CN113403307B - Rhododendron erythropolis petal RhCHS gene promoter and flower color breeding application - Google Patents

Rhododendron erythropolis petal RhCHS gene promoter and flower color breeding application Download PDF

Info

Publication number
CN113403307B
CN113403307B CN202010565848.4A CN202010565848A CN113403307B CN 113403307 B CN113403307 B CN 113403307B CN 202010565848 A CN202010565848 A CN 202010565848A CN 113403307 B CN113403307 B CN 113403307B
Authority
CN
China
Prior art keywords
promoter
rhododendron
petal
rhchs
gene
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Active
Application number
CN202010565848.4A
Other languages
Chinese (zh)
Other versions
CN113403307A (en
Inventor
贾永红
吴月燕
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Zhejiang Wanli University
Original Assignee
Zhejiang Wanli University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Zhejiang Wanli University filed Critical Zhejiang Wanli University
Priority to CN202010565848.4A priority Critical patent/CN113403307B/en
Publication of CN113403307A publication Critical patent/CN113403307A/en
Application granted granted Critical
Publication of CN113403307B publication Critical patent/CN113403307B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
    • C12N15/8242—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits
    • C12N15/8243—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits involving biosynthetic or metabolic pathways, i.e. metabolic engineering, e.g. nicotine, caffeine
    • C12N15/825—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits involving biosynthetic or metabolic pathways, i.e. metabolic engineering, e.g. nicotine, caffeine involving pigment biosynthesis
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8216—Methods for controlling, regulating or enhancing expression of transgenes in plant cells
    • C12N15/8222—Developmentally regulated expression systems, tissue, organ specific, temporal or spatial regulation
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/10—Transferases (2.)
    • C12N9/1025—Acyltransferases (2.3)
    • C12N9/1029—Acyltransferases (2.3) transferring groups other than amino-acyl groups (2.3.1)
    • C12N9/1037—Naringenin-chalcone synthase (2.3.1.74), i.e. chalcone synthase
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6844—Nucleic acid amplification reactions
    • C12Q1/6848—Nucleic acid amplification reactions characterised by the means for preventing contamination or increasing the specificity or sensitivity of an amplification reaction
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y203/00—Acyltransferases (2.3)
    • C12Y203/01—Acyltransferases (2.3) transferring groups other than amino-acyl groups (2.3.1)
    • C12Y203/01074—Naringenin-chalcone synthase (2.3.1.74), i.e. chalcone synthase

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Organic Chemistry (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Biomedical Technology (AREA)
  • General Health & Medical Sciences (AREA)
  • Molecular Biology (AREA)
  • Biochemistry (AREA)
  • Microbiology (AREA)
  • Physics & Mathematics (AREA)
  • Biophysics (AREA)
  • Cell Biology (AREA)
  • Plant Pathology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Analytical Chemistry (AREA)
  • Immunology (AREA)
  • Medicinal Chemistry (AREA)
  • Nutrition Science (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

The invention obtains a promoter with higher promoter activity from Rhododendron erythropolis petal tissue. The total length of the promoter is 1477bp, the expression of a Chalcone synthase (CHS) gene can be efficiently started, the promoter can replace the CHS gene promoter with low expression level in other species by means of a gene recombination technology, the CHS enzyme activity is improved, and the synthesis of anthocyanin and anthocyanin in downstream pathways of anthocyanin metabolic pathways is increased, so that the color expression of petals is influenced.

Description

Rhododendron erythropolis petal RhCHS gene promoter and flower color breeding application
Technical Field
The invention belongs to the technical field of genetic engineering, and particularly relates to an acquisition of a Chalcone synthase (CHS) gene promoter from Rhododendron erythropolis petal tissue and application of the gene promoter in flower color breeding research.
Background
The promoter is a DNA sequence located in the upstream region of the 5' end of the structural gene and has the length of 1000-2000 bp. The DNA sequence can activate RNA polymerase, make it combine with template DNA accurately and start transcription. The specific transcription of a gene depends on whether the enzyme is able to form a binary complex with a promoter whose sequence affects its affinity for RNA polymerase and thus its level of expression. A TATA box structure with the sequence TATAAA is usually contained near the transcription initiation site of the core region of the promoter; upstream of the 5' end of the transcription start site there are usually CAAT box with sequence CCAAT and GC box with sequence GGCGGG, which interfere with the expression of promoter activity and determine the transcription specificity and activity. Therefore, the cloning, analysis and verification of the promoter sequence, cis-acting element composition and functional expression can not only improve the understanding of the time-space expression rule of the functional gene, but also have important function in controlling the expression effect of the functional gene by pertinently controlling the exogenous stimulating factor.
Azalea, six of ten flowers in China, enjoys the reputation of being "flowers like brocade". The flower has high ornamental value and commercial value due to luxuriant branches and flower colors and blazing sound. Red Belgium azalea is one of important ornamental azalea, and has many types such as red, white, pink, light green, mosaic system and the like, and is one of the main types of potted flower production in the world. As a rate-limiting enzyme of the phenylalanine metabolic pathway (genetic phenyl propanoid pathway), CHS has an important influence on the results of anthocyanin precursor synthesis. As a promoter for regulating CHS gene expression efficiency, CHS enzyme expression yield can be influenced, and finally plant petal flower color expression can also be influenced.
The invention researches the upstream promoter of CHS gene in Rhododendron erythropolis petal tissue, and analyzes the obtained sequence with cis-acting elements. The activity of the promoter is determined by constructing a recombinant vector containing the promoter by a recombinant technology, injecting tobacco leaf tissue and observing the staining effect by a GUS tissue staining method.
Disclosure of Invention
The technical problem to be solved by the invention is as follows: provides a Rhododendron roseum petal RhCHS gene promoter in Red Belgium to solve the problem of insufficient research on CHS gene promoter in Rhododendron roseum petal tissue at present, and provides application of the promoter to improve Rhododendron molecular breeding level.
In order to solve the above problems, the present invention provides the following solutions:
a Rhododendron delavayi petal RhCHHS gene promoter has a sequence as follows:
(1) The nucleotide sequence shown as SEQ ID NO.1 (the initiation codon is atg).
The amino acid sequence of SEQ ID NO:1, and the nucleotide sequence still has the function of a RhCHS gene promoter.
A recombinant vector constructed by the promoter of claim 1 and pCAMBIE1301 plasmid by gene recombination technology.
The recombinant vector is constructed by pCAMBIE1301 skeleton and promoter sequence. The pCAMBIE1301 plasmid was digested simultaneously with PstI and NcoI to remove 35S Promoter in front of GUS gene. And recovering the vector skeleton, connecting the vector skeleton with the promoter, and successfully constructing the recombinant vector by the steps of transformation experiment, sequencing verification and the like of a reaction product.
A recombinant cell for promoter amplification prepared from the recombinant vector of claim 2 and E.coli competent DH5 α.
A recombinant cell for transient transformation, which is prepared from the recombinant vector of claim 2 and Agrobacterium tumefaciens GV 3101.
A method for preparing the rhododendron roseum RhCHS gene promoter of claim 1, which comprises the following steps: the primer is obtained by using Rhododendron erythropolis petal DNA as a template and amplifying by using 3 specific primers, wherein the sequences of the 3 specific primers are shown as SEQ ID NO2, NO3 and NO 4.
The application of the Rhododendron delavayi petal RhCHS gene promoter in flower color breeding research and practice of horticultural plants, in particular to research on the improvement of gene expression efficiency by using the RhCHS gene promoter for replacing a low-activity gene promoter, and particularly research and application in flower color breeding research of the flower and garden industry.
The Rhododendron delavayi is popular as an ornamental plant, but the application of chalcone synthase in flower color breeding is rare, the invention provides a RhCHHS gene promoter of Rhododendron delavayi and a preparation method thereof, fills up the vacancy of the gene promoter in the current genetic engineering, provides a cloning mode of the chalcone synthase promoter of Rhododendron delavayi, provides a theoretical basis for the research of Rhododendron delavayi and related plants in the future, provides a theoretical basis for the improvement of plant quality and the acquisition of plants with different flower colors by utilizing the genetic engineering technology in the future, and has higher application value.
Drawings
FIG. 1 is a diagram showing the type of cis-acting elements of the RhCHS gene promoter in Rhododendron erythropolis petals and their positions in the sequence according to the present invention;
FIG. 2 is an analysis diagram of the sequence of the promoter of the RhHS gene in the recombinant vector of the present invention;
FIG. 3 is a drawing of a sample in decolorization in the example of the present invention (from left to right, rhCHS gene promoter recombinant vector, 1301 positive vector, negative vector);
FIG. 4 is a schematic diagram of the transient decoloring result of tobacco leaves (from top to bottom, rhCHHS gene promoter recombinant vector, 1301 positive vector and negative vector) (three repeat experiments each).
Detailed Description
The invention is further described in detail by the following detailed description in conjunction with the accompanying drawings.
Example 1 Rhododendron RsCHS Gene promoter cloning
Extraction of Rhododendron erythropolis DNA
The petals of red Belgium rhododendron used for the experiment were collected from Ningbo North Lun Yinhua flower Co. The sampled plants are required to be healthy, have luxuriant flowers and bright colors, and experimental petals are required to have dry, clean and uniform petals, uniform colors and no insect spots. The petals of the living plant are firstly cleaned with floating dust by a wash bottle, and the petals are collected and rapidly frozen by liquid nitrogen. And extracting rhododendron genomic DNA (deoxyribonucleic acid) from the frozen petal sample by adopting a CTAB (cetyl trimethyl ammonium bromide) method in a laboratory for later use.
(II) Tail-PCR primer design and verification
3R-terminal primers SP1, SP2 and SP3 (Table 1) are designed according to the instruction of Genome Walking Kit (code No. 6108) Kit, and are respectively matched with 4 random primers in the Kit for 3 rounds of nested PCR amplification. In addition, two OFR validation primers CHS-F and CHS-R were designed (Table 1).
Table 1: 3R-end primers SP1, SP2 and SP3 in Tail-PCR
Name of primer Nucleic acid sequence (5 '- -3') Function(s)
SP1 CAAACATAAGTCAGTAACCGTCACCC Tail-PCR first round PCR downstream primer
SP2 AAGGCTCATCCGACGACGATTC Tail-PCR second round PCR downstream primer
SP3 ACCCCCGTAATCAGAATATATGCACG Tail-PCR third round PCR downstream primer
CHS-F ACTGCGACCCCACCGAACTG ORF verification primer of CHS
CHS-R CCATGTCCTGCCTAGCGTCC OFR verification primer of CHS
(III) Tail-PCR Experimental Process
Three rounds of PCR amplifications were performed using Rhododendron erythrobelgiae genomic DNA as a template, using a phantamaxfidity DNA polymerase kit from Vazyme, and referring to the PCR program in the specification, using three primers such as SP1, SP2, and SP3 as designed downstream primers and 4 random primers (AP 1, AP2, AP3, and AP 4) in the kit as upstream primers. The procedure of the three amplification experiments was as follows:
first round PCR amplification (20 cycles): the template is red Belgium genome DNA,4 random primers AP1, AP2, AP3, AP4 and SP1 are respectively paired for 4 groups of first-round PCR amplification, and the amplification procedure is as follows:
(2) the 1st PCR reaction conditions were as follows:
Figure BDA0002547801890000041
second round PCR amplification (20 cycles): respectively taking 2 ul of 4 groups of products of the first round of amplification as templates of the current round, and respectively pairing the 4 random primers and SP2 primers again to carry out 4 groups of second round PCR amplification, wherein the amplification procedure is as follows:
(2) the 2nd PCR reaction conditions were as follows:
Figure BDA0002547801890000042
third round of CPR amplification (25 cycles): mu.l of the 4 sets of products from the second round of amplification were used as templates for the second round, and 4 sets of third round PCR amplifications (25 cycles) were performed by pairing the 4 random primers with the SP3 primer.
(2) The 3rd PCR reaction conditions were as follows:
Figure BDA0002547801890000043
the three PCR amplification results show that the AP1-SP3 amplification result in the third PCR amplification product has an obvious band, and the electrophoresis band of about 2000bp at the position is recovered by tapping. And after adding A tail to the tail end of the recovered product, connecting a pMD19-T vector, constructing T clone, transforming escherichia coli, verifying by a primer pair CHS-F and SP3, selecting positive clone, sending the positive clone to a sample for sequencing, wherein a sequencing primer is a universal primer M13 (-47), and splicing the sequencing result to obtain a promoter sequence of the CHS gene, wherein the result is shown as SEQ ID NO. 1.
Example 2 analysis of cis-acting element of Rhododendron RhCHS Gene promoter
The obtained 1477 promoter sequences were subjected to cis-acting element analysis by means of plantarcae, and the names, numbers and positions of cis-elements are shown in table 2 and fig. 1.
Table 2: type, position and quantity table of cis-acting element of Rhododendron rhCHS gene promoter
Figure BDA0002547801890000051
Example 3 construction of recombinant vector
The pCambia1301 vector was digested with PstI and NcoI, 35S Promoter before GUS gene was excised, and the vector backbone was recovered and subjected to recombination reaction with CHSP fragment. And transforming the reaction product into escherichia coli DH5 alpha, coating a Kana resistant plate, culturing at 37 ℃ overnight, picking 8 resistant colonies, carrying out PCR identification on positive colonies by using the amplification primers, and picking No. 15 clone for sequencing. The bidirectional sequencing primer is M13-R CAGGAAACAGCTATGAC and Gus-R GAAAAGGGTCCTAACCAAGA.
The result shows that the promoter sequence obtained in the recombinant vector is completely consistent with the promoter sequence obtained in the Tail-PCR experiment, and the success of the construction of the recombinant vector is proved. The sequencing results and the analysis results are shown in FIG. 2.
Example 4 verification of Activity of recombinant vector-transformed Arabidopsis thaliana
First, agrobacterium is injected and inoculated into Nicotiana benthamiana (Nicotiana benthamiana)
Agrobacterium GV3101 competent cells (pCambia 1301 empty vector transformed and GUS gene-removed vector 1301 simultaneously used as positive and negative controls) were transformed with the recombinant plasmid by freeze-thaw method, plated on LB medium plates to which antibiotics (containing kana 50mg/L, rif 25mg/L and Gen 25 mg/L) were added, and after PCR-verification of resistant single clones, the resistant single clones were inoculated into 5ml of YEP liquid medium (containing the same antibiotics) and cultured overnight in an incubator at 28 ℃ and 160 rmp. After centrifugation, the culture was collected and then resuspended in 5ml of a resuspension solution (containing 10mM MgCl) 2 10mM MES, 150. Mu.M As) and allowed to stand at room temperature for 3h. The agrobacterium after standing was injected with the leaf blade (lower epidermis) of the nicotiana benthamiana (about 1 month of growth) at the 5-leaf stage, 2-3 leaf blades (in the same position of the plant, similar in growth state and size) were injected per plant, 3 pieces were injected per treatment, and 3 replicates were set. The injected plants were transferred to 16h light and grown in 8h dark after overnight darkness at 25 ℃.
(II) GUS staining
3-5 days after Agrobacterium injection, injection leaf inoculation sites (3 replicates) were harvested and stained overnight at 37 ℃ with GUS stain. The stained leaves were then decolorized with 75% ethanol (to remove chlorophyll) and also at 37 ℃ overnight. After the decolorized ethanol was poured out, the film was washed with 75% ethanol and photographed, and the results are shown in fig. 3 and 4.
As shown in FIGS. 3 and 4, it is clear that the color of the RhCHS gene promoter recombinant vector is darker than that of the 1301 positive vector and that of the negative vector, and the role of the rhododendron chalcone synthase of the invention in flower color expression is also verified.
As shown in FIGS. 3 and 4, GUS staining of the recombinant vector for the RhCHS gene promoter was clearly deep into the pCAMBIA1301 positive control. The result shows that the RhCHS gene promoter has the activity of obviously promoting the expression of the RhCHS gene, and the regulation on the expression activity of the RhCHS gene can be implemented by changing the sequence of the promoter in the later period, so that the content of anthocyanin in tissues is adjusted, and the promoter plays a role in flower color breeding.
Materials, reagents and experimental equipment related to the embodiment of the invention are all commercial products conforming to the field of biological genetic engineering unless otherwise specified.
The foregoing is only a preferred embodiment of the present invention, and it should be noted that, for those skilled in the art, modifications and decorations can be made without departing from the core technology of the present invention, and these modifications and decorations shall also fall within the protection scope of the present invention. Any changes which come within the meaning and range of equivalency of the claims are to be embraced within their scope.
Sequence listing
<110> Zhejiang Wanli college
<120> Rhododendron erythropolis petal RhCHHS gene promoter and flower color breeding application
<130> 2020.6.2
<160> 4
<170> SIPOSequenceListing 1.0
<210> 1
<211> 1477
<212> DNA
<213> Belgium azalea (Rhododendron of Belgium)
<400> 1
tttaagtgca tacaaattta aatcgtccat tgctcggtta aaatccgaaa tgtcgattgg 60
caaaataagc gaccgatctg accggattgg ccgctctgca gggagcccat tcccccttca 120
tcccatttcg ccaacccgtc ttgaccacct cacctaacta acacttcccc acaactaaaa 180
ttgtttaaac ctggggcaga gcaaatgaat taaaatttgg gatggcaaaa ttagaagaaa 240
tcaacccatt atgataatag gataaagttc ttatatttac gtaaaaatag tagacatttc 300
aaggttaatc gtccataatc atctataatt agatgtgaca ctttaatttt tttttcccca 360
gttaatcatc tataatacat gttttaaggt tggtcaccta ttaacacaga gcaaatagat 420
tttaaaacaa tctatttaaa tggaactcgg tgtttctttt aagtctgaaa aactattcac 480
ggttgattct aaactaaatt tcaaaccccc gttcgttact cttcttaaat agagtaattt 540
gtatacaagt ttctttgact gcttcgtgaa cttttttttt tacttttttt tttctcttta 600
gagaattgtt tttagaattt ttttttgcac tttacgaata tttttctaat gtagttctat 660
ctaagaataa atatatttag aaggaattca caaaaattac tgaaaacgaa acaaagttga 720
gaaagatcaa taagtcaaat gtcaagtcaa agttggattt tttttttcat tattgtactt 780
tttaaatttt ggaaacctct attttttatt ttcaagcgcg taattgatgt acccagaagt 840
aaaaattttg ataaaatatt taaaaacatt gaataaatag aaaacgcgaa accatgcgta 900
acttcttcat cccaaaaaat ctcttacaaa aacataacag acataaagca atttcccttt 960
ccatgtttta taagggaagt gccggagaga aatcatcttt cgttttttcc gaaacctaat 1020
tttgataacc ctcaacgctc aaaaagcttg ttctaggacg gaatactaat gtaagcacgt 1080
gtaggagtgc gtgtttgtct gtcttcgtga gcttattcta aaataatctt tatggtattt 1140
ttttatttta aaaattatct tgcaacccat gttttcccta ttaaatgaat tattatgaag 1200
taggtataca agaatctcca tatcatgtgg aggcttttga agggggaaat gtagatacac 1260
caaaacccaa ctcacgtgct agccggcctc tccaagtagt catagcacgt gattccaaac 1320
taccatttct attggtcaca tatatatacc acccacaata ccaccaagtt ttgtcacaag 1380
ctgatcaaca attatctacc actccaagct gcttgtacta acacctacaa accacaaaaa 1440
ctccggccac cgctaaatta ttttttccgg cgaaaag 1477
<210> 2
<211> 26
<212> DNA
<213> SP1
<400> 2
caaacataag tcagtaaccg tcaccc 26
<210> 3
<211> 22
<212> DNA
<213> SP2
<400> 3
aaggctcatc cgacgacgat tc 22
<210> 4
<211> 26
<212> DNA
<213> SP3
<400> 4
acccccgtaa tcagaatata tgcacg 26

Claims (4)

1. The application of rhododendron roseum petal RhCHS gene promoter in horticultural plant flower color breeding research and practice is characterized in that the sequence of the promoter is as follows: a nucleotide sequence shown as SEQ ID NO. 1;
the preparation method of the Rhododendron delavayi petal RhCHHS gene promoter comprises the following steps: the PCR primer is obtained by using Rhododendron erythropolis petal DNA as a template and amplifying by using 3 specific primers, wherein the sequences of the 3 specific primers are shown as SEQ ID NO.2, SEQ ID NO.3 and SEQ ID NO. 4.
2. The application of rhododendron roseum petal RhCHS gene promoter in research and practice of flower color breeding of horticultural plants as claimed in claim 1, wherein the promoter is constructed into a recombinant vector, and the promoter as claimed in claim 1 and pCAMBIE1301 plasmid are constructed through gene recombination technology.
3. The application of rhododendron roseum petal RhCHS gene promoter in horticultural plant flower color breeding research and practice as claimed in claim 2, wherein the recombinant cell for promoter amplification is prepared from the recombinant vector as claimed in claim 2 and Escherichia coli competent DH5 alpha.
4. The use of rhododendron roseum petal RhCHS gene promoter in research and practice of flower color breeding of horticultural plants as claimed in claim 2, wherein the recombinant vector as claimed in claim 2 and Agrobacterium tumefaciens GV3101 are prepared into recombinant cells for transient transformation.
CN202010565848.4A 2020-06-19 2020-06-19 Rhododendron erythropolis petal RhCHS gene promoter and flower color breeding application Active CN113403307B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN202010565848.4A CN113403307B (en) 2020-06-19 2020-06-19 Rhododendron erythropolis petal RhCHS gene promoter and flower color breeding application

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202010565848.4A CN113403307B (en) 2020-06-19 2020-06-19 Rhododendron erythropolis petal RhCHS gene promoter and flower color breeding application

Publications (2)

Publication Number Publication Date
CN113403307A CN113403307A (en) 2021-09-17
CN113403307B true CN113403307B (en) 2022-12-20

Family

ID=77677321

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202010565848.4A Active CN113403307B (en) 2020-06-19 2020-06-19 Rhododendron erythropolis petal RhCHS gene promoter and flower color breeding application

Country Status (1)

Country Link
CN (1) CN113403307B (en)

Families Citing this family (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN115058447A (en) * 2022-05-31 2022-09-16 浙江万里学院 Method for realizing exogenous target gene transient expression in azalea petals by utilizing agrobacterium-mediated method
CN116376862B (en) * 2023-02-24 2023-11-03 贵州师范大学 RdCHS4 protein related to rhododendron anthocyanidin metabolism, recombinant vector and application thereof

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN109517812A (en) * 2018-12-18 2019-03-26 浙江万里学院 Azalea chalcone synthase RsCHS albumen and its encoding gene

Also Published As

Publication number Publication date
CN113403307A (en) 2021-09-17

Similar Documents

Publication Publication Date Title
US20170306341A1 (en) Compositions and related methods for modulating transcriptional activation by incorporating gag motifs upstream of core promoter elements
CN110205330B (en) Tobacco heat shock protein HSP22 and application thereof
CN113403307B (en) Rhododendron erythropolis petal RhCHS gene promoter and flower color breeding application
EP2649180A1 (en) Methods for production of synthetic promoters with defined specificity
CN107881172B (en) Stress inducible promoter, stress inducible promoter plant expression vector and method for inducing expression of target gene
CN107435044B (en) Promoter for specific expression of rice stamen and application thereof
CN110387383B (en) Method for regulating expression of NtCBT gene in tobacco tissue and application thereof
CN108901844B (en) Method for constructing lycoris genus genetic transformation system
CN113234732B (en) Lycoris longituba LlbHLH19 gene and expressed protein and application thereof
CN112458091B (en) Rice constitutive expression promoter Os02g0752800 and application
CN109679956B (en) Promoter sequence based on BnaCng 52950D gene, recombinant vector and application
CN110157710B (en) NaD1 gene promoter of nicotiana tabacum and application thereof
CN111304240A (en) Method for rapidly identifying grape gene function based on tobacco transient expression system
CN114540354B (en) Expression vector containing hot pickled mustard tuber IFL1 promoter fusion GUS gene and application thereof
KR101677067B1 (en) Seedspecific promoter derived from Oryza sativa and use thereof
CN116445483A (en) Flavonol synthase gene promoter derived from rhododendron leaves in red belgium, and preparation method and application thereof
CN116376911B (en) Plant drought, low temperature and osmotic stress induced promoter and application thereof
KR101494191B1 (en) Promoter for directing the guard-cell specific expression
CN116478998B (en) Rice phloem specific expression promoter POs04g0452500 and application thereof
CN112322621B (en) Eucommia DIR1 gene MeJA response promoter and application thereof
CN116949054B (en) Method for improving crape myrtle leaf callus regeneration rate by over-expressing LiMYB gene
CN116042612B (en) Peppermint lipid transport protein gene promoter specifically expressed by glandular hairs and application thereof
CN114591968B (en) Application of tobacco NtSCL32 gene in plant branch regulation and control
CN109825507B (en) Plant drought-induced synthetic promoter SP18 and application thereof
CN112280779B (en) Promoter pNtab3450 and expression vector and application thereof

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant