CN113304074B

CN113304074B - Oil composition capable of promoting skin barrier function

Info

Publication number: CN113304074B
Application number: CN202110661061.2A
Authority: CN
Inventors: 顾红健; 乔武; 贾霆涵; 贺来健
Original assignee: Pigeon Mother And Baby Products Shanghai Co ltd; Pigeon Shanghai Co Ltd
Current assignee: Pigeon Mother And Baby Products Shanghai Co ltd; Pigeon Shanghai Co Ltd
Priority date: 2021-06-15
Filing date: 2021-06-15
Publication date: 2022-10-25
Anticipated expiration: 2041-06-15
Also published as: CN113304074A

Abstract

The invention relates to the use of a combination comprising only sea buckthorn seed oil and sunflower seed oil as active ingredients as an external use promoter for improving or enhancing the barrier function of the skin. The present invention also relates to a composition for improving or enhancing skin barrier function, characterized in that it comprises only sea buckthorn seed oil and sunflower seed oil as active ingredients.

Description

Oil composition capable of promoting skin barrier function

Technical Field

The present invention relates to cosmetics or skin external preparations, and more particularly, to an oil and fat composition which can promote the barrier function of skin.

Background

The development of each system of the fetus has a specific physiological maturation time, and partial organs are not completely developed in the process of early delivery. The skin is the largest organ of the human body, and the degree of epidermal barrier maturation is closely related to gestational age. Premature infants are born without complete epidermis formation, have thinner epidermis than full term infants, and have only a few stratum corneum layers ^1,3 . Lack of structural proteins in the dermis, poor mechanical properties and greater susceptibility of the skin to damage ² . Premature skin is also considered "damaged skin" ⁴ . The premature neonate has high water loss caused by skin barrier insufficiency, the electrolyte balance of the premature neonate is affected, and the water loss can also causeHeat loss, affecting the thermoregulation of premature infants. Epidermal barrier insufficiency increases the risk of infection in premature infants, and poor skin integrity has been reported as a major cause of sepsis in premature newborns. Although the barrier develops rapidly after birth in premature infants, full maturation still takes 2-9 weeks, even longer. Accelerating the maturation of the skin barrier is therefore of vital importance to the population of premature infants ⁴ 。

The integrity of the horny layer and the cohesion of the horny cells are one of the main indexes of barrier function, desmosomal protein (CDSN) is the main protein for connecting the horny cells and tightly connecting, the level of the CDSN protein is increased, the aggregation force between the horny cells is increased, and the skin barrier function is improved. Total protein content was reported to be higher than adult levels after harvesting premature and term neonatal keratinocytes using the Tape striping method. Indicating that the polymerization force between keratinocytes in the newborn is lower than that in the adult ⁸ 。

Peroxisome Proliferator Activated Receptors (PPARs) belong to the nuclear hormone receptors and are classified as PPAR α, PPAR β/δ and PPAR γ. These receptors are distributed in organs and tissues such as skin, fat, liver, heart and kidney. PPARs, when activated by their activators, promote the development of embryonic skin and the formation of skin barrier function. Topical PPARs activators promote differentiation of epidermal keratinocytes and synthesis of epidermal sebum. Meanwhile, the skin barrier function recovery after trauma is also promoted. In addition, the topical PPARs activator also has good inhibitory effect on irritant and allergic contact dermatitis ⁵ 。

Long chain polyunsaturated fatty acids are activators of PPARs, such as oleic acid, linoleic acid, alpha linolenic acid, docosahexaenoic acid, arachidonic acid, and the like. It has been reported that oleic acid, linoleic acid, eicosatetraenoic acid induce keratinocyte differentiation during human keratinocyte culture, such as expression of endo-tegrin and transglutaminase 1 ⁶ Docosahexaenoic acid promotes expression of filaggrin ⁷ 。

The skin care product raw material contains a plurality of plant-derived oils, and the components of the skin care product raw material contain long-chain polyunsaturated fatty acid. For example, under the conditions of high cold, severe heat, wind sand and drought climate, the fruits of sea buckthorn contain rich nutrients and bioactive substances, and therefore sea buckthorn is widely applied to many fields such as food, medicine, light industry, farming and animal husbandry fish industry and the like.

Based on such technical background, there is a need to develop a composition capable of achieving a better skin barrier function-improving effect, thereby being applied to daily care of premature infant skin, sensitive skin and skin with insufficient skin barrier function.

Disclosure of Invention

The seabuckthorn seed oil is a brown yellow to brown red transparent oily liquid obtained by carrying out supercritical extraction or subcritical biotechnology low-temperature extraction on seabuckthorn seeds, and is a high-concentration product integrating active ingredients of seabuckthorn. Contains more than 140 bioactive components such as flavone, organic acid, alkaloid, sterol, triterpene, and various vitamins. The sea buckthorn seed oil has the function of repairing skin barriers, and the alpha linolenic acid contained in the sea buckthorn seed oil is a PPAR alpha activator.

The sunflower seed oil is common vegetable oil in life, contains a large amount of unsaturated fatty acid such as linoleic acid and the like which is necessary for human bodies, can promote the regeneration and the growth of human body cells, protect the health of skin, and can reduce the accumulation of cholesterol in blood. Premature infants are reported to promote the maturation of skin barrier function after application of sunflower seed oil, which contains mainly linoleic acid which is an activator of PPAR α and PPAR β/δ.

In the prior art, the seabuckthorn seed oil and sunflower seed oil are commonly used together with other oils and fats for preparing food products (such as CN106509123B and CN 106922844B) or for preparing detergents (CN 112569134A) and lubricants (CN 112574797A)

As mentioned above, the skin is the largest immune organ, and the strength of the barrier function is very important to human health.

The work of the present application was that the present inventors surprisingly found that a combination comprising only sea buckthorn seed oil and sunflower seed oil as active ingredients had the effect of improving the skin barrier function. Therefore, better enhancement of skin barrier function can be achieved by using the composition containing the different PPARs activating ingredients, namely the sea buckthorn seed oil and the sunflower seed oil, and the composition can be applied to daily care of premature infant skin, sensitive skin and skin with insufficient skin barrier function.

It is therefore an object of the present invention to provide a more effective composition for promoting the enhancement of skin barrier function.

Accordingly, a first aspect of the present invention is to provide the use of a combination comprising only sea buckthorn seed oil and sunflower seed oil as active ingredients as an external use promoter to improve or enhance the skin barrier function.

A second aspect of the present invention is to provide the use of a combination comprising only sea buckthorn seed oil and sunflower seed oil as active ingredients for the preparation of a composition for enhancing or strengthening the barrier function of the skin.

According to a preferred embodiment of the invention, the mass ratio of the sea buckthorn seed oil to the sunflower seed oil is 10.

According to another most preferred embodiment of the invention, the mass ratio of the sea buckthorn seed oil to the sunflower seed oil is 1:1.

According to a preferred embodiment of the present invention, wherein the composition is a cosmetic or skin external preparation.

A third aspect of the present invention is to provide a composition for improving or enhancing skin barrier function, characterized in that it comprises only hippophae rhamnoides seed oil and sunflower seed oil as active ingredients.

In addition to the seabuckthorn seed oil and sunflower seed oil as active ingredients, the composition for improving or enhancing the skin barrier function may comprise various excipients, for example vegetable oils of the same type, such as corn oil, peanut oil, evening primrose oil, meadowfoam seed oil, avocado oil, jojoba seed oil, caprylic/capric triglyceride, carnauba (acid) wax, candelilla wax, jojoba oil and the like; animal fats and oils such as squalane, lanolin, beeswax, etc.; mineral oil petrolatum and fatty acids such as stearic acid, lauric acid, palmitic acid and the like, fatty alcohols such as cetyl alcohol, behenyl alcohol, cetearyl alcohol and the like. Preferred excipients include caprylic capric triglyceride, squalane, jojoba oil, and the like.

The integrity and cohesion between keratinocytes is one of the main indicators for evaluating the barrier function of the skin.

Desmosomal proteins (CDSN, corneodesmosin) are the major proteins for tight junctions connecting keratinocytes. Increasing CDSN protein level can increase aggregation force between keratinocytes and improve skin barrier function.

In order to verify the application of the composition in improving or strengthening the skin barrier function, the inventor adds the compositions of the seabuckthorn oil and the sunflower seed oil in different mass ratios to a human epidermis skin model weakened by mixed inflammatory factors IL-4, IL-13, TNF-alpha and Poly I: C stimulation, jointly cultures the human epidermis skin model, detects the expression condition of the desmosome protein by a fluorescent quantitative PCR (qPCR) method, and compares the improvement efficiency of the indexes with the improvement efficiency of single seabuckthorn seed oil or sunflower seed oil.

The trans-epidermal water loss value (TEWL) is the main index for evaluating the integrity of the skin barrier in a human body test, and the smaller the value, the better the barrier function. The method for collecting the corneocytes by using the Tape striping method and detecting the total protein content after collection is a main method for evaluating the polymerization force of the corneocytes in a human body test, wherein the lower the total protein content level, the higher the polymerization force among the corneocytes is, and the better the barrier function is.

After the compositions of the sea buckthorn oil and the sunflower seed oil with different mass ratios are added, the total protein content of the using part and the total protein content of the non-using part are compared by detecting the TEWL value of the using part and the non-using part through a human body test and collecting the corneocytes by using a Tape striping method.

The invention has the beneficial technical effects that:

the raw materials of the sea buckthorn seed oil and the sunflower seed oil are cheap and easy to obtain, and the preparation method is to simply and uniformly mix the raw materials at normal temperature without special process requirements. However, unexpectedly, the inventive combination of seabuckthorn and sunflower seed oil or the inventive formulation comprising only seabuckthorn and sunflower seed oil as active ingredients according to the present invention has a significant enhancing effect on desmosomal protein (CDSN) at the mRNA level and a significant reduction of the transepidermal water loss value (TEWL) in human skin tests, thus having a very good function of enhancing or strengthening the skin barrier.

Specifically, the functional raw materials of the invention comprise the following main components:

name of raw materials	Stearic acid C18:0	Oleic acid C18:1	Linoleic acid C18:2	Linolenic acid C18:3
					Sunflower seed oil	1-10％	14-39％	48-74％	≤0.5％
Sea buckthorn seed oil	-	15-25％	30-38％	23-31％

Drawings

FIG. 1: effect of combinations 1 to 3 of the invention on the expression of desmoglein (CDSN) at the mRNA level in vitro.

FIG. 2: effect of the preparations 1 to 3 of the present invention on the expression of desmoglein (CDSN) at the mRNA level in vitro.

FIG. 3: effect of formulation 1 of the present invention on transepidermal water loss value (TEWL) in human skin tests.

FIG. 4: effect of formulation 1 of the present invention on total protein levels in human skin tests.

FIG. 5: results histogram of desmoglein (CDSN) versus Integrated Optical Density (IOD).

Detailed Description

Example 1: sunflower seed oil unsaponifiable sample from Laboratoires Expancreatence, lot 1902400014, and Purdia, inc. was used, lot C13-180501 sea buckthorn seed oil. Sunflower seed oil and sea buckthorn seed oil are dissolved in DMSO solvent according to different mass ratios to obtain a combination 1-3 with the solution concentration of 20mM, and the specific mixture ratio and mass are as follows:

combination 1: sunflower seed oil seabuckthorn seed oil =2 (0.0190 g): 1 (0.0095 g)

And (3) combination 2: sunflower seed oil seabuckthorn seed oil =1 (0.0098 g): 2 (0.0196 g)

And (3) combination: sunflower seed oil seabuckthorn seed oil =1 (0.0145 g)

And (3) uniformly mixing the sunflower seed oil and the sea buckthorn seed oil in the mass ratio at normal temperature to obtain the composition 1-3.

Example 2: preparation of formulations 1-3 comprising combinations 1-3 prepared in example 1

Mixing caprylic/capric triglyceride, squalane and jojoba oil as preferred excipients at room temperature, and mixing the above composition 1-3 with the above excipient mixture to obtain preparation 1-3, wherein the specific mass ratio is shown in Table 1:

blank formulations without formulations 1-3 were also prepared as controls.

Example 3: effect of combinations 1-3 of the invention on desmoglein (CDSN) expression at the mRNA level in vitro.

The experimental method is as follows:

1. cell culture

Human keratinocytes (NHEK) were used, cultured in Epilife medium containing 60. Mu.M calcium ions and human keratinocyte growth supplement HKGS in an incubator at 37 ℃ containing 95% air and 5% carbon dioxide, the medium was changed every two days, and after the cells had grown to 70% -80% confluency, the cells were digested for the next experiment.

2. Inflammatory cell model construction

NHEK cells at 5X 10 ⁵ The next experiment was performed by inoculating the cells/well at a density of 35mm in a 35mm dish, culturing 60 μ M calcium ion and Epilife medium without HKGS in an incubator at 37 ℃ containing 95% air and 5% carbon dioxide overnight, attaching to the wall, adding a mixture of optimized concentrations of IL4, IL13, TNF-. Alpha.Poly I: C cytokines, incubating for 24 hours.

3. Cytotoxicity test

NHEK cells at 5X 10 ³ The density of individual cells/well was seeded in 96-well plates. Then, the culture was carried out for 12 hours in Epilife medium containing 60. Mu.M calcium ions and HKGS. Samples (0.25,0.5,1, 10, 100 μ g/mL) at various concentrations were prepared in DMSO and cells were treated for 24 hours in a 37 ℃ incubator containing 95% air and 5% carbon dioxide. Add 10. Mu.L CCK-8 per 100. Mu.L of medium and leave in carbon dioxide incubator for 3h, and the evaluation of the toxicity of the active on the cells was determined by comparing the absorbance of the active at 450nm wavelength for each concentration.

The calculation formula is as follows: cell viability (%) = absorbance/OD absorbance of treated group 100%, and it is generally considered that actives with cell viability greater than 80% are not significantly toxic to cells.

4. Efficacy testing

An inflammatory cell model was constructed according to the method 5.2, with the addition of inflammatory factor mixture and sample, and cultured for an additional 24 hours, and the total RNA of the cells was extracted using TRIZOL reagent (Life Technologies, CA, USA) and prepared for qPCR analysis.

5.QPCR analysis, and delegating the detection of ShanghaineBiotech limited to be completed.

Primer list 2:

gene	F	R
			CDSN	TTAAGCCAGGAACGGGGTATT	GGAACCGGATGCACCTTGTAG

Desmoglein (CDSN, corneodesmosin) is the major protein that connects keratinocytes to tight junctions. Increasing CDSN protein level can increase aggregation force between keratinocytes and improve skin barrier function.

Mu.l of each of the combinations 1 to 3 prepared in example 1 was added to co-culture of human keratinocytes weakened by mixed stimulation with inflammatory factors IL-4, IL-13, TNF-. Alpha., poly I: C, and the expression of desmoglein (CDSN) was detected by the quantitative fluorescence PCR (qPCR) method and compared with either seabuckthorn seed oil or sunflower seed oil alone and positive and blank controls, as shown in Table 3 below:

TABLE 3

Barrier indicators	Positive control	Blank control	Sunflower seed oil	Sea buckthorn seed oil	Combination	1	Combination 2	Combination 3
									CDSN	1.00	0.55	1.83	4.67	7.45	5.99	7.54

Positive control: the combinations 1-3 prepared in example 1 were not added to keratinocytes stimulated with a mixture of inflammatory factors.

Blank control: keratinocytes without any treatment, no combinations 1-3 prepared in example 1 were added.

As can be seen from Table 3, the combinations 1 to 3 according to the invention have a significantly improved desmosomal protein (CDSN) at the mRNA level compared to the seabuckthorn seed oil or sunflower seed oil alone, and thus have a significant synergistic effect.

Example 4: effect of the preparations 1 to 3 of the present invention on the expression of desmoglein (CDSN) at the mRNA level in vitro.

The test method was the same as in example 3.

Desmosomal proteins (CDSN, corneodesmosin) are the major proteins for tight junctions connecting keratinocytes. The CDSN protein level is increased, the aggregation force among keratinocytes can be increased, and the skin barrier function can be improved.

Mu.l of each of the preparations 1 to 3 prepared in example 2 was added to co-cultured human keratinocytes weakened by stimulation with mixed inflammatory factors IL-4, IL-13, TNF-. Alpha., poly I: C, and the expression of desmoglein (CDSN) was measured by the quantitative fluorescence PCR (qPCR) method and compared with the positive control and blank formulation, and the results are shown in Table 4 below:

TABLE 4

Barrier index	Positive control	Blank formulation	Preparation	1	Preparation 2	Preparation 3
							CDSN	1	0.08	2.75	3.24	4.67

Positive control: keratinocyte stimulation with a mixture of inflammatory factors, without addition of formulations 1-3 prepared in example 2

Blank formula: formulations 1-3, prepared in example 2, were not added as a mixture of 3 excipients, caprylic capric triglyceride, squalane, jojoba oil, in the proportions shown in table 1 above.

As can be seen from table 4, the formulations 1-3 of the present invention comprising sunflower seed oil and sea buckthorn seed oil had a significantly improved desmosomal protein (CDSN) at the mRNA level compared to the positive control and blank formulations.

Example 5: the effect of formulation 1 of the present invention on the transepidermal water loss value (TEWL) in a human skin test was tested as follows:

1. number of subjects, total 5 persons (internal test)

2. The subject claims:

2.1 Age 45 years old or older

2.2 No history of skin disease

2.3 The patient is not in a hospital for treatment due to skin problems

2.4 The glucocorticoid medicine has not been used in the last month

2.5 Without the basic diseases such as diabetes

2.6 The skin has no itching and dryness

3. Testing parts: inner side of forearm

4. Test method

4.1 Sample preparation 1 prepared in example 2 of the present invention was used at 2mg/cm ² The smearing amount was applied to the entire left forearm as the area where the sample was applied, and the right forearm was not smeared with any sample and used as a blank control area 2 times a day in the morning and at night for 4 weeks.

4.2 Percutaneous water loss (TEWL value) was measured by resting the test subjects in a room temperature environment (20-25) deg.C and humidity (40-60)% for 30 minutes, measuring the water loss values of the inner sides of the left and right forearms in the same area using the TEWL Meter of a CK skin tester for the initial, 1 week, 2 weeks, 3 weeks, 4 weeks, and 5 weeks, respectively. The 5 th week test was to investigate barrier recovery after disruption of the stratum corneum with tape. The same site was measured 3 times consecutively.

4.3 The horny layer was collected by Tape striping, and the same part of the inner side of the left and right forearms was applied to the skin continuously 20 times using D-Squame D100 film (Clinical & dark). The TEWL value was measured 4 times per patch, and the same site was measured 3 times consecutively. And (4) collecting the cuticle, and placing the Tape at-20 ℃ for storage for later use.

4.4 Total protein content detection, performed according to literature methods ⁹ 。

The trans-epidermal water loss value (TEWL) is the main index for evaluating the integrity of the skin barrier in human body tests, and the smaller the value, the better the barrier function is. The method for collecting the corneocytes by using the Tape striping method and detecting the total protein content after collection is a main method for evaluating the polymerization force of the corneocytes in a human body test, wherein the lower the total protein content level, the higher the polymerization force among the corneocytes is, and the better the barrier function is.

After the preparation 1 prepared in example 2 of the present invention was added, the total protein content of the used site and the unused site was compared by examining the TEWL values of the used site and the unused site in a human body test, collecting keratinocytes by using the Tape striping method.

As shown in fig. 3, the TEWL value of the application site (inventive formulation 1) was significantly decreased compared to the non-application site (control), indicating that the barrier function of human skin was improved by using the inventive formulation comprising sunflower seed oil and sea buckthorn seed oil.

As shown in fig. 4, the total protein level detected after harvesting the keratinocytes from the application site (inventive preparation 1) was significantly reduced compared to the non-application site (control), indicating an increased binding force between keratinocytes after using the inventive preparation comprising sunflower seed oil and sea buckthorn seed oil.

Example 6: the expression effect of CDSN at the protein level is detected by an immunohistochemical method.

The experimental method is as follows:

administration and induction steps:

1. and (4) leaving the model out of the factory: according to experimental groups, the skin model was transferred to 6-well plates (small molds were added in advance and 3.7mL of skin model culture solution was added), and test group numbers were marked on the 6-well plates.

2. Administration: 25 μ L of the test sample shown in Table 5 below was takenAdding onto the surface of the model, uniformly coating, and placing in CO ₂ Incubator (37 ℃, 5% CO) ₂ 95% RH) for 24h.

3. Fixing treatment: after the dosing incubation was completed, the 6-well plate was removed from the incubator. The surface of the model was lightly wiped with a sterile cotton swab. Fixing the model with 4% paraformaldehyde for 24h, cutting off the model, and performing immunohistochemical staining.

A step of immunohistochemistry, which is to say,

1. baking slices and dewaxing: the paraffin sections were placed in a 70 ℃ baking machine and baked for 4 hours.

2. Dewaxing and hydrating: soaking the slices in xylene for 10min, replacing xylene, soaking for 10min, soaking in anhydrous ethanol for 5min, soaking in 95% ethanol for 5min, and soaking in 75% ethanol for 5min. The cells were washed 3 times with PBS buffer for 5min each time.

3. Antigen retrieval: and (3) putting the paraffin sections into 0.01M sodium citrate antigen retrieval solution, performing high-pressure retrieval, cooling and taking out the sections. The washing was performed 3 times for 5 min/time with PBS buffer.

4. Blocking peroxidase: 1 drop of 3% H2O2 was added to each section and incubated at room temperature for 30min to block endogenous peroxidase activity. The washing was performed 3 times for 5 min/time with PBS buffer.

5. And (3) sealing serum: and adding serum homologous with the secondary antibody dropwise, sealing at 37 ℃ for 60min, and not washing.

6. Primary antibody incubation: add the primary antibody solution dropwise and incubate overnight at 4 ℃. The washing was performed 3 times for 5 min/time with PBS buffer.

7. And (3) secondary antibody incubation: and adding a secondary antibody working solution dropwise, and incubating for 1h at room temperature. The washing was performed 3 times for 5min in PBS buffer.

Abc complex incubation: dripping ABC complex solution, and incubating at room temperature for 30min. The washing was performed 3 times for 5 min/time with PBS buffer.

9, DAB dyeing: 1 drop of freshly prepared DAB solution (the specific part will stain brown) was added to each section and observed under a microscope for 5-30 s.

10. Counterdyeing: hematoxylin counterstain for 30s.

11. And (3) dehydrating: dehydrating the slices with gradient alcohol (75%, 95%, 100%) for 5min, soaking in xylene for 10min, replacing xylene, soaking for 10min, drying, sealing with neutral resin, sun drying, and observing.

Table 5 below shows the CDSN relative Integrated Optical Density (IOD) results.

TABLE 5

And B, group BC: blank model, without addition of test sample, only medium cultured normal growth of human epidermal skin model.

A PC group: human epidermal skin model stimulated with pilinic acid (WY 14643, 50umol/L, a highly potent ppar α agonist).

Sunflower seed oil group: a model of human epidermal skin stimulated with sunflower seed oil.

Seabuckthorn seed oil group: a model of human epidermal skin stimulated with seabuckthorn seed oil is used.

Combination 1 group: the human epidermal skin model stimulated with combination 1 prepared in example 1 was used.

As shown in table 5, compared with the BC group, the CDSN expression of the PC group was significantly improved, indicating that the stimulation conditions of this experiment were effective.

Compared with the BC group, it is again demonstrated from the protein expression level that the expression of CDSN can be significantly improved by the individual sunflower seed oil, the individual hippophae rhamnoides seed oil, and the combination 1 prepared in example 1 under the respective concentrations, which exactly corresponds to the expression of the combination 1 in example 3 at the mRNA level.

Reference documents:

1.Rutter N:Clinical consequences of an immature barrier.Semin Neonatol 2000；5:281.

2.Eichenfield LF and Hardaway CA:Neonatal dermatology.Curr Opin Pediatr 1999；11:471.

3.Cartlidge P:The epidermal barrier.Semin Neonatol 2000；5:273.

4.Marty Visscher,Vivek Narendran,The Ontogeny of Skin, ADVANCES IN WOUND CARE,VOLUME 3,NUMBER 4,2013

5. Memaoqiang, et al, the biological regulation of peroxisome proliferator-activated receptors on skin, journal of clinical dermatology, 36 vol. No. 3 of 2007

6.Matthias Schmuth etc.,Role of PPAR,LXR,and PXR in epidermal homeostasis and inflammation,Biochimica et Biophysica Acta (2013)

7.Leonie Wallmeyer etc.,Stimulation of PPARa normalizes the skin lipid ratio and improves the skin barrier of normal and filaggrin deficient reconstructed skin,Journal of Dermatological Science(2015)

8.Matty O.Visscher etc.,Biomarkers of neonatal skin barrier adaptation reveal substantial differences compared to adult skin.Pediatric research(2020)

9.Maja-Lisa Clausen etc.,Tape Stripping Technique for Stratum Croneum Protein Analysis,SCIENTIFIC REPORTS,2016。

Claims

1. The application of the combination only containing the sea buckthorn seed oil and the sunflower seed oil as active ingredients in preparing the external accelerant for improving or strengthening the skin barrier function is as follows, wherein the mass ratio of the sea buckthorn seed oil to the sunflower seed oil is (10).

2. Use of a combination comprising only sea buckthorn seed oil and sunflower seed oil as active ingredients for the preparation of a composition for enhancing or strengthening skin barrier function, wherein the mass ratio of sea buckthorn seed oil to sunflower seed oil is 10-1.

3. The use according to claim 1 or 2, wherein the mass ratio of the sea buckthorn seed oil to the sunflower seed oil is 5:1-1:5.

4. The use according to claim 3, wherein the mass ratio of the sea buckthorn seed oil to the sunflower seed oil is 1:1.

5. The use according to claim 2, wherein the composition is a cosmetic or skin external preparation.

6. A composition for improving or enhancing skin barrier function, characterized in that it only comprises seabuckthorn seed oil and sunflower seed oil as active ingredients, wherein the mass ratio of seabuckthorn seed oil to sunflower seed oil is 10-1.

7. The composition according to claim 6, wherein the mass ratio of the sea buckthorn seed oil to the sunflower seed oil is 5:1-1:5.

8. The composition according to claim 7, wherein the mass ratio of the sea buckthorn seed oil to the sunflower seed oil is 1:1.

9. The composition according to any one of claims 6-8, wherein the composition further comprises vegetable fats and oils, animal fats and oils, mineral oil petrolatum, fatty acids, and fatty alcohols.

10. The composition of claim 9, wherein the vegetable oil is selected from corn oil, peanut oil, evening primrose oil, meadowfoam oil, avocado oil, jojoba oil, caprylic capric triglyceride, carnauba wax, candelilla wax, or jojoba oil.

11. The composition of claim 9, wherein the animal fat is selected from squalane, lanolin, or beeswax.

12. The composition of claim 9, wherein the fatty acid is selected from stearic acid, lauric acid, or palmitic acid.

13. The composition of claim 9, wherein the fatty alcohol is selected from cetyl alcohol, behenyl alcohol, or cetearyl alcohol.

14. The composition of claim 9, wherein the composition further comprises caprylic capric triglyceride, squalane and jojoba oil.