CN113403307A

CN113403307A - Rhododendron erythropolis petal RhCHS gene promoter and flower color breeding application

Info

Publication number: CN113403307A
Application number: CN202010565848.4A
Authority: CN
Inventors: 贾永红; 吴月燕
Original assignee: Zhejiang Wanli University
Current assignee: Zhejiang Wanli University
Priority date: 2020-06-19
Filing date: 2020-06-19
Publication date: 2021-09-17
Anticipated expiration: 2040-06-19
Also published as: CN113403307B

Abstract

The invention obtains a promoter with higher promoter activity from Rhododendron roseum petal tissue. The total length of the promoter is 1477bp, the expression of a Chalcone synthase (CHS) gene can be efficiently started, the promoter can replace the CHS gene promoter with low expression level in other species by means of a gene recombination technology, the CHS enzyme activity is improved, and the synthesis of anthocyanin and anthocyanin in downstream pathways of anthocyanin metabolic pathways is increased, so that the color expression of petals is influenced.

Description

Rhododendron erythropolis petal RhCHS gene promoter and flower color breeding application

Technical Field

The invention belongs to the technical field of genetic engineering, and particularly relates to an acquisition of a Chalcone synthase (CHS) gene promoter from rhododendron roseum petal tissue and application of the CHS gene promoter in flower color breeding research.

Background

The promoter is a DNA sequence located in the upstream region of the 5' end of the structural gene, and the length of the promoter is different from 1000-2000 bp. The DNA sequence can activate RNA polymerase, make it combine with template DNA accurately and start transcription. The specific transcription of a gene depends on whether the enzyme is able to form a binary complex with a promoter whose sequence affects its affinity for RNA polymerase and thus its level of expression. A TATA box structure with the sequence TATAAA is usually contained near the transcription initiation site of the core region of the promoter; upstream of the 5' end of the transcription start site, there are usually CAAT box with sequence CCAAT and GC box structure with sequence GGCGGG, which interfere with the expression of promoter activity and determine the transcription specificity and activity. Therefore, the cloning, analysis and verification of the promoter sequence, cis-acting element composition and functional expression can not only improve the understanding of the time-space expression rule of the functional gene, but also have important function in controlling the expression effect of the functional gene by pertinently controlling the exogenous stimulating factor.

Azalea, six of ten famous flowers in China, enjoys the reputation of "flowers like brocade". The flower has luxuriant branches and leaves, bright color, and good appearance, and is attractive and commercially valuable. Red Belgium azalea is one of important ornamental azalea, and has many types such as red, white, pink, light green, mosaic system and the like, and is one of the main types of potted flower production in the world. As a rate-limiting enzyme of the phenylalanine metabolic pathway (genetic phenyl propanoid pathway), CHS has an important influence on the results of anthocyanin precursor synthesis. As a promoter for regulating CHS gene expression efficiency, CHS enzyme expression yield can be influenced, and finally plant petal flower color expression can also be influenced.

The invention researches the upstream promoter of CHS gene in Rhododendron erythropolis petal tissue, and analyzes the obtained sequence with cis-acting element. The activity of the promoter is determined by constructing a recombinant vector containing the promoter by a recombinant technology, injecting tobacco leaf tissue and observing the staining effect by a GUS tissue staining method.

Disclosure of Invention

The technical problem to be solved by the invention is as follows: provides a Rhododendron roseum petal RhCHS gene promoter in Red Belgium to solve the problem of insufficient research on CHS gene promoter in Rhododendron roseum petal tissue at present, and provides application of the promoter to improve Rhododendron molecular breeding level.

In order to solve the above problems, the present invention provides the following solutions:

a Rhododendron delavayi petal RhCHHS gene promoter has a sequence as follows:

(1) the nucleotide sequence shown as SEQ ID NO.1 (the initiation codon is atg).

SEQ ID NO: 1, and the nucleotide sequence still has the function of a RhCHS gene promoter.

A recombinant vector constructed by the promoter of claim 1 and pCAMBIE1301 plasmid by gene recombination technology.

The recombinant vector is constructed by pCAMBIE1301 skeleton and promoter sequence. The pCAMBIE1301 plasmid was digested simultaneously with PstI and NcoI to remove the 35S Promoter preceding the GUS gene. And recovering the vector skeleton, connecting the vector skeleton with the promoter, and successfully constructing the recombinant vector by the steps of transformation experiment, sequencing verification and the like of a reaction product.

A recombinant cell for promoter amplification prepared from the recombinant vector of claim 2 and E.coli competent DH5 α.

A recombinant cell for transient transformation, which is prepared from the recombinant vector of claim 2 and Agrobacterium tumefaciens GV 3101.

A method for preparing the rhododendron roseum RhCHS gene promoter of claim 1, which comprises the following steps: the DNA of Rhododendron erythropolis petals is used as a template, and the DNA is obtained by amplifying 3 specific primers, wherein the sequences of the 3 specific primers are shown as SEQ ID NO2, NO3 and NO 4.

The application of the Rhododendron delavayi petal RhCHS gene promoter in flower color breeding research and practice of horticultural plants, in particular to research on the improvement of gene expression efficiency by using the RhCHS gene promoter for replacing a low-activity gene promoter, and particularly research and application in flower color breeding research of the flower and garden industry.

The rhododendron belgii is popular as an ornamental plant, but the application of chalcone synthase in flower color breeding is rare, the invention provides a rhododendron rubrum RhCHS gene promoter and a preparation method thereof, fills up the vacancy of the gene promoter in the current genetic engineering, provides a cloning mode of the rhododendron chalcone synthase promoter in Belgium, provides a theoretical basis for the research of rhododendron and related plants in the future, provides a theoretical basis for the plant quality improvement by using the genetic engineering technology in the future and obtains plants with different flower colors, and has higher application value.

Drawings

FIG. 1 is a diagram showing the type of cis-acting elements of the RhCHS gene promoter in Rhododendron erythropolis petals and their positions in the sequence according to the present invention;

FIG. 2 is an analysis diagram of the promoter sequence of the RhCHS gene in the recombinant vector of the present invention;

FIG. 3 is a drawing of a sample in decolorization in the example of the present invention (from left to right, RhCHS gene promoter recombinant vector, 1301 positive vector, negative vector);

FIG. 4 is a schematic diagram of the transient decolorization result of tobacco leaves (from top to bottom, rhCHS gene promoter recombinant vector, 1301 positive vector and negative vector) (three repeat experiments each).

Detailed Description

The present invention will be further described in detail with reference to the following detailed description and accompanying drawings.

Example 1 Rhododendron RsCHS Gene promoter cloning

Extraction of Rhododendron erythropolis DNA

The petals of red Belgium rhododendron used for the experiment were collected from Ningbo North Lun Yinhua flower Co. The sampled plants are required to be healthy, have luxuriant flowers and bright colors, and experimental petals are required to have dry, clean and uniform petals, uniform colors and no insect spots. The petals of the living plants are firstly cleaned with floating dust on the surface by a wash bottle, collected and rapidly frozen by liquid nitrogen. And extracting rhododendron genomic DNA (deoxyribonucleic acid) from the frozen petal sample by adopting a CTAB (cetyl trimethyl ammonium bromide) method in a laboratory for later use.

(II) Tail-PCR primer design and verification

3R-terminal primers SP1, SP2 and SP3 (Table 1) were designed according to the instructions of Genome Walking Kit (code No.6108) Kit, and were paired with 4 random primers in the Kit, respectively, to perform 3 rounds of nested PCR amplification. In addition, two OFR validation primers CHS-F, CHS-R (Table 1) were designed.

Table 1: 3R-terminal primers SP1, SP2 and SP3 sequences in Tail-PCR

Primer name	Nucleic acid sequence (5 '- -3')	Function(s)
			SP1	CAAACATAAGTCAGTAACCGTCACCC	Tail-PCR first round PCR downstream primer
SP2	AAGGCTCATCCGACGACGATTC	Tail-PCR second round PCR downstream primer
			SP3	ACCCCCGTAATCAGAATATATGCACG	Tail-PCR third round PCR downstream primer
CHS-F	ACTGCGACCCCACCGAACTG	ORF validation primer of CHS
			CHS-R	CCATGTCCTGCCTAGCGTCC	OFR verification primer of CHS

(III) Tail-PCR Experimental Process

Three rounds of PCR amplifications were carried out using Rhododendron erythropolis genomic DNA as a template, using a phantamaxfidity DNA polymerase kit from Vazyme, and using three primers such as SP1, SP2, and SP3 as downstream primers and 4 random primers (AP1, AP2, AP3, and AP4) in the kit as upstream primers, respectively, according to the PCR procedure described in the specification. The procedure of the three amplification experiments was as follows:

first round PCR amplification (20 cycles): the template is red Belgium genome DNA, 4 random primers AP1, AP2, AP3, AP4 and SP1 are respectively paired for 4 groups of first round PCR amplification, and the amplification procedure is as follows:

1st PCR reaction conditions are as follows:

second round PCR amplification (20 cycles): taking 2 μ l of 4 groups of products of the first round of amplification as templates of the round, and pairing the 4 random primers and SP2 primers again to carry out 4 groups of second round PCR amplification respectively, wherein the amplification procedure is as follows:

② 2nd PCR reaction conditions are as follows:

third round of CPR amplification (25 cycles): mu.l of the 4 sets of products from the second round of amplification were used as templates for the second round, and 4 sets of third round PCR amplifications (25 cycles) were performed by pairing the 4 random primers with the SP3 primer.

② 3rd PCR reaction conditions are as follows:

the three PCR amplification results show that the AP1-SP3 amplification result in the third PCR amplification product has obvious bands, and the electrophoresis band of about 2000bp at the position is recovered by tapping. And after the tail end of the recovered product is added with an A tail, connecting a pMD19-T vector, constructing a T clone, transforming escherichia coli, verifying by a primer pair CHS-F and SP3, selecting a positive clone, sending the positive clone to a sample for sequencing, wherein a sequencing primer is a universal primer M13(-47), splicing the sequencing result to obtain a promoter sequence of the CHS gene, and the result is shown as SEQ ID NO. 1.

Example 2 analysis of cis-acting element of Rhododendron RhCHS Gene promoter

The obtained 1477 promoter sequences were subjected to cis-acting element analysis by means of plantarcae, and the names, numbers and positions of cis-elements are shown in table 2 and fig. 1.

Table 2: list of cis-acting element type, position and number of Rhododendron rhCHS gene promoter

Example 3 construction of recombinant vector

The pCambia1301 vector was digested with PstI and NcoI, 35S Promoter before GUS gene was excised, and the vector backbone was recovered and subjected to recombination reaction with CHSP fragment. And transforming the reaction product into escherichia coli DH5 alpha, coating a Kana resistant plate, culturing at 37 ℃ overnight, picking 8 resistant colonies, carrying out PCR identification on positive colonies by using the amplification primers, and picking No. 15 clone for sequencing. The bidirectional sequencing primer is M13-R: CAGGAAACAGCTATGAC, Gus-R: GAAAAGGGTCCTAACCAAGA.

The result shows that the promoter sequence obtained in the recombinant vector is completely consistent with the promoter sequence obtained in the Tail-PCR experiment, and the success of the construction of the recombinant vector is proved. The sequencing results and the analysis results are shown in FIG. 2.

Example 4 verification of Activity of recombinant vector transformed Arabidopsis thaliana

First, Agrobacterium is injected and inoculated into Nicotiana benthamiana (Nicotiana benthamiana)

The recombinant plasmid was transformed into Agrobacterium GV3101 competent (pCambia 1301 empty vector and GUS gene-removed 1301 vector were simultaneously transformed as positive and negative controls), plated on LB medium plates supplemented with antibiotics (kana 50mg/L, Rif 25mg/L, Gen 25mg/L), resistant monoclonals were picked up for PCR verification, inoculated into 5ml of YEP liquid medium (containing the same antibiotics as above), and cultured overnight in an incubator at 28 ℃ and 160rmp rpm by freeze-thaw method. After centrifugation, the culture was collected and then resuspended in 5ml of a resuspension solution (containing 10mM MgCl)₂10mM MES, 150. mu.M As) and allowed to stand at room temperature for 3 h. The agrobacterium after standing was injected with the leaf (lower epidermis) of the nicotiana benthamiana in the 5-leaf stage (about 1 month of growth), 2-3 leaves (in the same position of the plant, in a similar growth state and size) were injected per plant, 3 leaves were injected per treatment, and 3 replicates were set. The injected plants were transferred to 16h light and grown in 8h dark after overnight at 25 ℃ in the dark.

(II) GUS staining

3-5 days after Agrobacterium injection, injection leaf inoculation sites (3 replicates) were collected and stained overnight at 37 ℃ with GUS stain. The stained leaves were then decolorized with 75% ethanol (to remove chlorophyll) and also at 37 ℃ overnight. After the decolorized ethanol was removed, the plate was washed with 75% ethanol, observed and photographed, and the results are shown in FIGS. 3 and 4.

As shown in FIGS. 3 and 4, it is clear that the color of the RhCHS gene promoter recombinant vector is darker than that of the 1301 positive vector and darker than that of the negative vector, which also verifies the role of the rhododendron chalcone synthase of the present invention in flower color expression.

As shown in FIGS. 3 and 4, GUS staining of the recombinant vector of the RhCHS gene promoter was clearly deep into the pCAMBIA1301 positive control. The result shows that the RhCHS gene promoter has the activity of obviously promoting the expression of the RhCHS gene, and the regulation of the expression activity of the RhCHS gene can be implemented by changing the sequence of the promoter at the later stage, so that the content of anthocyanin in tissues is adjusted, and the promoter plays a role in flower color breeding.

Materials, reagents and experimental equipment related to the embodiment of the invention are all commercial products conforming to the field of biological genetic engineering unless otherwise specified.

The foregoing is only a preferred embodiment of the present invention, and it should be noted that, for those skilled in the art, modifications and decorations can be made without departing from the core technology of the present invention, and these modifications and decorations shall also fall within the protection scope of the present invention. Any changes which come within the meaning and range of equivalency of the claims are to be embraced within their scope.

Sequence listing

<110> Zhejiang Wanli college

<120> Rhododendron erythropolis petal RhCHS gene promoter and flower color breeding application

<130> 2020.6.2

<160> 4

<170> SIPOSequenceListing 1.0

<210> 1

<211> 1477

<212> DNA

<213> Belgium azalea (Rhododendron of Belgium)

<400> 1

tttaagtgca tacaaattta aatcgtccat tgctcggtta aaatccgaaa tgtcgattgg 60

caaaataagc gaccgatctg accggattgg ccgctctgca gggagcccat tcccccttca 120

tcccatttcg ccaacccgtc ttgaccacct cacctaacta acacttcccc acaactaaaa 180

ttgtttaaac ctggggcaga gcaaatgaat taaaatttgg gatggcaaaa ttagaagaaa 240

tcaacccatt atgataatag gataaagttc ttatatttac gtaaaaatag tagacatttc 300

aaggttaatc gtccataatc atctataatt agatgtgaca ctttaatttt tttttcccca 360

gttaatcatc tataatacat gttttaaggt tggtcaccta ttaacacaga gcaaatagat 420

tttaaaacaa tctatttaaa tggaactcgg tgtttctttt aagtctgaaa aactattcac 480

ggttgattct aaactaaatt tcaaaccccc gttcgttact cttcttaaat agagtaattt 540

gtatacaagt ttctttgact gcttcgtgaa cttttttttt tacttttttt tttctcttta 600

gagaattgtt tttagaattt ttttttgcac tttacgaata tttttctaat gtagttctat 660

ctaagaataa atatatttag aaggaattca caaaaattac tgaaaacgaa acaaagttga 720

gaaagatcaa taagtcaaat gtcaagtcaa agttggattt tttttttcat tattgtactt 780

tttaaatttt ggaaacctct attttttatt ttcaagcgcg taattgatgt acccagaagt 840

aaaaattttg ataaaatatt taaaaacatt gaataaatag aaaacgcgaa accatgcgta 900

acttcttcat cccaaaaaat ctcttacaaa aacataacag acataaagca atttcccttt 960

ccatgtttta taagggaagt gccggagaga aatcatcttt cgttttttcc gaaacctaat 1020

tttgataacc ctcaacgctc aaaaagcttg ttctaggacg gaatactaat gtaagcacgt 1080

gtaggagtgc gtgtttgtct gtcttcgtga gcttattcta aaataatctt tatggtattt 1140

ttttatttta aaaattatct tgcaacccat gttttcccta ttaaatgaat tattatgaag 1200

taggtataca agaatctcca tatcatgtgg aggcttttga agggggaaat gtagatacac 1260

caaaacccaa ctcacgtgct agccggcctc tccaagtagt catagcacgt gattccaaac 1320

taccatttct attggtcaca tatatatacc acccacaata ccaccaagtt ttgtcacaag 1380

ctgatcaaca attatctacc actccaagct gcttgtacta acacctacaa accacaaaaa 1440

ctccggccac cgctaaatta ttttttccgg cgaaaag 1477

<210> 2

<211> 26

<212> DNA

<213> SP1

<400> 2

caaacataag tcagtaaccg tcaccc 26

<210> 3

<211> 22

<212> DNA

<213> SP2

<400> 3

aaggctcatc cgacgacgat tc 22

<210> 4

<211> 26

<212> DNA

<213> SP3

<400> 4

acccccgtaa tcagaatata tgcacg 26

Claims

1. A Rhododendron roseum petal RhCHS gene promoter is characterized in that the sequence is as follows:

(1) a nucleotide sequence shown as SEQ ID NO. 1;

(2) the nucleotide sequence shown in SEQ ID NO.1 has one or more point mutations, but still has the nucleotide sequence with the function of the RhCHS gene promoter.

2. A recombinant vector constructed by the promoter of claim 1 and pCAMBIE1301 plasmid by gene recombination technology.

3. A recombinant cell for promoter amplification prepared from the recombinant vector of claim 2 and E.coli competent DH5 α.

4. A recombinant cell for transient transformation, which is prepared from the recombinant vector of claim 2 and Agrobacterium tumefaciens GV 3101.

5. A method for preparing the rhododendron roseum RhCHS gene promoter of claim 1, which comprises the following steps: the DNA of Rhododendron erythropolis petals is used as a template, and the DNA is obtained by amplifying 3 specific primers, wherein the sequences of the 3 specific primers are shown as SEQ ID NO2, NO3 and NO 4.

6. The application of rhododendron roseum petal RhCHHS gene promoter in horticultural plant flower color breeding research and practice as claimed in claim 1.