DNA rapid extraction kit) produced by Beijing pule Hai biological science and technology Limited company is used, a CTAB method is used for extracting sample genome DNA, and the specific extraction steps are carried out according to the kit instructions. The template DNA concentration was diluted to 20 ng/. mu.L and stored in a freezer at-20 ℃ for further use.

(3) The main instrument models are as follows:

the Centrifuge is of eppendorf Centrifuge 5810R type;

the micro ultraviolet spectrophotometer is NANODROP 1000 type;

the gel imaging system is JY04S-3E model (Beijing Junyi Oriental electrophoresis equipment Co., Ltd.).

(II) primer sequence information (5 '-3')

And (3) forward direction F: TCTTCCTCTTGGTGCCCG, respectively;

reverse R: TCAAAGAACCGCTAATCCCAT are provided.

(III) PCR System (20. mu.l)

Using a 20. mu.l PCR reaction system containing forward and reverse primer concentrations of 400 nmol.L^-1Each 1. mu.l, ddH₂O6. mu.l, PCR mix 10. mu.l, 20 ng/. mu.l template DNA 2. mu.l.

The PCRmix used for the assay was Beijing kang century Biotechnology Inc., 2 XTaq PCR Mastermix (Dye), Cat. No.: CW0682S (1ml), CW0682M (5ml), CW0682L (25 ml).

The PCR system comprises:

primer F (Forward primer) -1. mu.l (concentration 400 nmol. L)^-1)；

Primer R (reverse primer) -1. mu.l (concentration 400 nmol. L)^-1)；

ddH₂O——6μl；

PCR mix——10μl；

DNA template-2. mu.l (concentration 20 ng/. mu.l).

(IV) PCR procedure

The PCR amplification procedure was: pre-denaturation at 94 ℃ for 5min, annealing at 94 ℃ for 30s, annealing at 60 ℃ for 40s, annealing at 72 ℃ for 40s (35 cycles of the last three steps), extension at 72 ℃ for 2min, and storage at 4 ℃ for 20 min.

The PCR instruments used were C1000Touch Thermal Cycler and S1000 Thermal Cycler.

PCR procedure:

(V) result display

As shown in FIG. 2, specific bands appeared in the male samples, and no bands appeared in the female samples.

(VI) demonstration of newly developed marker

The primer amplification product is recovered and sequenced, the length of the product is 609bp, and the sequence is as follows: TCTTCCTCTTGGTGCCCGGTGTTTCCCCATGGGGTATATGAATTTCCACTTGAAGATCCGGAACTCTGACGCTTTGAATTTTGTCCTCTACTTGGACTCCCTCCAGATCGCTTCTTATTGCTCTCCCGATATTGGGACATCTCATCTAATGCTCTCTCAAAAATTATTGCTCATTGAAGGACCTCTTGATGGTTTGGCAATCGTAATATGTCTACTTTGTTGTGGATGTTTCACTACAACCCTACTTCAAACTTTCTCACCTTGCGAGATTTTGTCAAAATAATATGCGGGGCATAACAAGATAATTCTATGAACTTGGCATTGTACTCTACTACAGTCGTATTTCCTTGCACCAAATTAATAAATTCTACAATTTACTGATCCCTGACAGTTTCGAGAAAATACTCTTTGTTGAACACTTCTAAAACCCTAGGCCACAACCATAACGGCTCCAGTAGCTTTTTCAACTACCACCAAACTAGTGCGGCTTCCTCAAAAGTAAAGGTGGCAAGCGTCCCTTTCTGGTCATCAGTGCAAGGTAGGACTTCGAACACTCTCTCAAATCCCAAGAGCCAAGATTCCGCGGTCATGGGATTAGCGGTTCTTTGA

The sequences are subjected to Blast analysis in Gene-bank, similar sequences are not obtained, and the sequence is a brand new labeled primer.

Comparative example: application detection of existing kiwi fruit sex marker on actinidia arguta

(I) primer Source and information

SmX and SmY1 methods for labeling primer references Gill et al; a001, A002 and A003 labeled primers refer to the methods of Zhang Qiong and the like. The primers used were all synthesized by Shanghai Bioengineering Co., Ltd, and the specific primer information is shown in Table 1 below.

TABLE 1 sex marker primer information for 5 Actinidia chinensis planch used in this study

(II) general verification of SmX, SmY1, A001, A002 and A003 sex markers in actinidia arguta

In the preliminary experiment stage, we utilized the PCR conditions in the reference literature, and the 5 molecular markers are used as primers, and DNA samples of 16 actinidia arguta (female 8 strains, male 8 strains) are used as templates, and no sex-specific band is found in the obtained products.

Therefore, in order to better verify its versatility, a system optimization experiment was performed. Selecting 6 male sample and 6 female sample DNAs as templates to carry out a system optimization test, and screening a proper annealing temperature, wherein the system and the program of the optimization test are as follows:

(1) using a 20. mu.l reaction system containing 10. mu.l of 1 XTAQQ PCR MasterMix (Dye), 400 nmol. L of each of the forward and reverse primers^-120ng template DNA;

(2) the PCR amplification procedure was: pre-denaturation at 94 deg.C for 5min, at 94 deg.C for 30s, at 52-68 deg.C (52 deg.C, 53.1 deg.C, 55.2 deg.C, 58.2 deg.C, 61.9 deg.C, 64.9 deg.C, 67 deg.C and 68 deg.C for 30s, at 72 deg.C for 40s, for 35 cycles, and at last at 72 deg.C for 2 min;

(3) detecting the PCR amplification product by adopting 1% agarose gel electrophoresis and 8% polyacrylamide gel electrophoresis, and taking clear polymorphic bands and consistent lengths in the product corresponding to each marker as the detection basis of proper annealing temperature;

(4) the versatility of each marker in other actinidia arguta samples was verified using appropriate annealing temperatures.

(III) verification result

(1) System optimization and sex identification universal verification of SmX and SmY1 markers in actinidia arguta samples with known sex

The genome DNA of 12 actinidia arguta samples is used for SmY1 and SmX marked system optimization experiments, and the results show that:

SmY1 the optimum annealing temperature for amplification in actinidia arguta genomic DNA is 67 ℃, see figure 3, and the amplified fragment lengths are about 400bp and about 200bp respectively, which are obviously smaller than the product fragment length of SmY1 in the reference (in the reference, the product length of the primer is 770 bp); whereas annealing temperatures below 64.9 ℃ do not allow efficient amplification of the polymorphic fragments.

SmX marker in the preliminary validation test using 6 male and 6 female samples as materials, the amplification result of SmX marker did not amplify a clear and consistent band in any one sample, the polymorphism was poorly characterized, there was no sex specificity, and thus the sample validation was not continued to be expanded.

(2) System optimization and sex identification universal verification of A001, A002 and A003 markers in actinidia arguta samples with known sex

A test is designed by using 6 male samples and 6 female samples of actinidia arguta, and the amplification system optimization of three markers A001, A002 and A003 is carried out.

The optimal annealing temperature of the A001 marker in actinidia arguta is 67 ℃, as shown in figure 4, when the annealing temperature is 67 ℃, two polymorphic fragments appear in an amplification product, but sex difference is not shown;

the most suitable annealing temperature of A002 marker in Actinidia arguta is 65 deg.C, as shown in figure 5, when the annealing temperature is 65 deg.C, a clear polymorphic band is obtained, and in 6 female samples, there are two samples without bands;

since no clear polymorphic band was detected in the A003-labeled amplification product, in a further validation test, only the markers A001 and A002 were used for validation, and the use of A003 was abandoned.

The versatility of both a001 and a002 markers in actinidia arguta was further verified using 29 male and 35 female samples, respectively, and fig. 6 and 7 show the amplification results of both markers in a portion of the sample genomic DNA. The results show that: polymorphic fragments appear in the amplification products of A001 and A002, but the two markers do not show sex specificity to actinidia arguta germplasm resources.

While the preferred embodiments and examples of the present invention have been described in detail, the present invention is not limited to the embodiments and examples, and various changes can be made without departing from the spirit of the present invention within the knowledge of those skilled in the art.

SEQUENCE LISTING

<110> Zhengzhou fruit tree institute of Chinese academy of agricultural sciences

<120> actinidia arguta seedling sex early stage identification molecular marker and application thereof

<130> 2019

<160> 3

<170> PatentIn version 3.3

<210> 1

<211> 18

<212> DNA

<213> Artificial sequence

<400> 1

tcttcctctt ggtgcccg 18

<210> 2

<211> 21

<212> DNA

<213> Artificial sequence

<400> 2

tcaaagaacc gctaatccca t 21

<210> 3

<211> 609

<212> DNA

<213> Artificial sequence

<400> 3

tcttcctctt ggtgcccggt gtttccccat ggggtatatg aatttccact tgaagatccg 60

gaactctgac gctttgaatt ttgtcctcta cttggactcc ctccagatcg cttcttattg 120

ctctcccgat attgggacat ctcatctaat gctctctcaa aaattattgc tcattgaagg 180

acctcttgat ggtttggcaa tcgtaatatg tctactttgt tgtggatgtt tcactacaac 240

cctacttcaa actttctcac cttgcgagat tttgtcaaaa taatatgcgg ggcataacaa 300

gataattcta tgaacttggc attgtactct actacagtcg tatttccttg caccaaatta 360

ataaattcta caatttactg atccctgaca gtttcgagaa aatactcttt gttgaacact 420

tctaaaaccc taggccacaa ccataacggc tccagtagct ttttcaacta ccaccaaact 480

agtgcggctt cctcaaaagt aaaggtggca agcgtccctt tctggtcatc agtgcaaggt 540

aggacttcga acactctctc aaatcccaag agccaagatt ccgcggtcat gggattagcg 600

gttctttga 609

Claims

1. The molecular marker for early sex identification of actinidia arguta seedlings is characterized in that the forward primer sequence of the molecular marker is as follows: 5'-TCTTCCTCTTGGTGCCCG-3', the reverse primer sequence is: 5'-TCAAAGAACCGCTAATCCCAT-3', amplifying the actinidia arguta genome DNA by using the forward primer and the reverse primer, wherein the length of an amplification product is 609bp, and the sequence is as follows:

2. the use of the molecular marker of claim 1 in actinidia arguta gender-assisted breeding.

3. A actinidia arguta sex-assisted breeding kit, characterized in that the kit contains the primer pair as claimed in claim 1.

4. An early sex identification method for actinidia arguta comprises the following steps:

(1) extracting actinidia arguta genome DNA:

(2) labeling the primer sequence:

reverse primer sequence: 5'-TCAAAGAACCGCTAATCCCAT-3', respectively;

(3) and (3) PCR reaction system:

the concentration is 400 nmol.L^-11 μ l of the forward primer of (1),

the concentration is 400 nmol.L^-11 μ l of the reverse primer of (1),

ddH₂O —— 6μl，

PCR mix —— 10μl，

DNA template with concentration of 20 ng/. mu.l-2. mu.l;

(4) PCR amplification procedure:

(5) and (4) judging a result:

the male sample showed a specific band, and the female sample showed no band.

5. The method of claim 4, wherein the PCR mix in the PCR reaction system is 2 XTaq PCR MasterMix containing dye.