CN114591968B - Application of tobacco NtSCL32 gene in plant branch regulation and control - Google Patents

Application of tobacco NtSCL32 gene in plant branch regulation and control Download PDF

Info

Publication number
CN114591968B
CN114591968B CN202210206739.2A CN202210206739A CN114591968B CN 114591968 B CN114591968 B CN 114591968B CN 202210206739 A CN202210206739 A CN 202210206739A CN 114591968 B CN114591968 B CN 114591968B
Authority
CN
China
Prior art keywords
ntscl32
gene
tobacco
plant
application
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Active
Application number
CN202210206739.2A
Other languages
Chinese (zh)
Other versions
CN114591968A (en
Inventor
王晨
金静静
谢小东
李泽锋
王林
许亚龙
卢鹏
陈千思
徐馨
曹培健
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Zhengzhou Tobacco Research Institute of CNTC
Original Assignee
Zhengzhou Tobacco Research Institute of CNTC
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Zhengzhou Tobacco Research Institute of CNTC filed Critical Zhengzhou Tobacco Research Institute of CNTC
Priority to CN202210206739.2A priority Critical patent/CN114591968B/en
Publication of CN114591968A publication Critical patent/CN114591968A/en
Application granted granted Critical
Publication of CN114591968B publication Critical patent/CN114591968B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/415—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from plants
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
    • C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield

Landscapes

  • Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Molecular Biology (AREA)
  • Biophysics (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Zoology (AREA)
  • Biochemistry (AREA)
  • Wood Science & Technology (AREA)
  • General Health & Medical Sciences (AREA)
  • General Engineering & Computer Science (AREA)
  • Biotechnology (AREA)
  • Biomedical Technology (AREA)
  • Botany (AREA)
  • Physics & Mathematics (AREA)
  • Cell Biology (AREA)
  • Plant Pathology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Microbiology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Medicinal Chemistry (AREA)
  • Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The application belongs to the technical field of plant genetic engineering, and in particular relates to tobaccoNtSCL32The gene is applied to the application matters in the branch regulation of plants. Tobacco leafNtSCL32The gene is related to the development of tobacco axillary buds and the formation of lateral branches, and is used for regulating plant types; the tobacco isNtSCL32The length of the coding base sequence of the gene is 1113bp, and the sequence is shown as SEQ ID No. 1. In the application, the inventor selects the tobacco NtSCL32 gene as a research object, and discovers that after the phenotype research of plants after the gene silencing, after the expression quantity of the NtSCL32 gene is reduced, the axillary buds of the tobacco are increased, and the branches are obviously increased, namely, the regulation and control of the plant type can be realized by reducing the expression quantity of the NtSCL32 gene. Based on the result, a certain theoretical basis and a technical basis can be laid for the targeted cultivation of new varieties of proper plant types.

Description

Application of tobacco NtSCL32 gene in plant branch regulation and control
Technical Field
The application belongs to the technical field of plant genetic engineering, and in particular relates to tobaccoNtSCL32The gene is applied to the application matters in the branch regulation of plants.
Background
The branching development of the plant starts from axillary meristems, the branching condition of the plant has a decisive role in the regulation and control of the plant type, and the plant type is closely related to the yield and quality of crops, so that the regulation and control research of the plant type has important production application significance. While studies have shown that plant collateral development is affected by a variety of factors such as plant hormones and the environment, genetic factors remain fundamental determinants of plant branch development at the end of the root.
The related plant gene research works show that a large number of genes are involved in the branch development regulation process of plants, such as arabidopsis related to the development initiation of axillary meristem of plantsLSGenes that affect the expression of the meristematic marker gene SHOOT MERISTEMLESS (STM) during the vegetative growth phase of arabidopsis by expression of REVOLUTA (REV), thereby affecting the formation of AM. In addition, research shows that LAX gene in rice encodes bHLH transcription factor, and that it and SPA have redundancy in rice tillering regulation and control, and that the spikelet of 1ax mutant is completely or partially inhibited. As another example, studies have shown that,TB1the (TEOSINTE BRANCHED 1) gene is a key gene for regulating the dormancy of the axillary buds of the corn, and has a key role in regulating the development of the axillary buds.
The tobacco is used as an economic crop with harvested leaves as raw materials, and the research on branch development related genes of the tobacco obviously has important technical significance for improving the plant type of the tobacco and improving the yield of the tobacco leaves.
Disclosure of Invention
Based on the important technical significance of plant type regulation and control on tobacco production, the application is used for tobaccoNtSCL32The related research of the gene and plant branching influence lays a certain technical foundation for the regulation and control of tobacco plant types.
The technical scheme adopted by the application is briefly described below.
Tobacco leafNtSCL32Application of gene in plant branch regulation and control and tobaccoNtSCL32The gene is related to the development of tobacco axillary buds and the formation of lateral branches, and can be used for plant type regulation; the plant is, for example, tobacco;
in the specific application, by genetic engineering means, byNtSCL32Gene silencing and thus inhibitionNtSCL32After the gene expression is translated into NtSCL32 protein, the growth quantity of tobacco axillary buds is obviously increased and lateral branches are obviously increased in the gene silencing plant (namely, the increase of the tobacco axillary buds and the growth of the lateral branches are promoted by a gene silencing mode);
the tobacco isNtSCL32The length of the coding base sequence of the gene is 1113bp, and the sequence is shown as SEQ ID No. 1; the method comprises the following steps:
ATGTGGGTACTCAACAATTTGGCTTCTTCTAACGGAGATCCAAATCAAAGGCTTACATCTTGGTTTCTTAGGGCATTAATCTCAAGGGCTTCTAGGGTTTGTCCTACAGCCACAAATAATTATCTCTATGGAAGTAGTAATCTTGATCAAAGGAGATTAATGAGTGTGACTGAGCTTGCAGGGTATGTAGATCTCATCCCTTGGCATAGATTTGGATTTTGTGTATCAAATAGTGCTATTTATAAGGCCATTGAAGGGCACACAAAAGTTCACATATTAGATTTTAGTATCACTCATTGTATGCAATGGCCAACTCTAATTGATGCAATAGCTAAGAGGCCTGAGGGTCCTCCTTCTCTTCGAATATCGGTGCCTTCTTGGAGGCCACCAGTTCCTCCATTGCTTAATGTATCAAGTGAAGAAGTTGGCCATCGTTTGGCTAATTTTGCAAAGTTTAGAGATGTCCCTTTTGAATTCCAAGTGATTGAAGACTTAAACTATGATATGCTCTTGAGCCAATTGAGTCCTTTAACTCTTCAACTTAGGGATGATGAGGCTTTGGTGGTTAATTGCCAAAATTGGTTAAGGTATATGCCCGATGAACAAATTAATGGAAGTAGTTATTCTTCTCGTGACATATTTCTTGATATGGTTAAGGAACTAAATCCATGTATTATGACTGTGGTTGATGAGGATTCTGACTTGGGAAACTCAAGTTTAACATCAAGAATAGCCACTTGCTTTAATTATTTATGGATACCCTTTGATGCATTAGAGACTTTCTTGCCTAAGGATAGTAGACAAAGGCTTGATTATGAAGCTGATATTGGCCACAAAATTGAAAACATTATTGGAGTTGAAGGGGTTCAAAGGATAGAGAGATTAGAGTGTTGCAATAAATTCTCACAAAGGATGGAAAATAGTGGTTTTATGAGTGTTCCTTTTTGTGAGGAAACAATTAAGGAAGTGAAGTCACTGTTAGATGAGCGTGCAAGTGGGTGGGGTATGAAAAAAGAGGATGACATGCTTGTATTGACATGGAAAGGCCATAACTCTGTCTATGCAACTGCTTGGATCTTGGTCCCGCCTCAAATGGACATGACGATTGAGTAA；
tobacco leafNtSCL32The length of the amino acid sequence of the tobacco branch regulatory protein NtSCL32 coded by the gene is 370AA, and the amino acid sequence is shown as SEQ ID No.2, and is specifically as follows:
MWVLNNLASSNGDPNQRLTSWFLRALISRASRVCPTATNNYLYGSSNLDQRRLMSVTELAGYVDLIPWHRFGFCVSNSAIYKAIEGHTKVHILDFSITHCMQWPTLIDAIAKRPEGPPSLRISVPSWRPPVPPLLNVSSEEVGHRLANFAKFRDVPFEFQVIEDLNYDMLLSQLSPLTLQLRDDEALVVNCQNWLRYMPDEQINGSSYSSRDIFLDMVKELNPCIMTVVDEDSDLGNSSLTSRIATCFNYLWIPFDALETFLPKDSRQRLDYEADIGHKIENIIGVEGVQRIERLECCNKFSQRMENSGFMSVPFCEETIKEVKSLLDERASGWGMKKEDDMLVLTWKGHNSVYATAWILVPPQMDMTIE。
tobacco leafNtSCL32The primer sequence for gene PCR amplification is specifically designed as follows:
NtSCL32-F: 5'-ATGTGGGTACTCAACAATTTGGCTT-3'，
NtSCL32-R: 5'-TTACTCAATCGTCATGTCCATTTGA-3'。
for knocking down tobaccoNtSCL32The recombinant vector for gene expression is named pCambia2301-RTM-NtSCL32 and is obtained by constructing the following steps:
(one) designing primers and performing PCR amplification
And (3) respectively designing reverse and forward fragment amplification primers:
NtSCL32-R(+):5'-AGCCTGCAGCCATGGTGAAGGAGGACCCTCAGGCCTCTTA-3'，
NtSCL32-R(-):5'-ATAGACTTACAACGTTCAAGGGCTTCTAGGGTTTGTCCTA-3'；
the reverse fragment sequence was amplified using the above primers as follows:
GAGGACCCTCAGGCCTCTTAGCTATTGCATCAATTAGAGTTGGCCATTGCATACAATGAGTGATACTAAAATCTAATATGTGAACTTTTGTGTGCCCTTCAATGGCCTTATAAATAGCACTATTTGATACACAAAATCCAAATCTATGCCAAGGGATGAGATCTACATACCCTGCAAGCTCAGTCACACTCATTAATCTCCTTTGATCAAGATTACTACTTCCATAGAGATAATTATTTGTGGCTGTAGGACAAACCCTAGAAGCCC；
NtSCL32-F(+):5'-GCGGGTCGACGGTACCTCAAGGGCTTCTAGGGTTTGTCCTA-3'，
NtSCL32-F(-):5'-GACCCAGCAGATAGATGAAGGAGGACCCTCAGGCCTCTTA-3'；
the forward fragment sequence amplified using the above was as follows:
GGGCTTCTAGGGTTTGTCCTACAGCCACAAATAATTATCTCTATGGAAGTAGTAATCTTGATCAAAGGAGATTAATGAGTGTGACTGAGCTTGCAGGGTATGTAGATCTCATCCCTTGGCATAGATTTGGATTTTGTGTATCAAATAGTGCTATTTATAAGGCCATTGAAGGGCACACAAAAGTTCACATATTAGATTTTAGTATCACTCATTGTATGCAATGGCCAACTCTAATTGATGCAATAGCTAAGAGGCCTGAGGGTCCTC
then, taking the tobacco cDNA as a template, respectively carrying out PCR (polymerase chain reaction) amplification by using the primers, and extracting and purifying an amplified product for standby to obtain a target sequence fragment of an interference vector;
(II) enzyme digestion and ligation
Performing BamHI and XbaI double digestion on the pCambia2301-RTM vector, and connecting the digested product with the PCR amplified product of the recovered reverse fragment in the step (I) by using T4_ligase;
(III) transformation and screening
Converting the reverse fragment connection product in the step (II) into escherichia coli competent cells, and screening and identifying to obtain a recombinant correct intermediate plasmid vector;
carrying out KpnI single enzyme digestion on the intermediate vector plasmid, and then carrying out mechanical energy recombination reaction on the intermediate vector plasmid and the forward fragment amplification product in the step (I);
further, the recombinant reaction product is transformed into competent cells of escherichia coli, and finally, recombinant correct pCambia2301-RTM-NtSCL32 is obtained by screening and identification.
The recombinant vector pCambia2301-RTM-NtSCL32 is applied to plants, and can be reduced after being transformed into plantsNtSCL32The gene translation expression level further promotes the development of axillary buds and the growth of lateral branches of plants, thereby realizing the effect of regulating and controlling plant types.
A method for culturing the new variety of plant for regulating the plant type includes such steps as using agrobacterium-mediated gene transform method to transform the recombinant carrier pCambia2301-RTM-NtSCL32 to obtain the new variety with reduced NtSCL32 gene expression, and further screening and identifying.
Based on early work accumulation, the inventor selects a tobacco NtSCL32 gene as a research object, and discovers that after the phenotype research of plants after gene silencing, after the expression quantity of the NtSCL32 gene is reduced, tobacco axillary buds are increased, branches are obviously increased, namely, the plant type regulation and control can be realized by reducing the expression quantity of the NtSCL32 gene. Based on the result, a certain theoretical basis and a technical basis can be laid for the targeted cultivation of new varieties of proper plant types.
Drawings
FIG. 1 is a PCR electrophoretogram of NtSCL32 clone;
FIG. 2 shows analysis results of the expression level of NtSCL32 gene in the interference plant; in the figure, L-10, L-12, L-15, L-7 represent different transgenic lines;
FIG. 3 is a drawing of the tobacco branching phenotype of the NtSCL32 interfering plants.
Detailed Description
The application is further illustrated by the following examples. Before describing the specific embodiments, the following description will briefly explain some experimental contexts in the following embodiments.
Tobacco variety: k326, a common cultivar of tobacco, is obtained by preservation and provision of seeds by national tobacco gene research center;
and (3) a carrier: pEASY-T1 Simple vector, purchased from Beijing full gold biotechnology Co., ltd;
pCambia2301-RTM interfering vector, offered by Shanghai Kai Biotechnology Co.
Strains:
trans1-T1 chemocompetent cells, purchased from Beijing full gold biotechnology Co., ltd;
the LBA4404 agrobacterium strain, a common strain in biological experiments, can be obtained publicly;
primer synthesis and DNA sequencing were accomplished by Beijing Liuhua macrogene technologies Co., ltd;
experimental reagent:
fluorescent quantitative PCR enzyme (SYBR qPCR kit), available from zhengzhou ansai biotechnology limited;
reverse transcription kit, T4 ligase, restriction enzyme, purchased from treasured bioengineering (da company);
PCR amplification enzymes, 2 x TransStart GoldPfu PCR SuperMix, fluorescent quantitative PCR enzymes, DNA amplification enzymes, purchased from beijing all gold biotechnology limited;
RNA extraction kit (SuperPure Plant polyRNA Kit) and DNA purification gel recovery kit were purchased from QIAGEN.
Example 1
Based on the summary of the previous work, the inventors selected the tobacco NtSCL32 gene as the subject. In order to facilitate the definition of the actual influence of the gene on plant growth, the inventors first cloned the gene. The specific procedure is outlined below.
(1) Preparation of cDNA as cloning template
Taking 100mg of root (based on the analysis result of tissue expression pattern of the gene, the gene is mainly expressed in root and the expression level in leaf is very low) of tobacco (K326) in a Wang period as a sample, fully grinding in liquid nitrogen, extracting total RNA by referring to RNA extraction kit instruction book, and then carrying out reverse transcription to cDNA for standby;
(2) Designing primer for PCR amplification
Primer sequences designed for amplifying the NtSCL32 gene are as follows:
NtSCL32-F: 5'-ATGTGGGTACTCAACAATTTGGCTT-3'，
NtSCL32-R: 5'-TTACTCAATCGTCATGTCCATTTGA-3'；
using the cDNA prepared in the step (1) as a template, performing PCR amplification by using the primers,
50. mu.l of amplification system was designed as:
cDNA template, 2 μl;
1. 1 ul each of the upstream and downstream primers;
2×TransStart GoldPfu PCR SuperMix，25μl；
ddH 2 o is added to 50 ul;
the PCR amplification procedure was: pre-denaturation at 94℃for 4min; denaturation at 94℃for 30s, annealing at 58℃for 30s, extension at 72℃for 1min for 30 cycles; and finally extending at 72 ℃ for 10min.
After the PCR amplified products are subjected to electrophoresis detection and analysis, the PCR amplified products are recovered and purified by referring to the specification of the gel recovery kit.
(3) Ligation with pEASY-T1 vector, transformation
Ligating the PCR amplified product extracted in step (2) to a pEASY-T1 vector, wherein the specific ligation system is as follows:
PCR amplified product, 6. Mu.L;
pEASY-T1 vector, 1. Mu.L;
after mixing, the mixture was connected at 25℃for 25 min.
Subsequently, the ligation products described above were transformed into E.coli competent cells, and the specific transformation procedure was as follows:
after the competent cells are dissolved on ice, adding a connection product into 50 mu L of Trans1-T1 competent cells, flicking and uniformly mixing, and carrying out ice bath for 30 min; heating in a water bath at a temperature of 42 ℃ for 30s, and immediately placing on ice for 2min; 250 μl of LB (without antibiotics) equilibrated to room temperature was added, and cultured with shaking at 37deg.C for 1h; after mixing, the mixture was spread evenly on LB solid plates (containing 60. Mu.g/. Mu.L ampicillin), the plates were inverted, and incubated overnight at 37 ℃.
After picking white spot amplification culture, extracting plasmid DNA, carrying out bacterial liquid PCR identification on recombinant plasmids (the result is shown in figure 1), and then, carrying out sample feeding and sequencing on recombinant correct positive recombinant plasmids to obtain NtSCL32 gene sequences.
The sequencing analysis result shows that the sequence of the NtSCL32 gene is specifically shown as SEQ ID NO.1, and the amino acid sequence of the encoded NtSCL32 protein is shown as SEQ ID NO. 2. Further structural analysis and tissue expression pattern analysis show that the gene is located on tobacco chromosome 7 and is of a single exon structure, and the expression of the gene in root tobacco root systems is higher.
Example 2
To further understand the role of the NtSCL32 gene in plant growth and development, the inventors constructed a recombinant expression vector RNAi-NtSCL32 for knocking down the NtSCL32 gene, and the construction process of the recombinant vector is briefly described below.
(one) designing primers and performing PCR amplification
Reverse fragment amplification primers were designed:
NtSCL32-R(+):5'-AGCCTGCAGCCATGGTGAAGGAGGACCCTCAGGCCTCTTA-3'，
NtSCL32-R(-):5'-ATAGACTTACAACGTTCAAGGGCTTCTAGGGTTTGTCCTA-3'；
the target sequence of the amplified reverse fragment is as follows:
GAGGACCCTCAGGCCTCTTAGCTATTGCATCAATTAGAGTTGGCCATTGCATACAATGAGTGATACTAAAATCTAATATGTGAACTTTTGTGTGCCCTTCAATGGCCTTATAAATAGCACTATTTGATACACAAAATCCAAATCTATGCCAAGGGATGAGATCTACATACCCTGCAAGCTCAGTCACACTCATTAATCTCCTTTGATCAAGATTACTACTTCCATAGAGATAATTATTTGTGGCTGTAGGACAAACCCTAGAAGCCC；
designing forward fragment amplification primers:
NtSCL32-F(+):5'-GCGGGTCGACGGTACCTCAAGGGCTTCTAGGGTTTGTCCTA-3'，
NtSCL32-F(-):5'-GACCCAGCAGATAGATGAAGGAGGACCCTCAGGCCTCTTA-3'；
the target sequence of the amplified forward fragment is as follows:
GGGCTTCTAGGGTTTGTCCTACAGCCACAAATAATTATCTCTATGGAAGTAGTAATCTTGATCAAAGGAGATTAATGAGTGTGACTGAGCTTGCAGGGTATGTAGATCTCATCCCTTGGCATAGATTTGGATTTTGTGTATCAAATAGTGCTATTTATAAGGCCATTGAAGGGCACACAAAAGTTCACATATTAGATTTTAGTATCACTCATTGTATGCAATGGCCAACTCTAATTGATGCAATAGCTAAGAGGCCTGAGGGTCCTC。
then, taking tobacco cDNA as a template, respectively carrying out PCR (polymerase chain reaction) amplification by using the primers, and extracting and purifying an amplified product for standby to obtain a target sequence fragment of an interference vector;
(II) enzyme digestion and ligation
Performing BamHI and XbaI double digestion on the pCambia2301-RTM vector, and connecting the digested product with the PCR amplified product of the recovered reverse fragment in the step (I) by using T4_ligase;
(III) transformation and screening
Converting the reverse fragment connection product in the step (II) into escherichia coli competent cells, and screening and identifying to obtain a recombinant correct intermediate plasmid vector;
after KpnI single enzyme digestion is carried out on the intermediate vector plasmid, a recombination reaction is carried out on the intermediate vector plasmid and the forward fragment amplification product in the step (I) (the related operation is referred to the conventional operation in the prior art and is not repeated);
further, the recombinant reaction product is transformed into competent cells of escherichia coli, and finally, recombinant correct pCambia2301-RTM-NtSCL32 is obtained by screening and identification.
Example 3
Based on agrobacterium-mediated transformation, the inventor further transforms the recombinant vector pCambia2301-RTM-NtSCL32 constructed in example 2 into tobacco plants so as to obtain new transgenic plant varieties with reduced NtSCL32 gene expression or knocked-out NtSCL32 genes. The specific experimental procedure is briefly described below.
(1) Transformation of Agrobacterium
After freezing and thawing Agrobacterium competent cells on ice, 6. Mu.L of vector pCambia2301-RTM-NtSCL32 prepared in example 3 was added and mixed gently; then placing the mixture in a precooled electric rotating cup, and placing the mixture on ice for 5 min;
adjusting parameters of the electrotometer to: voltage 2.5 kV, capacitance 25 μf, resistance 200 Ω; then, sucking out water drops on the outer wall of the electric rotating cup by using water sucking paper, and then placing the electric rotating cup into an electric shock groove for electric shock 5 ms;
rapidly adding 800 mu L of YEB liquid culture medium preheated to 28 ℃, oscillating at 220 rpm and 28 ℃ for resuscitation 3 h;
centrifuging the bacterial liquid at 4500 rpm for 1min, discarding half of the volume of supernatant, re-suspending, and uniformly coating on a YEB solid culture medium containing Rif (100 mug/mL), str (50 mug/mL) and Kan (50 mug/mL), and inversely culturing at 28 ℃ for about 2-3 d until single colony is formed;
and (3) selecting single bacterial colony, carrying out PCR identification on bacterial liquid after amplification and culture, and identifying a correct positive clone bacterial strain, namely the agrobacterium engineering bacteria with correct transformation.
Culturing the engineering bacteria of the agrobacterium to OD 600 About 0.6, centrifuging at 4000 rpm for 5 min to collect the cells, and suspending the cells with 20 mL MS liquid medium to obtain the final productAnd (5) continuous transfection is performed by using an aggressive dye solution.
(2) Transformation of tobacco plants
Taking K326 tobacco aseptic seedling leaves which grow for about one month, processing the leaves into leaf discs with the diameter of 0.5 and cm by using a puncher, and pre-culturing the leaf discs after processing on an MS solid culture medium for 3 d;
then, placing the pre-cultured leaf disc in the infection liquid in the step (1), and fully infecting for 10 min;
the excess bacterial liquid around the leaf disc after dip-dyeing is sucked by sterile filter paper, and then the leaf disc is subjected to dark culture on a solid culture medium of MS+6-BA (2 mg/L) +NAA (0.5 mg/L) for 3 d;
washing the leaf discs with sterile water containing Cef (400 mg/L) and sucking off excess liquid with sterile filter paper, transferring the leaf discs to MS solid screening medium containing 6-BA (2 mg/L), NAA (0.5 mg/L), cef (200 mg/L) and Kan (50 mg/L), and culturing at 28deg.C under light;
when the adventitious bud length reached 0.5cm, the shoots were transferred to MS solid medium containing Cef (200 mg/L) and Kan (50 mg/L) for rooting.
After about one month of growth, a small number of leaves are taken, DNA is extracted, and the positive transgenic strain is detected by a PCR method. In specific PCR identification, the primers were designed as follows:
NtSCL32-J-F: 5'-GACGCACAATCCCACTATCC-3'，
NtSCL32-J-R: 5'-TGAAGGAGGACCCTCAGGCCTCTTA-3'。
phenotype change of transgenic lines:
further, detection and analysis are performed for identifying the expression condition of the NtSCL32 gene in the positive transgenic line based on the real-time quantitative PCR technology (specific operation refers to the previous and the prior art). Analysis showed that the tobacco NtSCL32 gene expression level was significantly reduced in different RNAi plant lines compared to wild type K326 (FIG. 2), i.e., it was shown that successful construction resulted in a new transgenic plant variety with reduced NtSCL32 gene expression level.
After further T0 generation plants were transplanted into the pot, the axillary bud length phenotype of the positive plants was observed when cultivated in the greenhouse for 6 weeks, and the results are shown in FIG. 3. Compared with wild K326, the transgenic strain has obviously increased axillary buds, faster growth speed and obviously increased lateral branches. Based on this result, the relevant plants, especially tobacco plant types, can be effectively regulated.
SEQUENCE LISTING
<110> Zhengzhou tobacco institute of China tobacco head company
<120> application of tobacco NtSCL32 gene in plant branching regulation
<130> none
<160> 2
<170> PatentIn version 3.5
<210> 1
<211> 1113
<212> DNA
<213> Nicotiana tabacum
<400> 1
atgtgggtac tcaacaattt ggcttcttct aacggagatc caaatcaaag gcttacatct 60
tggtttctta gggcattaat ctcaagggct tctagggttt gtcctacagc cacaaataat 120
tatctctatg gaagtagtaa tcttgatcaa aggagattaa tgagtgtgac tgagcttgca 180
gggtatgtag atctcatccc ttggcataga tttggatttt gtgtatcaaa tagtgctatt 240
tataaggcca ttgaagggca cacaaaagtt cacatattag attttagtat cactcattgt 300
atgcaatggc caactctaat tgatgcaata gctaagaggc ctgagggtcc tccttctctt 360
cgaatatcgg tgccttcttg gaggccacca gttcctccat tgcttaatgt atcaagtgaa 420
gaagttggcc atcgtttggc taattttgca aagtttagag atgtcccttt tgaattccaa 480
gtgattgaag acttaaacta tgatatgctc ttgagccaat tgagtccttt aactcttcaa 540
cttagggatg atgaggcttt ggtggttaat tgccaaaatt ggttaaggta tatgcccgat 600
gaacaaatta atggaagtag ttattcttct cgtgacatat ttcttgatat ggttaaggaa 660
ctaaatccat gtattatgac tgtggttgat gaggattctg acttgggaaa ctcaagttta 720
acatcaagaa tagccacttg ctttaattat ttatggatac cctttgatgc attagagact 780
ttcttgccta aggatagtag acaaaggctt gattatgaag ctgatattgg ccacaaaatt 840
gaaaacatta ttggagttga aggggttcaa aggatagaga gattagagtg ttgcaataaa 900
ttctcacaaa ggatggaaaa tagtggtttt atgagtgttc ctttttgtga ggaaacaatt 960
aaggaagtga agtcactgtt agatgagcgt gcaagtgggt ggggtatgaa aaaagaggat 1020
gacatgcttg tattgacatg gaaaggccat aactctgtct atgcaactgc ttggatcttg 1080
gtcccgcctc aaatggacat gacgattgag taa 1113
<210> 2
<211> 370
<212> PRT
<213> Nicotiana tabacum
<400> 2
Met Trp Val Leu Asn Asn Leu Ala Ser Ser Asn Gly Asp Pro Asn Gln
1 5 10 15
Arg Leu Thr Ser Trp Phe Leu Arg Ala Leu Ile Ser Arg Ala Ser Arg
20 25 30
Val Cys Pro Thr Ala Thr Asn Asn Tyr Leu Tyr Gly Ser Ser Asn Leu
35 40 45
Asp Gln Arg Arg Leu Met Ser Val Thr Glu Leu Ala Gly Tyr Val Asp
50 55 60
Leu Ile Pro Trp His Arg Phe Gly Phe Cys Val Ser Asn Ser Ala Ile
65 70 75 80
Tyr Lys Ala Ile Glu Gly His Thr Lys Val His Ile Leu Asp Phe Ser
85 90 95
Ile Thr His Cys Met Gln Trp Pro Thr Leu Ile Asp Ala Ile Ala Lys
100 105 110
Arg Pro Glu Gly Pro Pro Ser Leu Arg Ile Ser Val Pro Ser Trp Arg
115 120 125
Pro Pro Val Pro Pro Leu Leu Asn Val Ser Ser Glu Glu Val Gly His
130 135 140
Arg Leu Ala Asn Phe Ala Lys Phe Arg Asp Val Pro Phe Glu Phe Gln
145 150 155 160
Val Ile Glu Asp Leu Asn Tyr Asp Met Leu Leu Ser Gln Leu Ser Pro
165 170 175
Leu Thr Leu Gln Leu Arg Asp Asp Glu Ala Leu Val Val Asn Cys Gln
180 185 190
Asn Trp Leu Arg Tyr Met Pro Asp Glu Gln Ile Asn Gly Ser Ser Tyr
195 200 205
Ser Ser Arg Asp Ile Phe Leu Asp Met Val Lys Glu Leu Asn Pro Cys
210 215 220
Ile Met Thr Val Val Asp Glu Asp Ser Asp Leu Gly Asn Ser Ser Leu
225 230 235 240
Thr Ser Arg Ile Ala Thr Cys Phe Asn Tyr Leu Trp Ile Pro Phe Asp
245 250 255
Ala Leu Glu Thr Phe Leu Pro Lys Asp Ser Arg Gln Arg Leu Asp Tyr
260 265 270
Glu Ala Asp Ile Gly His Lys Ile Glu Asn Ile Ile Gly Val Glu Gly
275 280 285
Val Gln Arg Ile Glu Arg Leu Glu Cys Cys Asn Lys Phe Ser Gln Arg
290 295 300
Met Glu Asn Ser Gly Phe Met Ser Val Pro Phe Cys Glu Glu Thr Ile
305 310 315 320
Lys Glu Val Lys Ser Leu Leu Asp Glu Arg Ala Ser Gly Trp Gly Met
325 330 335
Lys Lys Glu Asp Asp Met Leu Val Leu Thr Trp Lys Gly His Asn Ser
340 345 350
Val Tyr Ala Thr Ala Trp Ile Leu Val Pro Pro Gln Met Asp Met Thr
355 360 365
Ile Glu
370

Claims (1)

1. Tobacco leafNtSCL32The application of the gene in the branching regulation of tobacco is characterized in that the gene engineering technology means is utilized byNtSCL32Gene silencing and thus inhibitionNtSCL32The gene expression is translated into NtSCL32 protein, and is finally used for increasing the quantity of axillary buds and the quantity of side branch branches so as to realize the regulation and control of the tobacco plant type;
the tobacco isNtSCL32The gene sequence is shown as SEQ ID No. 1.
CN202210206739.2A 2022-03-04 2022-03-04 Application of tobacco NtSCL32 gene in plant branch regulation and control Active CN114591968B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN202210206739.2A CN114591968B (en) 2022-03-04 2022-03-04 Application of tobacco NtSCL32 gene in plant branch regulation and control

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202210206739.2A CN114591968B (en) 2022-03-04 2022-03-04 Application of tobacco NtSCL32 gene in plant branch regulation and control

Publications (2)

Publication Number Publication Date
CN114591968A CN114591968A (en) 2022-06-07
CN114591968B true CN114591968B (en) 2023-10-24

Family

ID=81815305

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202210206739.2A Active CN114591968B (en) 2022-03-04 2022-03-04 Application of tobacco NtSCL32 gene in plant branch regulation and control

Country Status (1)

Country Link
CN (1) CN114591968B (en)

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN101679494A (en) * 2007-04-12 2010-03-24 瑞典树木科技公司 Methods of increasing plant growth
CN101948870A (en) * 2010-09-08 2011-01-19 上海交通大学 Method for reducing branch quantity of plant and improving chlorophyll and anthocyanin contents of plant
CN112626082A (en) * 2020-12-28 2021-04-09 山东农业大学 Application of corn gene ZmSCL14 in regulation and control of plant root development

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN101679494A (en) * 2007-04-12 2010-03-24 瑞典树木科技公司 Methods of increasing plant growth
CN101948870A (en) * 2010-09-08 2011-01-19 上海交通大学 Method for reducing branch quantity of plant and improving chlorophyll and anthocyanin contents of plant
CN112626082A (en) * 2020-12-28 2021-04-09 山东农业大学 Application of corn gene ZmSCL14 in regulation and control of plant root development

Non-Patent Citations (5)

* Cited by examiner, † Cited by third party
Title
GenBank.PREDICTED: Nitotiana tomentosiformis scarecrow-like protein 32 (LOC104121077), mRNA, XM_009632972.3.《GenBank》.2020,第1-2页. *
Homology-based analysis of the GRAS gene family in tobacco;Y.Q. Chen et al.;《Genetics and Molecular Research》;第14卷(第4期);第15188-15200页 *
Manipulation of plant architecture and flowering time by down-regulation of the GRAS transcription factor SlGRAS26 in Solanum lycopersicum;Shengen Zhou et al.;《Plant Science》;第2018卷;第81-93页 *
PREDICTED: Nitotiana tomentosiformis scarecrow-like protein 32 (LOC104121077), mRNA, XM_009632972.3;GenBank;《GenBank》;第1-2页 *
烟草NtGRAS基因的克隆与转录激活及表达特性分析;杨辉等;《湖南农业大学学报(自然科学版)》;第44卷(第3期);第271-277页 *

Also Published As

Publication number Publication date
CN114591968A (en) 2022-06-07

Similar Documents

Publication Publication Date Title
CN112831478B (en) Protein OsCAT8 for regulating rice chalkiness and coding gene and application thereof
CN110819639B (en) Tobacco low-temperature early-flowering related gene NtDUF599 and application thereof
CN107012147B (en) Drought and/or high-salt induction promoter SlWRKY8P from tomato and application thereof
CN109266650B (en) Inducible promoter, recombinant vector and transformant thereof, method for inducing gene expression and application of inducible promoter
CN108517324B (en) NtIPMD gene affecting tobacco axillary bud differentiation
CN112080507B (en) Key gene GbMYB4 for regulating and controlling ginkgo flavonoid synthesis, protein expressed by gene GbMYB4, vector and application of gene GbMYB4
CN110862445B (en) NtOEP1 gene influencing tobacco pigment content and application thereof
CN110156883B (en) Tobacco SLs signal transduction protein NtDAD2, coding gene, recombinant expression vector, gene editing vector and application thereof
CN107177603A (en) Tobacco growing element transport protein NtPIN4 and its application
CN114672494A (en) Application of tobacco NtEXB1 gene in plant branch development regulation
CN108976293B (en) Negative regulation gene for biosynthesis of litchi anthocyanin and application of negative regulation gene
CN114591968B (en) Application of tobacco NtSCL32 gene in plant branch regulation and control
CN107557384B (en) Genetic transformation system for inducing plant dwarfing and construction and application thereof
CN115058433B (en) Tobacco leaf yellowing regulatory gene NtMYB2, protein and application thereof
CN112481264B (en) Application of promoter GmLCLa1 in regulation and control of gene response abscisic acid treatment and water stress
CN112725355B (en) A dragon fruit HuNIP6 for promoting plant blooming in advance; 1 gene and application thereof
CN109295089B (en) Seedless tomato with regular cracks and bright color and cultivation method thereof
CN114807165A (en) Application of corn ZmNAC78 gene
CN110106200B (en) Application of corn BBM1 gene in improving genetic transformation efficiency of plants
CN113416239A (en) Transcription factor AvbHLH3 participating in synthesis and regulation of elaeostearum acetate and application thereof
CN114875043B (en) Betula alba BpPIF4 gene participating in adventitious root development and application thereof
CN114350685B (en) Application of tobacco NtTAC1 gene in leaf angle regulation and control
CN114805513B (en) Tobacco NtOEE1 gene and application thereof in regulation of stem and leaf included angle and plant height
CN114540354B (en) Expression vector containing hot pickled mustard tuber IFL1 promoter fusion GUS gene and application thereof
CN117051014B (en) Cloning and application of cold-resistant gene MYB97 of swallow flower

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant