CN116211766A

CN116211766A - Black tea fermentation product and application thereof

Info

Publication number: CN116211766A
Application number: CN202310122547.8A
Authority: CN
Inventors: 蒲思凯; 陈月云; 梁敏婷; 郑晓旻; 吴清霞; 杨勇; 黄铭琳
Original assignee: Xianting Guangzhou Technology R & D Co ltd
Current assignee: Xianting Guangzhou Technology R & D Co ltd
Priority date: 2023-02-14
Filing date: 2023-02-14
Publication date: 2023-06-06

Abstract

The invention belongs to the technical field of A61K, and particularly relates to a black tea fermentation product and application thereof; black tea fermentation product, the preparation raw materials include: fermenting substrate, zymophyte and polyalcohol; the flavonoid substances, the polyphenol substances, the organic acid and the like contained in the fermented black tea fermentation product can be more easily loaded in the double-helix structure, meanwhile, because of the existence of carbomer sodium, strong interaction is formed, the slow release effect of the black tea fermentation product is ensured, and when the black tea fermentation product is used in a mask, active ingredients can be in a slow absorption state in the use process, so that the absorption of the active ingredients on the skin surface is promoted.

Description

Black tea fermentation product and application thereof

Technical Field

The invention belongs to the technical field of A61K, and particularly relates to a black tea fermentation product and application thereof.

Background

The black tea fermentation product has a large application prospect, is used in the fields of beverages and cosmetics at present, is prepared by interaction of different microorganisms, and can fully exert the effects of polyphenols, organic acids and vitamins in specific use. In addition, the application of the composition in cosmetics can increase bioavailability, promote the effective components in the composition to better coexist with skin, and avoid causing skin sensitivity.

The Chinese patent application No. 201911215663.4 discloses a preparation method and application of a cosmetic raw material containing Kang Pucha, wherein the cosmetic raw material disclosed in the published patent comprises Kang Pucha stock solution, 1, 2-hexanediol and p-hydroxyacetophenone, and the scheme disclosed in the published patent realizes improvement of skin quality and metabolism promotion of the prepared product.

In the face of more and more products like the black tea-containing fermented products in the market, the use amount of the black tea-containing fermented products and the effect of the black tea-containing fermented products in skin care products such as face cream, facial masks and the like are an important challenge for researchers at present.

Disclosure of Invention

In order to solve the technical problems, further optimize the application effect of the black tea fermentation product in cosmetics, the first aspect of the application provides a black tea fermentation product, which is prepared from the following raw materials: fermenting substrate, zymophyte and polyalcohol;

the fermentation substrate comprises black tea filtrate.

In some preferred embodiments, the fermentation substrate further comprises a carbohydrate.

Further preferably, the weight ratio of the black tea filtrate to the sugar substance is 20:1.

further preferably, the implementation mode of the black tea filtrate is as follows: soaking 30-60 g black tea in 1 liter of hot water of 92-98 ℃ (water is boiled to 100 ℃ and then is dried to a target temperature) for 5-15 minutes, filtering and adding sugar substances to obtain the black tea.

Further preferably, the fermentation bacteria include at least one of yeast, acetic acid bacteria and lactobacillus.

Further preferably, the fermentation bacteria are saccharomycetes, acetic acid bacteria and lactobacillus; still more preferably, the weight ratio of yeast, acetic acid bacteria and lactobacillus is (5-10): (4-6): 1.

further preferably, the saccharomycete is Saccharomyces boulardii, and the concentration of the saccharomycete in the fermentation liquor is 300-400 cfu/g.

Further preferably, the acetic acid bacteria are acetobacter pasteurii, and the concentration of the acetic acid bacteria in the fermentation liquor is 30-60 cfu/g.

Further preferably, the lactobacillus is lactobacillus plantarum, and the concentration of the lactobacillus plantarum in the fermentation liquor is 200-300 cfu/g.

In some preferred embodiments, the polyol is 1, 3-propanediol.

The saccharide in the present application is preferably sucrose, and there is no limitation on the kind and brand of sucrose.

Black tea fermentation products referred to in this application are derived from the company, ceramium, guangzhou trade, inc.

In some preferred embodiments, the black tea fermentation product is prepared by the process of:

s1, preparing black tea filtrate;

s2, fermenting: inoculating symbiotic strains, specifically saccharomycetes (the concentration of which is 350cfu/g in fermentation liquor), lactobacillus (the concentration of which is 50cfu/g in fermentation liquor), acetic acid bacteria (the concentration of which is 250cfu/g in fermentation liquor), and uniformly stirring, fermenting at room temperature (15-40 ℃) for 15-35 days to obtain fermentation liquor;

s3, filtering the fermentation liquor, and performing high-temperature cooking sterilization (at 50-70 ℃ for 30-50 min) to obtain a sterilized fermentation product;

s4, mixing the sterilized fermentation product with polyol according to the weight ratio of (5-10): and (1-5) mixing to obtain a finished product of the black tea fermentation product.

In a second aspect the invention provides the use of a black tea fermentation product in cosmetics.

Further preferably, the black tea fermentation product is mainly used in face cream, facial mask, skin care water, essence and emulsion.

In some preferred embodiments, the raw materials for preparing the face cream at least comprise black tea fermentation products, emulsifying agents, humectants and solvents; preferably, the black tea fermentation product is added in an amount of 0.5-5% by weight.

Further preferably, the black tea fermentation product is added in an amount of 2% by weight.

Further preferably, the emulsifier in the preparation raw materials of the face cream comprises cetostearyl alcohol, polyglycerol-10 stearate, polyglycerol-6 tristearate and hydroxypropyl guar.

Further preferably, the humectant comprises at least one of glycerin, betaine, and methyl propylene glycol.

Further preferably, the solvent in the raw materials for preparing the face cream comprises water.

Further preferably, the raw materials for preparing the face cream further comprise an emollient, a preservative and a thickener.

Further preferred, the emollient comprises at least one of caprylic/capric triglyceride, white pool (LIMNANTHES ALBA) seed oil, butter tree (BUTYROSPERMUM PARKII) fruit oil, hydrogenated olive oil composition, polydimethylsiloxane, hydrogenated polyisobutylene.

Further preferably, the preservative is a synthetic composition, and the preparation raw materials comprise butanediol, octanoyl hydroxamic acid, water, glycerol caprylate and p-hydroxyacetophenone.

Further preferably, the thickener is polyacrylate crosslinked polymer-6.

Further preferably, the raw materials for preparing the face cream also comprise essence.

In some preferred embodiments, the raw materials for preparing the mask at least comprise black tea fermentation products, thickening agents, sodium hyaluronate and functional aids; preferably, the black tea fermentation product is added in an amount of 0.1-2% by weight.

Further preferably, the black tea fermentation product is added in an amount of 0.5% by weight.

In some preferred embodiments, the thickening agent is xanthan gum and sodium carbomer; preferably, the weight ratio of the xanthan gum to the carbomer sodium is 1: (1-5).

The applicant finds that the effect of the black tea fermentation product in the mask can be greatly improved by adding the thickening agent in the system and ensuring that the thickening agent is xanthan gum and carbomer sodium, and the effect of the black tea fermentation product in the mask can be greatly improved by adding the thickening agent in the system through adding different contents of the black tea fermentation product, wherein the weight ratio of the xanthan gum to the carbomer sodium is 1: (1-5) the stability of the black tea fermentation product can be greatly improved, the reason why the phenomenon appears is presumed to be probably due to: the molecular chain of xanthan gum forms a rod-shaped double-helix structure in the system, flavonoid substances, polyphenol substances, organic acid and the like contained in the fermented black tea fermentation product can be more easily loaded in the double-helix structure, meanwhile, strong interaction is formed due to the existence of carbomer sodium, the slow release effect of the black tea fermentation product is ensured, and when the black tea fermentation product is used in a mask, active ingredients can be in a state of being slowly absorbed in the use process, so that the absorption of the active ingredients on the skin surface is promoted.

In some preferred embodiments, the functional auxiliary materials prepared in the facial mask comprise antibacterial and antiseptic components prepared from butanediol, octanoyl hydroxamic acid, water, glycerol octanoate, p-hydroxyacetophenone, PEG-40 hydrogenated castor oil, solvents and essence.

In some preferred embodiments, the raw materials for preparing the skin care lotion at least comprise black tea fermentation products, nutrient solution, sodium hyaluronate with molecular weight of 80-150 ten thousand and solvent.

Further preferably, the nutrient solution is prepared from inulin, water and alpha-glucan oligosaccharides.

Further preferably, the raw materials for preparing the skin care lotion further comprise functional components.

Further preferably, the preparation raw materials of the functional components include: water, lactobacillus/soybean milk fermentation product filtrate, butanediol, 1, 2-pentanediol.

In some preferred embodiments, the black tea fermentation product is added in an amount of 0.1 to 10% by weight.

Further preferably, the molecular weight of the sodium hyaluronate in the skin care water is 130 ten thousand.

Further preferably, the black tea fermentation product is added in an amount of 5% by weight.

The beneficial effects are that: the black tea fermentation product provided by the invention has the following advantages in a specific use process:

1. when the black tea fermentation product provided by the invention is used in a specific cosmetic, the black tea fermentation product is obtained by fermenting a plurality of strains, so that the bioavailability and the body recognition and effective treatment capacity of the components can be improved, the black tea fermentation product is ensured to be more symbiotic with skin when the black tea fermentation product is used in the cosmetic, and the components are unlikely to cause sensitivity in skin care application. Experiments show that the product prepared from the black tea fermentation product has a repairing effect on human keratinocytes at the concentration of 0.10%,0.03% and 0.015%, has a relieving effect on a damaged epidermis model, has the effect of up-regulating TJP1 gene expression and the epidermis barrier repairing effect, has excellent safety, and has no adverse reaction during use;

2. when the black tea fermentation product is applied to the mask, the effect of the black tea fermentation product in the mask can be greatly improved by adding the thickener and ensuring that the thickener is xanthan gum and carbomer sodium, and particularly, when the weight ratio of the xanthan gum to the carbomer sodium is 1: and (1-5), the stability of the black tea fermentation product can be greatly improved, the slow release effect of the black tea fermentation product is ensured, and when the black tea fermentation product is used in a facial mask, the active ingredients can be in a state of being slowly absorbed in the use process, so that the absorption of the active ingredients on the skin surface is promoted.

Drawings

FIG. 1. Results of cell relative activity test of example sample TA in an in vitro repair evaluation test;

FIG. 2 shows the results of the cell scratch test of the test group and the control group in the in vitro repair evaluation test;

FIG. 3. Cell images of cell scratch experiments in vitro repair evaluation tests;

FIG. 4 tissue activity evaluated for soothing efficacy in an in vitro skin model;

FIG. 5. Results of an in vitro skin epidermis thickness test;

FIG. 6. Skin tissue observations of in vitro skin model soothing efficacy assessment;

FIG. 7 shows the results of cell relative activity testing of example sample TA in a barrier repair test;

FIG. 8 TJP1 gene expression test results of example sample TA in a barrier repair test;

FIG. 9. Test area divisions for sample safety and efficacy tests;

FIG. 10 differential analysis of transepidermal water loss and heme content of the forearm flexor skin for sample safety and efficacy;

FIG. 11. Anti-wrinkle performance test results of application example 1;

FIG. 12. Anti-wrinkle performance test results of application example 2;

FIG. 13. Anti-wrinkle performance test results of application example 3;

FIG. 14 shows the result of the pore-shrinking performance test of application example 2;

FIG. 15 shows a melanin content bar graph, wherein the first is BC, the second is PC, and the third is a bar graph of sample results of the present application from the left;

FIG. 16 is a bar graph of results of tyrosinase inhibition assay, wherein the first is BC (none), the second is PC, and the third is a bar graph of sample results of the present application from the left.

Detailed Description

Examples

The embodiment provides a black tea fermentation product, which is prepared from the following raw materials: fermenting substrate, zymophyte and polyalcohol;

the fermentation substrate comprises black tea filtrate and sugar substances.

The weight ratio of the black tea filtrate to the sugar substances is 20:1.

the preparation method of the black tea filtrate comprises the following steps: 50g of black tea (Camellia sinensis) leaves are taken, soaked in 1 liter of hot water with the temperature of 95 ℃ (water is boiled to 100 ℃ and then is dried to 95 ℃) for 10 minutes, and sugar substances are added after filtration, so that the black tea is prepared for standby.

The saccharide is sucrose.

The fermentation bacteria are saccharomycetes, acetic acid bacteria and lactobacillus; the weight ratio of the saccharomycete, the acetic acid bacteria and the lactobacillus is 7:5:1.

The microzyme is Saccharomyces boulardii (SACCHAROMYCES BOULARDII).

The acetic acid bacteria are Acetobacter pasteurii (ACETOBACTER PASTEURIANUS).

The lactobacillus is lactobacillus plantarum (LACTOBACILLUS PLANTARUM).

The polyol is 1, 3-propanediol.

The preparation process of the black tea fermentation product comprises the following steps:

s1, preparing black tea filtrate;

s2, fermenting: inoculating symbiotic strain, specifically yeast (concentration in fermentation liquor)

350 cfu/g), lactobacillus (concentration 50cfu/g in fermentation broth), acetic acid bacteria (concentration in fermentation broth)

250 cfu/g), stirring uniformly, fermenting at room temperature (25 ℃) for 22 days to obtain fermentation liquor;

s3, filtering the fermentation liquor, and performing high-temperature cooking sterilization (60 ℃ for 40 min) to obtain a sterilized fermentation product;

s4, mixing the sterilized fermentation product with polyol according to the weight ratio of 7:3, and obtaining a finished product of the black tea fermentation product.

Application example 1

The application of black tea fermentation product in face cream is provided, and the composition of the face cream is shown in the table below.

The polyacrylate crosslinked polymer-6 is derived from SEPPIC (Sibirch), and the product name is SEPIMAX ZEN.

The glycerol is derived from SUMI ASIH (Malus, st.) and is available under the product name Glycerine USP.

The methyl propylene glycol is derived from SETHIC (mantane trade Co., guangzhou) and has the product name riddle OF.

The betaine is derived from DUPONT.

The composition of cetostearyl alcohol, polyglycerol-10 stearate, polyglycerol-6 tristearate and hydroxypropyl guar is derived from SETHIC (Xianting trade Co., guangzhou) and has the product name of a wonderful latex agent.

The caprylic/capric triglyceride is derived from Sasol (Sha Suo) and has the product name MIGLYOL812N.

The white pond flower (LIMNANTHES ALBA) seed oil is derived from SETHIC (mantis trade Co., ltd.) and has the product name pond flower seed oil.

The butter tree (BUTYROSPERMUM PARKII) was derived from Jarchem, USA, under the product name Jarplex SB35 (shea butter).

The composition of hydrogenated olive acid ethylhexyl ester and hydrogenated olive oil unsaponifiable matter is derived from SETHIC (mantel trade company, guangzhou) and has the product name of Uele curculigo.

The hydrogenated polyisobutene is derived from Konaiou and has the product name of synthesized squalane.

The polydimethylsiloxane was derived from DOWSIL (Tao Xi) and has the product name XIAMETER PMX-200Silicone Fluid 350cSt.

The composition of butanediol, octanoyl hydroxamic acid, water, glycerol octanoate and p-hydroxyacetophenone is derived from B & J (hundred-clean) and has the product name of Biocare GC-04.

The preparation method of the face cream comprises the following steps: mixing the phase A raw materials, heating to 80 ℃ and preserving heat; (2) mixing the raw materials of phase B, heating to 80 ℃ and preserving heat; (3) adding phase A into phase B, homogenizing for 4 minutes; (4) Stirring and cooling to 45 ℃, adding the phase C, and stirring uniformly to obtain the composite material.

Application example 2

The application of the black tea fermentation product is used in a facial mask, and the components of the facial mask are shown in the table below.

The xanthan gum is derived from Jungbunzlauer and has the product name of xanthan gum.

The carbomer sodium is derived from 3VSIGMA and has the product name PNC-400.

The sodium hyaluronate is derived from Furita, and specifically sodium hyaluronate (130 ten thousand).

The flavour is derived from Pending.

The PEG-40 hydrogenated castor oil is derived from BASF (Basf).

The preparation method of the mask comprises the following steps: s1, dispersing xanthan gum and PNC400 by using riddle alcohol OF and glycerin, adding sterilized water, heating to 60 ℃, and stirring until the system is completely dissolved; s2, cooling to 45 ℃, adding the rest raw materials, and stirring until the system is completely uniform.

Application example 3

The application of the black tea fermentation product is used in skin care water, and the ingredients of the skin care water are shown in the table below.

The nutrient solution is derived from Axialys (European Li Si) and the product name is biological nutrient solution.

The functional component is derived from Axialys (European patent Li Si) and has the product name of Orting allergy.

The preparation method of the skin care lotion comprises the following steps: wetting and mixing sodium hyaluronate with A-phase glycerin and methyl propylene glycol to obtain a mixed solution, adding the mixed solution into water under stirring, and stirring and dissolving uniformly;

adding the phase B raw material, and stirring uniformly.

Performance testing

1. In vitro repair evaluation test 1.1 test sample

a. Test group (TA): 0.4mL of the sample was added to 1.6mL of MEM medium to prepare a stock solution having a concentration of 20% (v/v). And then diluted sequentially with MEM medium to the test concentration.

b. Control group

Positive Control (PC): 1ng/mL EGF (epidermal growth factor)

Blank Control (BC): MEM medium containing 1% fetal bovine serum

1.2 principle of testing

Cells are inoculated on a multi-hollow culture plate and are adhered to and dispersed in the culture plate to form a single-layer cell layer. A vacuum zone free of cells was automatically prepared using a scratch pad to observe the condition of cell migration filling the zone. After the corresponding test sample was added to the cell culture plate, analysis was observed at 12 hours, 24 hours, and migration and proliferation conditions of cells were recorded, thereby evaluating the repair performance of the product.

1.3 Experimental materials and test procedure

1.3.1 Experimental materials

(1) Cell line: human keratinocyte (HaCaT)

(2) Complete culture solution: MEM medium (3) maintenance medium containing 10% fetal bovine serum: MEM medium (4) MTT solution containing 1% fetal bovine serum: MTT was formulated with PBS as a stock solution of MTT at a concentration of 5mg/mL, sterilized by filtration using a 0.22 μm syringe filter, stored at-20 ℃ (5) test conditions: incubator temperature 37+ -1deg.C, humidity 90+ -5%, CO ₂ 5±1％

Note that: MEM medium: minimal essential medium; MTT: thiazole blue; PBS: phosphate buffered saline.

1.3.2 Experimental procedure

1.3.2.1 cytotoxicity screening

(1) Cells were routinely cultured. The density of the preparation is 0.7 to 1.0X10 ⁵ Each/mL of the cell suspension was inoculated into a 96-well cell culture plate, 100. Mu.L per well, and cultured for 18-24 hours.

(2) The original culture solution in the wells is discarded, 100 mu L of test samples with different concentrations are added to each well, and the mixture is returned to the incubator for incubation for 24+/-1 hours.

(3) The plates were removed and 20. Mu.L MTT solution was added to each well and incubated in an incubator for 3-4 hours. The liquid in the wells was removed, 100. Mu.L of DMSO was added to each well, and after shaking for 10-15min with a shaker, absorbance was measured at 570nm wavelength with an ELISA reader.

1.3.2.2 cell scratch test

(1) Conventionally culturing cells, and adjusting the cell density to 3.0-7.0X10 ⁵ Each mL was seeded with 70. Mu.L of 24 well cell culture plates with 2 well inserts and returned to the incubator for 18-24 hours until cell fusion.

(2) The culture inserts in the plates were carefully removed with forceps and a flat cell-free area was formed between the 2 wells of the culture inserts. The cell layer was washed 3 times with phosphate buffer to remove exfoliated cells.

(3) 1mL of culture medium containing test samples at different concentrations was added to each well, while images were collected under a mirror, recorded as 0 hours, and the collected locations were marked.

(4) Every 12 hours, pictures were taken at the same location of the mark, recorded as 12 hours and 24 hours.

The test groups are as follows.

Group of	Culture conditions
		Blank control group (BC)	Maintenance medium
Positive control group (PC)	Maintenance medium containing 1ng/mL EGF
		Sample set to be Tested (TA)	Maintenance medium containing 3 concentration samples

1.4 test results

1.4.1 results of cell relative Activity test

Example results of cell relative activity test after TA uptake are shown in figure 1.

1.4.2 cell scratch test results

The results of the cell scratch test for the test group and the control group are shown in the following table, the bar graph is shown in fig. 2, and the cell image of the cell scratch test is shown in fig. 3.

Relative area size of scratches of different groups (%)

Comparison of scratch relative area of different groups

1.5 conclusion

As shown in fig. 1 to 3, the relative areas of scratches of the positive control group (PC) were significantly reduced and the differences were statistically significant at 12 hours compared to the blank control group (BC), and the relative areas of scratches were significantly reduced and the differences were statistically significant at concentrations of 0.10%,0.03%, and 0.015% in the examples. At 24 hours, the relative areas of scratches of the Positive Control (PC) were significantly reduced and the differences were statistically significant compared to the Blank (BC), and the example showed significantly reduced and the differences were statistically significant at concentrations of 0.10%,0.03%, 0.015%. These test results show that the samples prepared in the examples of the present application have a repairing effect on human keratinocytes at a concentration of 0.10%,0.03% and 0.015%.

2. In vitro skin model soothing efficacy evaluation (testing institution: guangzhou city Huadai biotechnology Co., ltd.)

2.1 test sample

a. Test group (TA): the examples were taken as test group samples.

b. Control group

Positive Control (PC): 1 μg/mL dexamethasone

Blank Control (BC): DPBS solution

2.2 principle of testing

The skin model is exposed to SDS to cause injury through an in-vitro skin model relieving test, a skin stimulating injury model is prepared, and after a test object is added, the relieving effect of the test object on the injured skin is evaluated through analysis of tissue activity, inflammatory factor change and histological observation of the skin model.

2.3 Experimental materials and test procedure

2.3.1 Experimental materials

(1) Detection kit: in vitro recombinant epidermis model (Skinovi-Epi)

(2) Culture conditions: 37 ℃,5 percent CO2 and 95 percent relative humidity

(3) Culture solution: human body external recombination epidermis model culture medium

(3) Tissue fixative: 4% neutral paraformaldehyde solution

(5) MTT solution: MTT was dissolved in PBS buffer to prepare a stock solution at a concentration of 5 mg/mL. Before use, the weight of the medicine is 1:4 was diluted with the culture medium to a final concentration of 1mg/mL.

(6) MTT analytical solution: isopropyl alcohol.

(7) Human IL-1 alpha ELISA kit

Note that: MTT: thiazole blue; PBS: phosphate buffered saline.

2.3.2 test procedure

(1) Skin model preparation: the pre-warmed maintenance medium was added to a 6-well plate (0.9 mL/well), and the skin model was transferred to the medium containing the maintenance medium and placed in an incubator for overnight incubation.

(2) Sample adding: the test samples were taken at 25 μl, uniformly smeared on the surface of the epidermis model, and after reaching the specified exposure time, the samples were thoroughly rinsed with DPBS until no residue was present, and then placed in fresh maintenance medium for continued incubation, or subject exposure was performed.

Note that: DPBS: du's phosphate buffer; SDS: sodium dodecyl sulfate; TA: sample of

(3) After a defined post-incubation time, 300. Mu.L of 1mg/ml MTT solution was added to each well of a 24-well plate, and the skin model of one well was transferred to the well plate and incubated in an incubator for 3 hours. After the MTT reaction is finished, the epidermis model is taken out, the bottom liquid is sucked up, the epidermis model is placed in a new 24-well plate, 2mL of isopropanol is added into each well, a sealing membrane is sealed, and the epidermis model is placed overnight at 4 ℃ in a dark place. 200. Mu.L of solution per tube was taken in 96-well plates and OD was read at 570 nm. Isopropanol was used as a blank.

(4) The skin model of the other well was removed from the epidermal tissue with a punch and transferred to a 2mL EP centrifuge tube, each tube was added with 2mL of neutral fixative and fixed at room temperature for at least 24 hours. After conventional embedding, sectioning, HE staining, the morphology was observed with a microscope.

(5) Collecting culture medium of each hole model, storing at-80deg.C, and measuring IL-1 with ELISA kit

Alpha content.

2.4 test results

2.4.1 results of cell relative Activity test

Examples samples were tested for tissue activity and skin thickness as shown in the following table, and bar graphs are shown in figures 4 and 5.

TABLE 2 tissue Activity results

* : compared to the model group, the differences were statistically significant (p < 0.05);

#: the differences compared to the control group were statistically significant (p < 0.05)

Histological analysis results

2.4.2 cell scratch test results

The relative skin activities of the test and control groups are shown in the following table, and the tissue observation images are shown in fig. 7.

/>

2.5 conclusion

The results of the relaxation test of each group of samples on the in vitro recombinant 3D epidermis model are as follows:

1) The epidermis model showed a significant decrease in tissue activity and differences in statistical significance in comparison to the control group at 0.1% sds damage. The test substance is applied after 0.1% SDS injury, the tissue activity of the sample group is obviously improved compared with that of the model group, and the difference has statistical significance, so that the test substance has a relieving effect on the epidermis model after injury.

2) The epidermis model was significantly thinner and cell layers decreased compared to the control group under the 0.1% SDS injury. It is believed that 0.1% SDS had significant damage to the skin model. The test substance is applied after 0.1% SDS injury, the sample group has obviously improved epidermis thickness compared with the model group, and the difference has statistical significance, so that the test substance has a relieving effect on the injured epidermis model.

3) The epidermis model showed a significant increase in IL-1α content and the difference was statistically significant, suggesting successful modeling, compared to the control group, at 0.1% SDS injury. The IL-lα content was significantly reduced and the differences were statistically significant in the positive group compared to the model group. Compared with the model group, the IL-1 alpha content of the sample group is obviously reduced and the difference has statistical significance, which is reduced by 50.46%, and the test object is suggested to have a relieving effect on the injured epidermis model.

3. Barrier repair-HaCaT cell TJP1 Gene expression test (testing institution: guangzhou City Huayuan Biotech Co., ltd.)

3.1 test sample

a. Test group (TA): 20. Mu.L of the sample of example was taken, 1.98mL of the maintenance medium was added to prepare a stock solution having a concentration of 1.00% (v/v), and then the stock solution was diluted to the test concentration in sequence with the maintenance medium.

b. Control group

Positive Control (PC): 50ng/mL EGF

Negative Control (NC): MEM containing 1% (v/v) FBS

3.2 principle of testing

The effect of the sample on the expression of the TJP1 gene in keratinocytes was examined by an in vitro test to evaluate whether the sample had an epidermal barrier repair effect.

3.3 Experimental materials and test procedure

3.3.1 Experimental materials

(1) Cell line: human immortalized keratinocyte source: guangzhou customs technical center, passage number: 35

(2) Culture solution: MEM medium containing 10% FBS

(3) Test conditions: incubator temperature 37+ -1deg.C, humidity 90+ -5%, CO ₂ 5±1％

(4) PBS buffer solution containing 5% trehalose

(5) MTT solution: MTT was formulated into MTT stock solution at a concentration of 5mg/mL with PBS, and the stock solution was sterilized by filtration using a needle filter of 0.22. Mu.m, and stored at-20 ℃.

(6) TRIzol reagent

3.3.2 test procedure

3.3.2.1 cell Activity test

(1) Cells were routinely cultured. The density of the preparation is 0.8 to 1.0X10 ⁵ Each/mL of the cell suspension was inoculated into a 96-well cell culture plate, 100. Mu.L per well, and cultured for 18-24 hours.

(3) The plates were removed, 100. Mu.L of medium was added to each well, and 20. Mu.L of MTT solution was added thereto, and the incubator was incubated for 3-4 hours. The liquid in the wells was removed, 100. Mu.L of DMSO was added to each well, and after shaking for 10-15 minutes with a shaker, absorbance was measured at 570nm wavelength with an ELISA reader.

3.3.2.2TPJI Gene expression test

(1) Cells were routinely cultured. Preparation Density of 1.5X10 ⁵ Cell suspension per mL, cell suspension was inoculated in a 60mm cell culture dish, 3 mL/dish, and cultured for 18-24 hours.

(2) The original culture medium in the dishes was discarded, and the maintenance medium containing the test substances at different concentrations and the maintenance medium without the sample were added according to groups, 3 in parallel, and exposed for 24 hours.

Group of	Culture conditions
		Negative control group (NT)	Negative control group (NT) 1% FBS MEM
Positive control group (PC)	1% FBS MEM containing 50ng/mLEGF
		Sample set to be Tested (TA)	1% FBS MEM containing sample

Note that: EGF is an epidermal growth factor; MEM is the minimum necessary medium; FBS is fetal bovine serum; PBS as phosphate buffer solution

(3) Harvesting cells 1-5×10 ⁷ Transfer into a 1.5mL centrifuge tube, add 1mL Trizol, mix well, and stand at room temperature for 5 minutes. 0.2mL of chloroform was added thereto, the mixture was shaken for 15 seconds, and allowed to stand for 2 minutes. Centrifuge at 4℃for 12000 g.times.15 min, and collect the supernatant. 0.5mL of isopropyl alcohol was added, the liquid in the tube was gently mixed, and left to stand for 10 minutes. Centrifuge at 4℃for 12000 g.times.10 min, discard supernatant. 1mL of 75% ethanol was added and the precipitate was gently washed. The supernatant was discarded at 4℃and 7500 g.times.5 minutes. Air drying, adding proper amount of DEPC H ₂ O is dissolved.

(4) The primers were designed as follows:

nouns (noun)	Sequence(s)
		FQ54-TJP1(ZO1)	CGGGACTGTTGGTATTGGCTAGA
RQ54-TJP1(ZO1)	GGCCAGGGCCATAGTAAAGTTTG
		GAPDH-F	AATGACCCCTTCATTGAC
GAPDH-R	TCCACGACGTACTCAGCGC

(5) cDNA was synthesized by reverse transcription (20. Mu.L of the total system)

(6)qPCR

qPCR System, total 20. Mu.L

Template 1μL

Forward Primer(10μM)0.4μL

Reverse Primer(10μM)0.4μL

2xPerfecStar qPCR SuperMix 10μL

Nuclease-Water 8.2μL

qPCR amplification conditions (two-step method)

3.4.1 results of cell relative Activity test

Example sample cell relative activity test results are shown in figure 6.

3.4.2 TJP1 Gene expression test results

TJP1 gene expression tests for the test group and the control group are shown in the following table and fig. 8.

3.5 conclusion

Compared with a negative control group (NT), the positive control group (PC) has obviously up-regulated TJP1 expression quantity (p is less than 0.05), which indicates that the modeling is successful; compared with a negative control group, the TJP1 expression level of the sample of the example is obviously increased at the test concentration of 0.03%, and the difference has statistical significance, and has the effect of up-regulating the TJP1 gene expression and the epidermal barrier repairing effect.

4. Sample safety and efficacy (testing institution: laidepu detection technology Co., guangzhou)

Samples of the examples were taken for sample safety and efficacy testing.

4.1 product information and methods of use

Test product: cream samples containing 2% of examples

Test product use area: forearm flexor side

The specific application method of the test product comprises the following steps:

(1) The technician uses disposable latex finger stall to respectively test the samples according to (2.0+/-0.1) mg/cm according to the sample area setting of the random table ² Is uniformly coated in a single time in a designated test area.

(2) The same method of use was used in the placebo area, specifically placebo (no cream sample of example added, solvent make-up margin) and the test product was run in the placebo area.

Frequency and period of use: single use

Notice that: avoiding mutual contamination of the product between the test area and the tested area

4.2 subject

Number of subjects: planned recruitment and successful inclusion of 37 persons, eventually at least 30 effective data

Age of the subject: 18-60 years old

Sex of the subject: male or female

Subject inclusion criteria:

(1) A chinese healthy male or female subject between 18 and 60 years of age;

(2) The skin on the lateral side of the double forearm is smooth. Flat and skin-free;

(3) Obvious erythema with stronger consistency can appear after 3% SLS patch test;

(4) Cosmetics, health products, medicines or other types of products which have the same effects as the test products, such as relieving and repairing effects, are not used at the tested part except the test products during the test;

(5) Chinese can be read, and can be accurately understood, and a test informed consent form is signed;

(6) Can be matched with and participate in the return visit time of the test, and timely reflect the health condition of the patient or any change of the medicine, and adverse reaction symptoms.

Subject exclusion criteria:

(1) Women currently in lactation or gestation, or women planning pregnancy in the future 2 months;

(2) Skin at the tested part has obvious sunburn, scar, pigmented nevus and multiple hairs or other people possibly affecting test measurement results;

(3) The skin of the tested part has bacterial infection, virus or fungus infection;

(4) Patients with chronic skin diseases (such as skin tumor, rosacea, eczema, lupus erythematosus, seborrheic dermatitis, psoriasis, severe epidermis abscission, etc.);

(5) There is a history of immunosuppression or immunodeficiency disorders (including HIV or AIDS), or immunosuppression drugs or radiation therapy is currently used;

(6) Chronic diseases and endocrine diseases such as asthma, epilepsy, diabetes, hypertension, hyperthyroidism or hypothyroidism;

(7) Other clinical trials were enrolled within 3 months;

(8) Any drug that may affect the skin condition or response, such as antihistamines, antibiotics, insulin, anti-inflammatory drugs, vitamin a, steroid drugs, aspirin, thyroid drugs, etc., is used in the past 6 months or is currently being used;

(9) The tested part is subjected to medical treatment such as laser treatment, chemical stripping and other cosmetic treatment, and botulinum and other minimally invasive cosmetic treatment within 6 months;

(10) Those diagnosed with allergy or other known or suspected allergic reactions (systemic, inhaled or topical), with a history of sensitivity to the ingredients of the formulation;

(11) According to the judgment of the test mechanism, other lesions or conditions which reduce the possibility of entering a group or complicate the entering of the group are provided, such as the conditions of frequent change of working environment, unstable living environment and the like which are easy to cause visit; alcoholism and/or psychoactive substances, substance abusers and dependents.

(12) A person with a history of mental illness or a failure to self-care.

4.3 test parameters and instruments

Through the test, the difference analysis of the transepidermal water loss rate and heme content of the forearm flexor skin is shown in fig. 10, and no adverse reaction is seen in the test process.

The clinical efficacy test results show that:

1) After application of the test product, the forearm flexor skin transepidermal water loss rate of the test product group subjects was at D0T ₃₀ min、D0T ₆₀ min and D0T _8h The return visit shows a significant decrease trend and is at D0T ₃₀ min、D0T ₆₀ min and D0T _8h At the return visit, the change of the forearm flexor side skin trans-epidermal water loss rate of the test product group subjects is obviously superior to that of a placebo control group, which indicates that the test product has the repairing effect and can improve the skin barrier function under the test condition.

2) After application of the test product, the test product component subjects had a forearm flexor skin heme content of D0T ₃₀ min、D0T ₆₀ min and D0T _8h The return visit shows a significant decrease trend and is at D0T ₃₀ min、D0T ₆₀ min and D0T _8h On return visit, the change of the skin heme amount of the forearm flexor side of the test product composition subjects is obviously superior to that of the placebo control group, which indicates that the test product has a soothing effect under the test condition and can reduce the skin heme.

3) Under the test conditions, no adverse reaction was seen in the subjects as assessed by the dermatologist.

5. Anti-wrinkle and pore-shrinking test

(1) Anti-wrinkle test

Respectively taking the products of application examples 1-3 to carry out anti-wrinkle test, wherein the face cream (application example 1) is used for 2 times per day and is continuously used for 4 weeks; the mask (application example 2) was used 2 times per week for 4 weeks; skin care lotion (application example 3) was applied around the eyes for 6 hours; the test results are shown in figures 10-12 respectively, and can be seen to obviously improve the ability of removing fine lines and smoothing wrinkles of creams, masks and skin lotions containing black tea fermentation products.

(2) Pore shrinking test

The mask prepared in application example 2 was used 2 times per week for 4 weeks continuously, and the change of cheek pores was observed, and the test results are shown in fig. 14.

6. Whitening test:

A. melanin content test

(1) Test materials

The cells used in this test were human melanocytes.

(2) Main reagent

DF-12 culture solution, DMSO, PBS, melanin standard, L-DOPA standard, sodium hydroxide, absolute ethyl alcohol, diethyl ether), ammonia water, glabridin, kojic acid and BCA kit

(3) Test method

1) Inoculating: cells were seeded at a seeding density of 2×105 cells/well in 6-well plates and incubated overnight in an incubator (37 ℃,5% co 2).

2) Preparing liquid: test article working fluids were prepared according to the specific test packet table below.

3) Administration: according to the test grouping of the table, when the cell plating rate in the 6-hole plate reaches 40% -60%, grouping drug administration is carried out, the drug administration amount of each hole is 2mL, 3 compound holes are arranged in each group, the culture solution is incubated for 24 hours in an incubator (37 ℃ and 5% CO 2), and the culture solution is discarded after 24 hours, and PBS is washed for 1 time.

4) Cell digestion: melanocytes (700. Mu.L/well) were digested with 0.25% pancreatin, the reaction was stopped by adding stop solution at 37℃for 1-2min, and after pipetting the cells were collected into a 1.5mL centrifuge tube, centrifuged at 10000r/min for 10min, and the supernatant was discarded.

5) 200. Mu.L of distilled water, 500. Mu.L of absolute ethyl alcohol and 500. Mu.L of diethyl ether are sequentially added into a centrifuge tube, the mixture is fully and uniformly mixed, and then the mixture is left to stand at room temperature for 20min, centrifuged at 3000r/min for 5min, and the supernatant is discarded.

6) 1mL of a 1mol/L aqueous NaOH solution containing 10% DMSO was added, and the mixture was heated in a water bath at 80℃for 40min.

7) After the thermal incubation, 200 μl of supernatant was aspirated into the well of the well-labeled 96-well plate, OD was read at 405nm, and two replicates were tested on the 96-well plate for each model.

8) Results statistical analysis: graphPad Prism was used to map and the results were expressed as mean±sd. Comparisons between groups were performed using t-test statistical analysis. Statistical analysis was double tailed. P <0.05 was considered to have significant differences and P <0.01 was considered to have very significant differences.

(4) The results are shown in the following table, and the melanin content bar graph is shown in fig. 15.

Compared with the BC group, the melanin content of the PC group is obviously reduced, which proves that the positive control in the test is effective.

Compared with the BC group, the melanin content of the sample is obviously reduced at the concentration of 1% (v/v), and the inhibition rate is 31.34%.

B. Tyrosinase activity assay

(1) Test method

1) Inoculating: cells were seeded at a seeding density of 2.5X105 cells/well in 6-well plates and incubated overnight in an incubator (37 ℃,5% CO 2).

2) Preparing liquid: test article working fluids were prepared according to the test packet table below.

3) Administration: according to the test group in Table 3, when the cell plating rate in the 6-hole plate reaches 40% -50%, group administration is carried out, the administration amount of each hole is 2mL, and 3 compound holes are arranged in each group. The culture was continued at 37℃in a 5% CO2 incubator for 24 hours.

4) Collecting cells: after 24h incubation, 500. Mu.L of PBS was added to each well, and the cells were transferred to a 1.5mL centrifuge tube with a cell scraper and centrifuged at 6000rpm for 5min.

5) Lysing the cells: the PBS was discarded, 100. Mu.L of 0.5% sodium deoxycholate was added to each well to lyse the cells, lysed at 0℃for 1h,12000rpm, and centrifuged at 4℃for 20min, and the supernatant was transferred to a 1.5mL centrifuge tube.

6) Protein quantification: protein quantification was performed on all samples according to BCA kit instructions.

7) L-DOPA reaction: samples were added to the centrifuge tube in an amount of 90. Mu.L, with 10. Mu.L of 0.1% L-DOPA per tube.

8) OD value reading: at the time point of 60min, the absorbance of each sample was read at 475nm wavelength by the microplate reader.

9) Tyrosinase inhibition rate calculation formula: inhibition (%) =1- [ (sample 60min OD value-sample 0min OD value)/(control 60min OD value-control 0min OD value) ×100%.

(2) Test results

The results of tyrosinase activity inhibition rate are shown in the following table, and the bar graph of the detection results is shown in fig. 16:

compared with the BC group, the PC group has the function of obviously inhibiting the tyrosinase activity, which proves that the positive control in the test is effective.

Compared with the BC group, the tyrosinase activity inhibition rate of the sample is 63.95% at the concentration of 1% (v/v).

Claims

1. A black tea fermentation product, characterized in that the preparation raw materials comprise: fermenting substrate, zymophyte and polyalcohol;

the fermentation substrate comprises black tea filtrate.

2. A black tea fermentation product according to claim 1 wherein the fermentation substrate further comprises a carbohydrate.

3. A black tea fermentation product according to claim 1 or claim 2 wherein the fermentation bacteria comprise at least one of yeasts, acetic acid bacteria and lactobacillus.

4. Use of a black tea fermentation product according to any one of claims 1 to 3 for use in cosmetics.

5. Use of a black tea fermentation product according to claim 4 wherein the cosmetic comprises at least a cream, a mask, a lotion, an essence, an emulsion.

6. Use of a black tea fermentation product according to claim 5 wherein the raw materials for the preparation of the cream comprise at least the black tea fermentation product, an emulsifier, a humectant, a solvent; preferably, the black tea fermentation product is added in an amount of 0.5-5% by weight.

7. The use of black tea fermentation products according to claim 5, wherein the raw materials for the preparation of the mask at least comprise black tea fermentation products, thickeners, sodium hyaluronate, functional aids; preferably, the black tea fermentation product is added in an amount of 0.1-2% by weight.

8. Use of a black tea fermentation product according to claim 7 wherein the thickening agents are xanthan gum and sodium carbomer; preferably, the weight ratio of the xanthan gum to the carbomer sodium is 1: (1-5).

9. Use of a black tea fermentation product according to claim 5 wherein the skin care lotion is prepared from at least black tea fermentation product, nutrient solution, sodium hyaluronate having a molecular weight of 80-150 ten thousand, and solvent.

10. Use of a black tea fermentation product according to claim 9 wherein the black tea fermentation product is added in an amount of from 0.1 to 10% by weight.