CN114672494A - Application of tobacco NtEXB1 gene in plant branch development regulation - Google Patents
Application of tobacco NtEXB1 gene in plant branch development regulation Download PDFInfo
- Publication number
- CN114672494A CN114672494A CN202210206578.7A CN202210206578A CN114672494A CN 114672494 A CN114672494 A CN 114672494A CN 202210206578 A CN202210206578 A CN 202210206578A CN 114672494 A CN114672494 A CN 114672494A
- Authority
- CN
- China
- Prior art keywords
- ntexb1
- gene
- tobacco
- plant
- regulation
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/415—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from plants
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8216—Methods for controlling, regulating or enhancing expression of transgenes in plant cells
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Genetics & Genomics (AREA)
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Biochemistry (AREA)
- Biotechnology (AREA)
- General Engineering & Computer Science (AREA)
- Molecular Biology (AREA)
- Biophysics (AREA)
- Biomedical Technology (AREA)
- General Health & Medical Sciences (AREA)
- Wood Science & Technology (AREA)
- Zoology (AREA)
- Plant Pathology (AREA)
- Physics & Mathematics (AREA)
- Microbiology (AREA)
- Cell Biology (AREA)
- Botany (AREA)
- Gastroenterology & Hepatology (AREA)
- Medicinal Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The invention belongs to the technical field of plant genetic engineering, and particularly relates to tobaccoNtEXB1The gene is applied to the patent application in the regulation and control of the development of plant branches. TobaccoNtEXB1The gene is related to branch development at axillary buds, has the function of increasing or reducing plant branches, and is used for plant type regulation and control of plants; tobaccoNtEXB1The gene sequence is shown in SEQ ID No. 1. In the application, through the research on the expression characteristics of the gene tissues, the inventor finds that: tobaccoNtEXB1The gene has the highest expression level in pistil, relatively higher expression level in axillary bud and lowest expression level in terminal bud. Further research on the phenotype of the plant after the gene silencing finds that the reduction is realizedNtEXB1Amount of Gene expressionAfter that, the tobacco axillary bud development speed becomes obviously slow. Based on the results, a certain theoretical basis and technical basis can be established for the targeted cultivation of new varieties of suitable plant types.
Description
Technical Field
The invention belongs to the technical field of plant genetic engineering, and particularly relates to tobaccoNtEXB1The gene is applied to the patent application in the regulation and control of the development of plant branches.
Background
Branches of the plant are formed through the development of axillary meristems, and have a decisive role in plant type regulation, and the plant type is closely related to the yield and quality of crops, so that the plant type regulation and control research has important production and application significance. In the prior art, the development of plant lateral branches is influenced by various factors such as plant hormones and environment, but at the end of root, genetic factors still have a fundamental determining effect on the development of plant branches.
Research work on related plant genes shows that a large number of genes are involved in the branch development regulation process of plants, such as tomato related to the development initiation of plant axillary meristemLSGene, research shows thatLSAfter the gene mutation, the formation of axillary meristems at vegetative growth stage is completely inhibited. Additional studies have shown that of the MYB transcription factor familyRAX1AndRAX2the gene plays an important role in the formation of Arabidopsis axillary meristems. As another example, studies have shown that,TB1the gene is a key gene for regulating and controlling dormancy of the maize axillary buds and has a key function in regulating and controlling development of the axillary buds.
The research on genes related to the development of branches of the tobacco, which is used as a commercial crop taking harvested leaves as production raw materials, has important technical significance for improving the plant type of the tobacco and increasing the yield of tobacco leaves.
Disclosure of Invention
Based on the important technical significance of the branch development gene to the tobacco production, the application is to the tobaccoNtEXB1The gene and the development activity of plant branches are related to research, thereby laying a certain technical foundation for the regulation and control of the plant type of the tobacco.
The technical scheme adopted by the application is briefly described as follows.
TobaccoNtEXB1Application of gene in plant branch development regulation and control, tobaccoNtEXB1The gene is related to the development of branches at axillary buds of tobacco, has the function of increasing or reducing plant branches, and can be used for plant type regulation and control of plants; the plant, such as tobacco;
When the method is specifically applied, through the technical means of genetic engineering, the method comprises the following stepsNtEXB1Gene silencing and subsequent inhibitionNtEXB1After the gene expression is translated into the NtEXB1 protein, the tobacco axillary buds grow slowly in the gene-silenced plants (namely, the tobacco branches are inhibited from growing in a gene silencing mode);
said tobaccoNtEXB1The length of a coding base sequence of the gene is 927bp, and the sequence is shown as SEQ ID No. 1; the method comprises the following specific steps:
ATGTCTGATAATAACCCTTTTTATCATGATTACTTGGGAACAGGAGGGATAAATAATGCATTTTCTAATTTCTTTGGTGATCAAAATCCCTCAATTTATGATCAAATAATACCTCCTAATACACAAACCCCTCATCAGGATTTTGATCCTTCATCTTATATGAGTACTCTCACTGAGTGTTTACATGGTTCTATGGACTATAACTCTTTATCAAATGTTCTTGGCATGAGTTGCTCATCTTCTGAAGTTGTTTGTCCACCATTAGATCAAGAATCTTCAAGAAAAAACACTGCTGAAATTCCATTGACTCCAAATTCTTTGGTCTCTTCATCTTCTAGTGAGGCTGGAGGTGAAGAAGATTCTTCAAAAAGCAAGAAAGATTTGCAAGCAAAAGATCAGTGTGAAGATGGAGATGATAAGTCTAAGAAAGTGAGCAAAGCAAAGAAGAAAGGAGAAAAGAAGCAAAAGGAGCCGCGATTTGCCTTTATGACTAAGAGTGAGATTGACAATCTTGAAGATGGCTATCGATGGAGAAAATATGGGCAGAAAGCAGTGAAAAATAGTCCTTTTCCGAGGAGTTATTACAGATGCACAAGTCAAAAGTGCAGTGTGAAGAAACGTGTGGAAAGATCATATGAAGATCCATCAGTCGTGATCACTACATACGAAGGCCAACATAATCATCACTGTCCCGCAACTCTTCGTGGAAATGCAGCTGCAGCTATGCTTTCACCTTCCTTCTTATCCTCTTCACAATTAATTCCTCAAGATGTACTCTTTGCCCAAATGCTTACAACCCCAACCAATCAAAATCAGCTCCCTATTAATTATTCTGTCTATAATTATCAGCAGCAACCCCAATTAGGTCCTGAATATGGCCTATTTCAAGATATGGTTGCATCATTGATCCACAAACGAGAGCCATGA；
tobaccoNtEXB1The length of the amino acid sequence of the tobacco branch development regulatory protein NtEXB1 coded by the gene is 308AA, and the amino acid sequence is shown as SEQ ID No.2, and specifically comprises the following steps:
MSDNNPFYHDYLGTGGINNAFSNFFGDQNPSIYDQIIPPNTQTPHQDFDPSSYMSTLTECLHGSMDYNSLSNVLGMSCSSSEVVCPPLDQESSRKNTAEIPLTPNSLVSSSSSEAGGEEDSSKSKKDLQAKDQCEDGDDKSKKVSKAKKKGEKKQKEPRFAFMTKSEIDNLEDGYRWRKYGQKAVKNSPFPRSYYRCTSQKCSVKKRVERSYEDPSVVITTYEGQHNHHCPATLRGNAAAAMLSPSFLSSSQLIPQDVLFAQMLTTPTNQNQLPINYSVYNYQQQPQLGPEYGLFQDMVASLIHKREP。
tobaccoNtEXB1The primer sequence for gene PCR amplification is specifically designed as follows:
NtEXB1-F: 5'-ATGTCTGATAATAACCCTTTTTATC-3'
NtEXB1-R: 5'-GATAAAAAGGGTTATTATCAGACAT-3'。
for knocking off grassNtEXB1A recombinant vector for gene expression, which is named pBWA (V) KS-RNAi-NtEXB1 and is obtained by the following steps:
firstly, designing a primer and carrying out PCR amplification
Based on the gene silencing target sequence, the primer sequence for PCR amplification is designed as follows:
NtEXB1-F(+)：5’-cagtGGTCTCacaacACACAAACCCCTCATCAGGA-3’，
NtEXB1-F(-)：5’-cgatGGTCTCacaggTTTGCTTGCAAATCTTTCTT-3’；
the sequence of the target fragment amplified by the primers is as follows:
ACACAAACCCCTCATCAGGATTTTGATCCTTCATCTTATATGAGTACTCTCACTGAGTGTTTACATGGTTCTATGGACTATAACTCTTTATCAAATGTTCTTGGCATGAGTTGCTCATCTTCTGAAGTTGTTTGTCCACCATTAGATCAAGAATCTTCAAGAAAAAACACTGCTGAAATTCCATTGACTCCAAATTCTTTGGTCTCTTCATCTTCTAGTGAGGCTGGAGGTGAAGAAGATTCTTCAAAAAGCAAGAAAGATTTGCAAGCAAA；
NtEXB1-R(+)：5’-cagtGGTCTCagggcTTTGCTTGCAAATCTTTCTT-3’；
NtEXB1-R(-)：5’-cagtGGTCTCatacaACACAAACCCCTCATCAGGA-3’；
the sequence of the target fragment amplified by the primers is as follows:
TTTGCTTGCAAATCTTTCTTGCTTTTTGAAGAATCTTCTTCACCTCCAGCCTCACTAGAAGATGAAGAGACCAAAGAATTTGGAGTCAATGGAATTTCAGCAGTGTTTTTTCTTGAAGATTCTTGATCTAATGGTGGACAAACAACTTCAGAAGATGAGCAACTCATGCCAAGAACATTTGATAAAGAGTTATAGTCCATAGAACCATGTAAACACTCAGTGAGAGTACTCATATAAGATGAAGGATCAAAATCCTGATGAGGGGTTTGTGT；
then, taking the tobacco cDNA as a template, respectively carrying out PCR amplification by using the primers, and extracting and purifying amplification products for later use to obtain a target sequence segment of the interference vector;
(II) cleavage and ligation
Carrying out BsaI/Eco31I double enzyme digestion on the PCR amplification product obtained in the step (I) and a pBWA (V) KS-RNAi vector respectively, and connecting the enzyme digestion product by using T4_ ligase;
(III) transformation and screening
And (5) transforming the ligation product in the step (II) into an escherichia coli competent cell, and screening and identifying to obtain a recombinant plasmid expression vector pBWA (V) KS-RNAi-NtEXB1 with correct recombination construction.
The recombinant vector pBWA (V) KS-RNAi-NtEXB1 is applied to plants, and the recombinant vector can reduce the content of the polypeptide in the plant after being transformed into the plantsNtEXB1The gene translation expression level is further used for inhibiting the development of plant branches, thereby realizing the plant type regulation effect.
A method for culturing the new plant variety with the regulation of plant type features that the Agrobacterium mediated gene transfer method is used to transfer the recombinant vector pBWA (V) KS-RNAi-NtEXB1 to plant, and the NtEXB1 gene expression-reduced new variety is obtained through screening and identification.
Based on the accumulation of previous work, the inventors selected tobacco in this applicationNtEXB1The inventors found that, by using a gene as a research object and studying the expression characteristics of the gene tissue: tobaccoNtEXB1The gene has the highest expression level in pistil and relatively high expression level in axillary bud, and has the lowest expression level in terminal bud, i.e., the gene may act specifically on axillary bud related tissue regulation. Further research on the phenotype of the plant after the gene silencing finds that the reduction is realized NtEXB1After gene expression level, tobacco axillary bud developmentThe speed becomes significantly slower. Based on the results, a certain theoretical basis and technical basis can be established for the targeted cultivation of new varieties of suitable plant types.
Drawings
FIG. 1 is a schematic view ofNtEXB1Expression characteristics of genes in different tissues;
FIG. 2 isNtEXB1In interfering plantsNtEXB1Analyzing the gene expression quantity; in the figure, EXB1-1, EXB1-2, EXB1-5 and EXB1-6 represent different transgenic lines, accord with the name and do not have special technical meaning;
FIG. 3 is a schematic view ofNtEXB1The length of axillary buds of the plants is interfered, and EXB-1 and EXB-2 in the figure represent different transgenic cultivation lines, and the name does not have special technical meaning.
Detailed Description
The present application is further illustrated by the following examples. Before describing the specific embodiments, a brief description will be given of some experimental background cases in the following embodiments.
Biological material:
tobacco variety: k326, a common tobacco variety, wherein the seeds adopted in the embodiment are preserved and provided by the national tobacco gene research center;
carrier: pEASY-T1 Simple vector, purchased from Beijing Quanyujin Biotechnology, Inc.;
pBWA (V) KS-RNAi vector, available from Wuhanbo Biotech Ltd;
The strain is as follows:
trans1-T1 chemically competent cells, purchased from Kyoto Kogyo gold Biotechnology Ltd;
LBA4404 Agrobacterium strains, common strains in biological experiments, can be obtained publicly;
the synthesis of the primers and the DNA sequencing are completed by the Beijing Liu-He Hua Dagen science and technology Co., Ltd;
experimental reagent:
fluorescent quantitative PCR enzyme (SYBR qPCR kit) purchased from Zhengzhou Ansai Biotech Co., Ltd;
the reverse transcription kit, T4 ligase and restriction enzyme are purchased from Takara bioengineering (Dalian) Co., Ltd;
DNA amplification enzyme, purchased from Beijing Quanji Biotech, Inc.;
RNA extraction Kit (Superpure Plant polyRNA Kit) and DNA purification gel recovery Kit were purchased from QIAGEN.
Example 1
Based on a summary of prior work, the inventors selected tobaccoNtEXB1The gene was used as a subject. In order to clarify the actual influence of the gene on plant growth, the inventors first cloned the gene. The specific process is briefly described as follows.
(1) Preparation of cDNA as cloning template
Taking 100mg of lamina of Wangcheng tobacco (K326) as a sample, fully grinding in liquid nitrogen, extracting total RNA according to the instruction of an RNA extraction kit, and then carrying out reverse transcription to obtain cDNA for later use;
(2) Designing primers and carrying out PCR amplification
Designed for amplificationNtEXB1The primer sequences of the genes are as follows:
NtEXB1-F: 5'-ATGTCTGATAATAACCCTTTTTATC-3'
NtEXB1-R: 5'-GATAAAAAGGGTTATTATCAGACAT-3'
using the cDNA prepared in the step (1) as a template, performing PCR amplification by using the primer,
the 50. mu.l amplification system was designed as follows:
cDNA template, 2. mu.l;
upstream and downstream primers, each 1 ul;
2×TransStart GoldPfu PCR SuperMix，25 μl；
ddH2o was added to 50 ul.
The PCR amplification procedure was: pre-denaturation at 94 ℃ for 4 min; denaturation at 94 ℃ for 30s, annealing at 56 ℃ for 30s, and extension at 72 ℃ for 40s for 30 cycles; and final extension at 72 deg.C for 10 min.
And (3) carrying out electrophoresis detection analysis on the PCR amplification product, and then recovering and purifying the PCR amplification product according to the instruction of the gel recovery kit.
(3) Connected with pEASY-T1 vector and transformed
Connecting the PCR amplification product extracted in the step (2) to a pEASY-T1 vector, wherein the specific connection system is as follows:
PCR amplification product, 6. mu.L;
pEASY-T1 vector, 1. mu.L;
after mixing, the mixture was connected at 25 ℃ for 25 min.
Subsequently, the ligation product is transformed into competent cells of Escherichia coli, and the specific transformation process is carried out by the following steps:
dissolving competent cells on ice, adding the ligation product into 50 μ L of Trans1-T1 competent cells, flicking, mixing, and ice-cooling for 30 min; heat shock is carried out in water bath at 42 ℃ for 30s, and the mixture is immediately placed on ice for 2 min; adding 250 μ L LB (without antibiotic) balanced to room temperature, shaking and culturing at 37 deg.C for 1 h; after mixing, the mixture was spread evenly on LB solid plates (containing 60. mu.g/. mu.L ampicillin) and cultured overnight at 37 ℃ with the petri dish inverted.
Picking white spots for amplification culture, extracting plasmid DNA, carrying out bacteria liquid PCR identification on recombinant plasmids, and then, sending the positive recombinant plasmids with correct recombination to a sample for sequencing to obtainNtEXB1A gene sequence.
The result of sequencing analysis shows that the DNA sequence of the DNA is expressed,NtEXB1the length of the gene coding region is 927 bp nucleotides, which is shown in SEQ ID NO. 1; further analysis shows that the codeNtEXB1The amino acid sequence of the protein is shown as SEQ ID NO. 2.
Example 2
Based on the fluorescent quantitative PCR technology in example 1, the inventors have conductedNtEXB1The characteristics of the tissue expression pattern of the gene were analyzed and studied, and the specific experimental procedures are summarized below.
Collecting pistil, terminal bud, root, petal, calyx, stem, stamen, leaf, vein and axillary bud of tobacco in bud stage as samples, extracting RNA, and synthesizing cDNA with reverse transcription kit for use (refer to kit instruction).
With tobaccoNtL25The gene is used as an internal reference, fluorescent quantitative PCR detection is carried out, and when in detection, the primer sequence is designed as follows:
detection ofNtEXB1The fluorescent quantitative primer of the gene has the following primer sequence:
NtEXB1-q-F: 5’- TCTTCGTGGAAATGCAGCTG-3’，
NtEXB1-q-R: 5’- CCTAATTGGGGTTGCTGCTG-3’；
when detecting the tobacco NtL25 gene, the specific primer design is as follows:
NtL25-F: 5’-CAAAAGTTACATTCCACCG-3’，
NtL25-F: 5’-TTTCTTCGTCCCATCAGGC-3’；
the conditions of the fluorescent quantitative PCR are as follows: first step pre-denaturation, at 95 ℃ for 10 s; the second step of PCR reaction, 95 ℃, 5 s, 60 ℃, 30 s, 39 cycles; third step dissolution profile.
Each sample was subjected to 3 biological replicates, passage 2-△△CTThe method analyzes relative gene expression difference. The results of the analysis are shown in FIG. 1. It can be seen that tobaccoNtEXB1The gene has the highest expression level in pistil, relatively high expression level in petal, stamen and axillary bud and the lowest expression level in terminal bud.
Example 3
For further understandingNtEXB1The function of the gene in the growth and development of plants, the inventor constructs the gene for knocking downNtEXB1The recombinant expression vector pBWA (V) KS-RNAi-NtEXB1 for the gene was briefly described below in the following description of the construction process of the recombinant vector.
(I) designing target site sequence and PCR amplification primer
The resulting NtEXB1 gene coding sequence was sequenced according to example 1, atNtEXB1The coding region of the gene selects a partial fragment as a target sequence (272 bp) for RNAi construction:
ACACAAACCCCTCATCAGGATTTTGATCCTTCATCTTATATGAGTACTCTCACTGAGTGTTTACATGGTTCTATGGACTATAACTCTTTATCAAATGTTCTTGGCATGAGTTGCTCATCTTCTGAAGTTGTTTGTCCACCATTAGATCAAGAATCTTCAAGAAAAAACACTGCTGAAATTCCATTGACTCCAAATTCTTTGGTCTCTTCATCTTCTAGTGAGGCTGGAGGTGAAGAAGATTCTTCAAAAAGCAAGAAAGATTTGCAAGCAAA；
based on the selected target site sequence, the primer sequences for PCR amplification were further designed as follows:
NtEXB1-F(+):5’-cagtGGTCTCacaacACACAAACCCCTCATCAGGA-3’，
NtEXB1-F(-):5’-cgatGGTCTCacaggTTTGCTTGCAAATCTTTCTT-3’；
the sequence of the target fragment amplified by the primers is as follows:
ACACAAACCCCTCATCAGGATTTTGATCCTTCATCTTATATGAGTACTCTCACTGAGTGTTTACATGGTTCTATGGACTATAACTCTTTATCAAATGTTCTTGGCATGAGTTGCTCATCTTCTGAAGTTGTTTGTCCACCATTAGATCAAGAATCTTCAAGAAAAAACACTGCTGAAATTCCATTGACTCCAAATTCTTTGGTCTCTTCATCTTCTAGTGAGGCTGGAGGTGAAGAAGATTCTTCAAAAAGCAAGAAAGATTTGCAAGCAAA；
NtEXB1-R(+):5’-cagtGGTCTCagggcTTTGCTTGCAAATCTTTCTT-3’，
NtEXB1-R(-):5’-cagtGGTCTCatacaACACAAACCCCTCATCAGGA-3’；
the sequence of the target fragment amplified by the primers is as follows:
TTTGCTTGCAAATCTTTCTTGCTTTTTGAAGAATCTTCTTCACCTCCAGCCTCACTAGAAGATGAAGAGACCAAAGAATTTGGAGTCAATGGAATTTCAGCAGTGTTTTTTCTTGAAGATTCTTGATCTAATGGTGGACAAACAACTTCAGAAGATGAGCAACTCATGCCAAGAACATTTGATAAAGAGTTATAGTCCATAGAACCATGTAAACACTCAGTGAGAGTACTCATATAAGATGAAGGATCAAAATCCTGATGAGGGGTTTGTGT。
and carrying out PCR amplification by using the primers and the tobacco cDNA as a template to obtain a target sequence segment for constructing the interference vector.
(II) cleavage and ligation
Carrying out BsaI/Eco31I double enzyme digestion on the PCR amplification product obtained in the step (I) and a pBWA (V) KS-RNAi vector respectively, and connecting the enzyme digestion product by using T4_ ligase;
(III) transformation and screening
And (3) transforming the ligation product in the step (II) into an escherichia coli competent cell, screening, selecting positive plasmids, and further carrying out bacteria liquid PCR identification and sequencing identification to obtain a recombinant plasmid expression vector pBWA (V) KS-RNAi-NtEXB1 with correct recombination construction (the related operation refers to the previous operation and the conventional operation in the prior art, and the description is omitted).
Example 4
Based on Agrobacterium mediated transformation method, the inventor further transforms the recombinant vector pBWA (V) KS-RNAi-NtEXB1 constructed in example 3 into tobacco plants to obtainNtEXB1The gene expression level is reduced orNtEXB1A new transgenic plant variety with gene knockout. The specific experimental procedures are briefly described as follows.
(1) Transformation of Agrobacterium
Freezing and thawing Agrobacterium tumefaciens competent cells on ice, adding 6. mu.L of the vector pBWA (V) KS-RNAi-NtEXB1 prepared in example 3, flicking and mixing; then placing the mixture in a pre-cooled electric rotating cup, and placing on ice for 5 min;
adjusting the parameters of the electric rotating instrument to: the voltage is 2.5 kV, the capacitance is 25 muF, and the resistance is 200 omega; then, completely absorbing water drops on the outer wall of the electric rotating cup by using absorbent paper, and then placing the electric rotating cup into an electric shock groove for 5 ms;
rapidly adding 800 μ L YEB liquid culture medium preheated to 28 deg.C, and resuscitating with shaking at 220 rpm and 28 deg.C for 3 h;
Then, the bacterial liquid is centrifuged at 4500 rpm for 1 min, half volume of supernatant is discarded, the supernatant is uniformly coated on YEB solid culture medium containing Rif (100 mu g/mL), Str (50 mu g/mL) and Kan (50 mu g/mL) after being resuspended, and inverted culture is carried out at 28 ℃ for about 2-3 d until a single colony is formed;
and selecting a single colony, performing PCR identification on the bacterial liquid after amplification culture, and identifying a correct positive clone strain, namely the agrobacterium engineering strain with correct transformation.
Further culturing the agrobacterium engineering bacteria to OD600After centrifugation at 4000 rpm for 5 min, the cells were collected and suspended in 20 mL of MS liquid medium to give an infection solution for subsequent transfection.
(2) Transformation of tobacco plants
Taking leaves of K326 tobacco aseptic seedlings growing for about one month, processing the leaves into leaf discs with the diameter of 0.5 cm by using a puncher, and pre-culturing the processed leaf discs on an MS solid culture medium for 3 d;
subsequently, placing the pre-cultured leaf disc in the staining solution in the step (1) and fully infecting for 10 min;
sucking the redundant bacterial liquid around the impregnated leaf disc by using sterile filter paper, and performing dark culture on a solid culture medium of MS +6-BA (2 mg/L) + NAA (0.5 mg/L) for 3 d;
washing leaf disks with sterile water containing Cef (400 mg/L), removing excess liquid by using sterile filter paper, transferring the leaf disks to MS solid screening culture medium containing 6-BA (2 mg/L), NAA (0.5 mg/L), Cef (200 mg/L) and Kan (50 mg/L), and culturing at 28 ℃ by illumination;
When the adventitious bud grows to 0.5cm, the bud is transferred to MS solid medium containing Cef (200 mg/L) and Kan (50 mg/L) for rooting.
After growing for about one month, a small amount of leaves are taken, DNA is extracted, and a positive transgenic line is detected by a PCR method. In the specific PCR identification, the primers are designed as follows:
NtEXB1-J-F: 5’-TTCATTTGGAGAGAACACGGGGGAC-3’，
NtEXB1-J-R: 5’-TCATGGCTCTCGTTTGTGGA-3’。
phenotype change of transgenic lines:
further, based on real-time quantitative PCR technology, the method is used for identifying positive transgenic linesNtEXB1And (3) detecting and analyzing the gene expression condition (specific operation refers to the previous step and the prior art). The results are shown in FIG. 2.
The analysis showed that tobacco was present in different RNAi plant lines compared to wild-type K326NtEXB1The gene expression level is obviously reduced, namely, the successful construction is shown to obtainNtEXB1A new transgenic plant variety with reduced gene expression level.
After the T0 generation plants are transplanted into pots and cultivated in a greenhouse for 12 weeks, the axillary bud length phenotype of the positive plants is detected and counted, and the result is shown in FIG. 3. It can be seen that the transgenic lines had slow development of axillary buds and significantly shorter length than the wild type, compared to the wild type K326. Further combining the foregoingNtEXB1The characteristics of gene expression pattern are expected to be utilizedNtEXB1The gene can specifically regulate and control the development activity of axillary bud branches, and further lay a certain technical foundation for regulating and controlling the plant type of plants, particularly tobacco.
SEQUENCE LISTING
<110> Zhengzhou tobacco institute of China tobacco general company
<120> application of tobacco NtEXB1 gene in plant branch development regulation
<130> none
<160> 2
<170> PatentIn version 3.5
<210> 1
<211> 927
<212> DNA
<213> Nicotiana tabacum
<400> 1
atgtctgata ataacccttt ttatcatgat tacttgggaa caggagggat aaataatgca 60
ttttctaatt tctttggtga tcaaaatccc tcaatttatg atcaaataat acctcctaat 120
acacaaaccc ctcatcagga ttttgatcct tcatcttata tgagtactct cactgagtgt 180
ttacatggtt ctatggacta taactcttta tcaaatgttc ttggcatgag ttgctcatct 240
tctgaagttg tttgtccacc attagatcaa gaatcttcaa gaaaaaacac tgctgaaatt 300
ccattgactc caaattcttt ggtctcttca tcttctagtg aggctggagg tgaagaagat 360
tcttcaaaaa gcaagaaaga tttgcaagca aaagatcagt gtgaagatgg agatgataag 420
tctaagaaag tgagcaaagc aaagaagaaa ggagaaaaga agcaaaagga gccgcgattt 480
gcctttatga ctaagagtga gattgacaat cttgaagatg gctatcgatg gagaaaatat 540
gggcagaaag cagtgaaaaa tagtcctttt ccgaggagtt attacagatg cacaagtcaa 600
aagtgcagtg tgaagaaacg tgtggaaaga tcatatgaag atccatcagt cgtgatcact 660
acatacgaag gccaacataa tcatcactgt cccgcaactc ttcgtggaaa tgcagctgca 720
gctatgcttt caccttcctt cttatcctct tcacaattaa ttcctcaaga tgtactcttt 780
gcccaaatgc ttacaacccc aaccaatcaa aatcagctcc ctattaatta ttctgtctat 840
aattatcagc agcaacccca attaggtcct gaatatggcc tatttcaaga tatggttgca 900
tcattgatcc acaaacgaga gccatga 927
<210> 2
<211> 308
<212> PRT
<213> Nicotiana tabacum
<400> 2
Met Ser Asp Asn Asn Pro Phe Tyr His Asp Tyr Leu Gly Thr Gly Gly
1 5 10 15
Ile Asn Asn Ala Phe Ser Asn Phe Phe Gly Asp Gln Asn Pro Ser Ile
20 25 30
Tyr Asp Gln Ile Ile Pro Pro Asn Thr Gln Thr Pro His Gln Asp Phe
35 40 45
Asp Pro Ser Ser Tyr Met Ser Thr Leu Thr Glu Cys Leu His Gly Ser
50 55 60
Met Asp Tyr Asn Ser Leu Ser Asn Val Leu Gly Met Ser Cys Ser Ser
65 70 75 80
Ser Glu Val Val Cys Pro Pro Leu Asp Gln Glu Ser Ser Arg Lys Asn
85 90 95
Thr Ala Glu Ile Pro Leu Thr Pro Asn Ser Leu Val Ser Ser Ser Ser
100 105 110
Ser Glu Ala Gly Gly Glu Glu Asp Ser Ser Lys Ser Lys Lys Asp Leu
115 120 125
Gln Ala Lys Asp Gln Cys Glu Asp Gly Asp Asp Lys Ser Lys Lys Val
130 135 140
Ser Lys Ala Lys Lys Lys Gly Glu Lys Lys Gln Lys Glu Pro Arg Phe
145 150 155 160
Ala Phe Met Thr Lys Ser Glu Ile Asp Asn Leu Glu Asp Gly Tyr Arg
165 170 175
Trp Arg Lys Tyr Gly Gln Lys Ala Val Lys Asn Ser Pro Phe Pro Arg
180 185 190
Ser Tyr Tyr Arg Cys Thr Ser Gln Lys Cys Ser Val Lys Lys Arg Val
195 200 205
Glu Arg Ser Tyr Glu Asp Pro Ser Val Val Ile Thr Thr Tyr Glu Gly
210 215 220
Gln His Asn His His Cys Pro Ala Thr Leu Arg Gly Asn Ala Ala Ala
225 230 235 240
Ala Met Leu Ser Pro Ser Phe Leu Ser Ser Ser Gln Leu Ile Pro Gln
245 250 255
Asp Val Leu Phe Ala Gln Met Leu Thr Thr Pro Thr Asn Gln Asn Gln
260 265 270
Leu Pro Ile Asn Tyr Ser Val Tyr Asn Tyr Gln Gln Gln Pro Gln Leu
275 280 285
Gly Pro Glu Tyr Gly Leu Phe Gln Asp Met Val Ala Ser Leu Ile His
290 295 300
Lys Arg Glu Pro
305
Claims (6)
1. TobaccoNtEXB1The application of the gene in the regulation and control of plant branch development is characterized in that the gene is the tobaccoNtEXB1The gene is related to branch development at axillary buds, has the function of increasing or reducing plant branches, and is used for plant type regulation and control of plants;
said tobaccoNtEXB1The length of the coding base sequence of the gene is 927bp, and the sequence is shown as SEQ ID No. 1.
2. The tobacco of claim 1NtEXB1The gene is applied to the regulation and control of the development of plant branches, and is characterized in that the plant is specifically tobacco;
when in specific application, the gene engineering technical means is adopted, and the method is characterized in thatNtEXB1Gene silencing and inhibitionNtEXB1After the gene expression is translated into the NtEXB1 protein, axillary buds grow slowly in the gene-silenced plants.
3. TobaccoNtEXB1The primer sequence for gene PCR amplification is characterized in that the tobaccoNtEXB1The gene and the sequence are shown as SEQ ID No.1, and during PCR amplification, the specific primer sequence is designed as follows:
NtEXB1-F: 5'-ATGTCTGATAATAACCCTTTTTATC-3'
NtEXB1-R: 5'-GATAAAAAGGGTTATTATCAGACAT-3'。
4. for knocking off grassNtEXB1The recombinant vector pBWA (V) KS-RNAi-NtEXB1 for gene expression is characterized by being constructed by the following steps:
firstly, designing a primer and carrying out PCR amplification
Based on the gene silencing target sequence, the primer sequence for PCR amplification is designed as follows:
NtEXB1-F(+)：5’-cagtGGTCTCacaacACACAAACCCCTCATCAGGA-3’，
NtEXB1-F(-)：5’-cgatGGTCTCacaggTTTGCTTGCAAATCTTTCTT-3’；
NtEXB1-R(+)：5’-cagtGGTCTCagggcTTTGCTTGCAAATCTTTCTT-3’；
NtEXB1-R(-)：5’-cagtGGTCTCatacaACACAAACCCCTCATCAGGA-3’；
then, respectively utilizing the primers to carry out PCR amplification, and extracting and purifying amplification products for later use to obtain a target sequence fragment of the interference vector;
(II) cleavage and ligation
Carrying out BsaI/Eco31I double enzyme digestion on the PCR amplification product obtained in the step (I) and a pBWA (V) KS-RNAi vector respectively, and connecting the enzyme digestion product by using T4_ ligase;
(III) transformation and screening
And (5) transforming the ligation product in the step (II) into an escherichia coli competent cell, and screening and identifying to obtain a recombinant plasmid expression vector pBWA (V) KS-RNAi-NtEXB1 with correct recombination construction.
5. The use of the recombinant vector pBWA (V) KS-RNAi-NtEXB1 in plants according to claim 4, wherein said recombinant vector is capable of decreasing the expression of said RNAi-NtEXB1 in plants transformed with said recombinant vectorNtEXB1The expression level of gene translation further inhibits the development of plant axillary bud branches, thereby realizing the plant type regulation effect.
6. A method for culturing the new plant variety with the regulation of plant type features that the Agrobacterium mediated gene transfer method is used to transfer the recombinant vector pBWA (V) KS-RNAi-NtEXB1 to plant, and the NtEXB1 gene expression-reduced new variety is obtained through screening and identification.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202210206578.7A CN114672494A (en) | 2022-03-04 | 2022-03-04 | Application of tobacco NtEXB1 gene in plant branch development regulation |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202210206578.7A CN114672494A (en) | 2022-03-04 | 2022-03-04 | Application of tobacco NtEXB1 gene in plant branch development regulation |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN114672494A true CN114672494A (en) | 2022-06-28 |
Family
ID=82073006
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202210206578.7A Pending CN114672494A (en) | 2022-03-04 | 2022-03-04 | Application of tobacco NtEXB1 gene in plant branch development regulation |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN114672494A (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN115043921A (en) * | 2022-06-30 | 2022-09-13 | 中国科学院华南植物园 | Lotus corniculatus plant type related gene LjLAZY3 and application thereof |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108517324A (en) * | 2018-04-17 | 2018-09-11 | 中国烟草总公司郑州烟草研究院 | One NtIPMD gene for influencing tobacco axillary bud differentiation |
| CN112063629A (en) * | 2020-08-19 | 2020-12-11 | 江西省科学院生物资源研究所 | Application of camphor tree branch regulatory factor WRKY2/DIB1 gene |
-
2022
- 2022-03-04 CN CN202210206578.7A patent/CN114672494A/en active Pending
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108517324A (en) * | 2018-04-17 | 2018-09-11 | 中国烟草总公司郑州烟草研究院 | One NtIPMD gene for influencing tobacco axillary bud differentiation |
| CN112063629A (en) * | 2020-08-19 | 2020-12-11 | 江西省科学院生物资源研究所 | Application of camphor tree branch regulatory factor WRKY2/DIB1 gene |
Non-Patent Citations (3)
| Title |
|---|
| DONGSHU GUO ET AL.: "The WRKY Transcription Factor WRKY71/EXB1 Controls Shoot Branching by Transcriptionally Regulating RAX Genes in Arabidopsis", 《THE PLANT CELL》, vol. 27 * |
| GENBANK: "PREDICTED: Nicotiana tabacum probable WRKY transcription factor 71 (LOC107779328), mRNA, XM_016599733.1", 《GENBANK》, pages 1 - 2 * |
| 康怡乐等: "烟草NtWRKY71 基因克隆与表达分析", 《中国烟草学报》, pages 1 - 11 * |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN115043921A (en) * | 2022-06-30 | 2022-09-13 | 中国科学院华南植物园 | Lotus corniculatus plant type related gene LjLAZY3 and application thereof |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| MXPA02003456A (en) | Method for regulating transcription of foreign genes in the presence of nitrogen. | |
| CN110669119B (en) | EjAGL17 protein for regulating loquat flowering time and coding gene and application thereof | |
| CN110819639B (en) | Tobacco low-temperature early-flowering related gene NtDUF599 and application thereof | |
| CN109022454B (en) | Cotton long fiber high expression gene GhLFHE2, and encoded protein and application thereof | |
| CN108517324B (en) | NtIPMD gene affecting tobacco axillary bud differentiation | |
| CN107177604B (en) | NtWRKY69 gene influencing tobacco pigment content and application thereof | |
| CN114672494A (en) | Application of tobacco NtEXB1 gene in plant branch development regulation | |
| CN110862445B (en) | NtOEP1 gene influencing tobacco pigment content and application thereof | |
| CN110156883B (en) | Tobacco SLs signal transduction protein NtDAD2, coding gene, recombinant expression vector, gene editing vector and application thereof | |
| CN107557384B (en) | Genetic transformation system for inducing plant dwarfing and construction and application thereof | |
| CN109161549A (en) | Regulate and control ARF8.1 and ARF8.2 gene and its application of tomato lateral bud development | |
| CN114807165A (en) | Application of corn ZmNAC78 gene | |
| CN110904067B (en) | Tobacco chlorogenic acid synthetic gene NtHQT and application thereof | |
| CN113637059A (en) | Application of GhTLP19 protein in regulation and control of cotton verticillium wilt-resistant bacteria and method for regulating and controlling cotton verticillium wilt-resistant bacteria | |
| CN108103075B (en) | Switchgrass gene PvC3H29 for delaying plant senescence and application thereof | |
| CN114591968B (en) | Application of tobacco NtSCL32 gene in plant branch regulation and control | |
| CN112391397A (en) | Tobacco flavone monooxygenase gene NtCYP75B2 and application thereof | |
| CN106701780B (en) | PgAG gene for regulating development of pomegranate ovule and application thereof | |
| CN114350685B (en) | Application of tobacco NtTAC1 gene in leaf angle regulation and control | |
| CN114875043B (en) | Betula alba BpPIF4 gene participating in adventitious root development and application thereof | |
| CN114805513B (en) | Tobacco NtOEE1 gene and application thereof in regulation of stem and leaf included angle and plant height | |
| CN116606855B (en) | Rice green tissue specific promoter pOsRBBI3 and application thereof | |
| CN116606856B (en) | Rice green tissue specific promoter pOsPTHR and application thereof | |
| CN110194791B (en) | Application of SPL3 protein in regulation and control of plant inflorescence or carpopodium development | |
| CN111019954B (en) | Tobacco protein ACTB and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination |