CN112760328A - Wheat TaB3-like-A gene and application thereof - Google Patents
Wheat TaB3-like-A gene and application thereof Download PDFInfo
- Publication number
- CN112760328A CN112760328A CN202110246349.3A CN202110246349A CN112760328A CN 112760328 A CN112760328 A CN 112760328A CN 202110246349 A CN202110246349 A CN 202110246349A CN 112760328 A CN112760328 A CN 112760328A
- Authority
- CN
- China
- Prior art keywords
- wheat
- ser
- arg
- gene
- asp
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/415—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from plants
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
- C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Genetics & Genomics (AREA)
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Molecular Biology (AREA)
- Engineering & Computer Science (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Biophysics (AREA)
- Biotechnology (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Biomedical Technology (AREA)
- Biochemistry (AREA)
- Wood Science & Technology (AREA)
- Zoology (AREA)
- Physics & Mathematics (AREA)
- Microbiology (AREA)
- Plant Pathology (AREA)
- Cell Biology (AREA)
- Botany (AREA)
- Gastroenterology & Hepatology (AREA)
- Medicinal Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
- Peptides Or Proteins (AREA)
Abstract
The invention belongs to the technical field of crop molecular biology and discloses a wheat TaB3-like-A gene and application thereof, wherein the wheat TaB3-like-A gene is located on a first wheat homologous group, the sequence of a wheat 1A homologous chromosome is shown as SEQ ID No.1, the sequence of a wheat 1B homologous chromosome is shown as SEQ ID No.2, and the sequence of a wheat 1D homologous chromosome is shown as SEQ ID No. 3. Experiments of the invention find that after wheat B3-like-A gene mutation, the plant height of the plant is obviously reduced. The wheat TaB3-like-A gene can be widely applied to the fields of wheat genetic breeding, germplasm resource improvement and plant cultivation and editing of the TaB3-like gene, and plays an important role in improving and modifying the germplasm resources of crops such as wheat.
Description
Technical Field
The invention belongs to the technical field of crop molecular biology, and relates to a wheat TaB3-like-A gene and application thereof, in particular to a sequence of the wheat TaB3-like-A gene, a phenotype of a B3-like-A gene mutation plant induced by EMS, and application of the TaB3-like-A gene in plant height regulation and control.
Background
Wheat is currently an important food crop in the world, and is also the staple food for people above about 1/3 worldwide. In recent years, China has become the largest wheat producing and consuming countries in the world, so that the yield of wheat is closely related to the national food safety. With the increase of population, the reduction of arable land area and the increase of production cost, how to increase the wheat yield to ensure the grain safety becomes an urgent problem to be solved. In the 70 s of the 20 th century, the green revolution dominated by the utilization of the semi-dwarf gene of wheat brings great increase to the global wheat yield, shows that the plant height of wheat has important influence on the formation of the yield, researches on the genetic law of plant height development are helpful for understanding the action mechanism of yield formation, and has important significance for breeding lodging-resistant and high-yield varieties by utilizing the plant height gene and further improving the yield of wheat.
The B3 gene family is a large family of transcription factors that are unique to plants and widely found in plants. The B3 gene family can be divided into 5 subfamilies according to its structural and functional characteristics: the ARF family, ABI3 family, HIS family, RAV and REM subfamilies, which play important roles in regulating plant growth and development, organ morphogenesis, flower bud differentiation and responding to various adversity stresses. At present, 118B 3 transcription factors exist in Arabidopsis, 117B 3 transcription factors exist in rice, and 80B 3 transcription factors exist in sorghum. The B3 gene superfamily contains a conserved B3 domain that encodes a 110 amino acid protein, including 7 β folds and 2 α helices, and is ubiquitous in higher plant genomes. Wherein 7 beta-strands (B1-B7) are polymerized to form an open beta-barrel fold, and two alpha-helices are respectively embedded between the 2 nd, 3 rd and 5 th, 6 th strands of the beta-strands. This domain can act by chimerizing with the major groove of DNA.
Currently, only less than 20% of the genes of the B3 superfamily in arabidopsis have been reported experimentally for functional aspects, and are mainly focused on the ARF family and the ABI3 family. Wherein, 23 members in the ARF family can respond to salt stress, and partial ARF family members participate in the processes of regulating embryo growth, seed development and the like. ABI3 is a key gene in an abscisic acid (ABA) signal transduction pathway, can respond to the action of ABA, and plays an important role in inhibiting cell elongation, influencing vascular differentiation, preventing cellulose synthesis, regulating stomatal opening and closing, responding to adversity stress and the like. Although partial B3 transcription factor function researches exist in wheat, the relation between the TaB3-like gene and the plant height is not reported, and the biological function and the molecular mechanism of the gene in influencing the wheat plant height are not clear.
The invention proves that the gene can obviously reduce the plant height reduction of wheat by the association of the A homologous chromosome gene of the TaB3-like gene and the plant height and the phenotype of the tetraploid mutant, and provides a basis for improving and researching the molecular mechanism of the gene influencing the plant height and the application.
Disclosure of Invention
Aiming at the problems in the prior art, the invention provides a wheat TaB3-like-A gene and application thereof.
The wheat TaB3-like-A gene is positioned on a first wheat homologous group, the sequence of the wheat TaB3-like-A gene on a wheat 1A homologous chromosome is shown as SEQ ID No.1, the sequence of the wheat TaB3-like-A gene on a wheat 1B homologous chromosome is shown as SEQ ID No.2, and the sequence of the wheat TaB3-like-A gene on a wheat 1D homologous chromosome is shown as SEQ ID No. 3; the protein sequences are respectively SEQ ID NO.4-SEQ ID NO. 6.
The invention also aims to provide application of the wheat TaB3-like-A gene in wheat breeding.
The invention also aims to provide application of the wheat TaB3-like-A gene in regulating plant height.
The invention also aims to provide application of the wheat TaB3-like-A gene in preparation of transgenic plants.
The invention also aims to provide application of the wheat TaB3-like-A gene in improvement of plant germplasm resources.
The invention also aims to provide application of the wheat TaB3-like-A gene in preparation of an expression inhibitor.
The invention also aims to provide application of the expression inhibitor of the wheat TaB3-like-A gene in reducing plant height.
By combining all the technical schemes, the invention has the advantages and positive effects that: the wheat TaB3-like-A gene and the application thereof provided by the invention capture DNA of a wheat core germplasm material through an exon to obtain the wheat TaB3-like-A gene related to a plant height SNP marker locus. The sequence of the coding region sequence of the TaB3-like gene in the A, B, D homologous chromosome is obtained through a wheat genome database. The mutation system of the missense mutation of the TaB3-like-A gene is selected to obtain the phenotype that the plant height is obviously reduced. The TaB3-like-A gene can regulate and control the plant height, and the plant height of the plant is obviously reduced after missense mutation of the gene.
The invention proves that the gene can obviously reduce the plant height reduction of wheat by the association of the A homologous chromosome gene of the TaB3-like gene and the plant height and the phenotype of the tetraploid mutant, and provides a basis for improving and researching the molecular mechanism of the gene influencing the plant height and the application. The invention provides a B3-like-A gene mutant plant, and the plant height of the plant is obviously reduced compared with that of a wild type.
The invention provides the biological functions of wheat TaB3-like-A gene and wheat B3-like-A gene in regulating and controlling the plant height of wheat, and experiments show that after the wheat B3-like-A gene is mutated, the plant height of the wheat is obviously reduced. The wheat TaB3-like-A gene can be widely applied to the fields of wheat genetic breeding, germplasm resource improvement and plant cultivation and editing of the TaB3-like gene, and plays an important role in improving and modifying the germplasm resources of crops such as wheat.
Drawings
In order to more clearly illustrate the technical solutions of the embodiments of the present invention, the drawings needed to be used in the embodiments of the present invention will be briefly described below, and it is obvious that the drawings described below are only some embodiments of the present invention, and it is obvious for those skilled in the art that other drawings can be obtained according to the drawings without creative efforts.
FIG. 1 is a schematic diagram of the expression of TaB3-like-A gene in different tissues according to the embodiment of the present invention.
FIG. 2 is a phenotypic schematic diagram of a B3-like-A gene mutant strain provided in the examples of the present invention.
Detailed Description
In order to make the objects, technical solutions and advantages of the present invention more apparent, the present invention is further described in detail with reference to the following embodiments. It should be understood that the specific embodiments described herein are merely illustrative of the invention and are not intended to limit the invention.
Aiming at the problems in the prior art, the invention provides a wheat TaB3-like-A gene and application thereof, and the invention is described in detail below with reference to the accompanying drawings.
The invention aims to provide a wheat TaB3-like-A gene and application thereof.
The invention provides application of SNP marker loci of wheat TaB3-like-A genes in association analysis. The gene sequences of TaB3-like genes on A, B, D homologous chromosomes are obtained in a hexaploid wheat Chinese spring genome database and are respectively shown as SEQ ID NO.1-3, and the genes are positioned on a first chromosome homologous group.
SEQ ID NO.1：
atggcgacggcggaggcgggcagcgccagcggcgcgggcgccgcctacgaggaggagcgccggaagcggatcctcgacaacctcaagcacctcgaggatttgggcatatcgaagatggccaagagcctgatccaggccacgaggcagcaggacaagacccctcgggcgagcccaaagtccaggaagaagttcgaggccaccactgaagtcaggcgctcctccagggccaggaccactgtttcctacaaggatgattttccggaacttgatgattttgtgcgccgcagaaggataagtaaaagtgtggacaatggtaggggatacactgggagaatttcttcttatcaacaacaacagcgtgcttttaaaagagctgagaaacttaaagatagtctagaccctgacaacccgtcgtttgtcaagaccatggttcgatcacatgtatccagctgcttttggcttggtctcccttctagtttctgcaaagatcatctgcctcccagagaacataagatggtgttggaggatgaagagggtgttgaatttgatgccgtatacatcggaaatcgaacaggtctgagtggtggatggagaggcttctcaatgcaccatgacttggaagatggggattcattggcctttgaattggctgaacctgacagatttaagatttacatttttaaagctatcgaagatggaaaagaggccgagcctaatgataagaatactgatgtggacagtgattcagcccaggaagttcctgaccagacggattcacctgtttctgaacccccttccagccctgaacctctaaaaggagctaaaagaagaaagctcccttccagccctgaacctctaaaaggagctaaaagaagaaagctccgtgggcgacggtag
SEQ ID NO.2：
atggcgacggcggaggcgagcagcgccagcggcgcgggcgccgcctacgaggaggagcgccggaagcggatcctcgacaacctcaagcacctcgaggatttgggcatatcgaagatggccaagagcctgatccaggccacgaggcagcaggacaagactcctcgggcgagcccaaagtccaggaagaagttcgaggctaccaccgaagtcaggcgctcctccagggccaggaccactgtttcctacaaggatgattttcccgaacttgatgattttgtgcgccgcagaagggtaagtaaaagtgtggacaatggtaggggatacaccgggagaatttcttcttatcaacaacaacagcgtgcttttaaaagagctgagaaacttcaagatagtctagaccctgacaacccgtcgtttgtcaagaccatggttcgatcacatgtatccagctgcttttggcttggtctcccttctagtttctgcaaagatcatctgcctcccagagaacataagatggtgttggaggatgaagaaggtgttgaatttgatgctgtatacatcggaaatcgaacaggtctgagtggtggatggagaggcttctcgatgcaccatgacttggaagatggggactcattggtctttgaattggctgagcctgacagatttaagatttacatttctaaagctatcgaagatggaaaagaggctgagcctaatgataagaatgctgatgtggacagtgattcagcccaggaagttcctgaccagacggattcacctgtttctgaacccccttccagccctgagcctctaaaaggagctaaaagaagaaaactccgtgggcgacggtag
SEQ ID NO.3：
atggcgacggcggaggcgggcagcgccagcggcgcgggcgccgcctacgaggaggagcgccagaagcggatccttgacaacctcaagcacctcgaggatttgggcatatcgaagatggccaagagcctgatccaggccacgaggcagcagcacaagatccctcgggcgagcccaaagtccaggaagaagttcgaggccaccactgaagtcaggcgctcctccagggccaggaccaccgtttcctacaaggacgattttcccgaactcgatgatttcgtgcgccgcagaagggtaagtaaaagtgtgcacagtggtaggggatacaccgggagaatttcttcttatcaacaacaacagcgtgcttttaaaagagctgagaaacttcaagatagtctagaccctgacaacccgtcgtttgtcaagaccatggttcgatcacatgtatccagctgcttttggcttggtctcccttctagtttctgcaaagatcatctgcctcccagagaacataagatggtgttggaggatgaagagggtgttgaatttgatgccgtatacatcggaaatcgaacaggtctgagtggtggatggagaggcttctcgatgcaccacgacttggaagatggggattcattggtcttcgaattggctgagcctgacagatttaagatttacatttttaaagctatcgaagatggaaaagaggccgagcctaatgataataatgctgatgtggacagtgattcagcccaggaagttcctgaccagacggattcacctgtttctgaacccccttccagccctgaacctctaaaaggagctaaaagaagaaagctccgtgggcgacggtag
The protein sequence of the TaB3-like-A gene of wheat provided by the invention is SEQ ID NO.4-SEQ ID NO. 6.
SEQ ID NO.4>TraesCS1A02G302700
Met Ala Thr Ala Glu Ala Gly Ser Ala Ser Gly Ala Gly Ala Ala Tyr
Glu Glu Glu Arg Arg Lys Arg Ile Leu Asp Asn Leu Lys His Leu Glu
Asp Leu Gly Ile Ser Lys Met Ala Lys Ser Leu Ile Gln Ala Thr Arg
Gln Gln Asp Lys Thr Pro Arg Ala Ser Pro Lys Ser Arg Lys Lys Phe
Glu Ala Thr Thr Glu Val Arg Arg Ser Ser Arg Ala Arg Thr Thr Val
Ser Tyr Lys Asp Asp Phe Pro Glu Leu Asp Asp Phe Val Arg Arg Arg
Arg Ile Ser Lys Ser Val Asp Asn Gly Arg Gly Tyr Thr Gly Arg Ile
Ser Ser Tyr Gln Gln Gln Gln Arg Ala Phe Lys Arg Ala Glu Lys Leu
Lys Asp Ser Leu Asp Pro Asp Asn Pro Ser Phe Val Lys Thr Met Val
Arg Ser His Val Ser Ser Cys Phe Trp Leu Gly Leu Pro Ser Ser Phe
Cys Lys Asp His Leu Pro Pro Arg Glu His Lys Met Val Leu Glu Asp
Glu Glu Gly Val Glu Phe Asp Ala Val Tyr Ile Gly Asn Arg Thr Gly
Leu Ser Gly Gly Trp Arg Gly Phe Ser Met His His Asp Leu Glu Asp
Gly Asp Ser Leu Ala Phe Glu Leu Ala Glu Pro Asp Arg Phe Lys Ile
Tyr Ile Phe Lys Ala Ile Glu Asp Gly Lys Glu Ala Glu Pro Asn Asp
Lys Asn Thr Asp Val Asp Ser Asp Ser Ala Gln Glu Val Pro Asp Gln
Thr Asp Ser Pro Val Ser Glu Pro Pro Ser Ser Pro Glu Pro Leu Lys
Gly Ala Lys Arg Arg Lys Leu Pro Ser Ser Pro Glu Pro Leu Lys Gly
Ala Lys Arg Arg Lys Leu Arg Gly Arg Arg
SEQ ID NO.5>TraesCS1B02G312900
Met Ala Thr Ala Glu Ala Ser Ser Ala Ser Gly Ala Gly Ala Ala Tyr
Glu Glu Glu Arg Arg Lys Arg Ile Leu Asp Asn Leu Lys His Leu Glu
Asp Leu Gly Ile Ser Lys Met Ala Lys Ser Leu Ile Gln Ala Thr Arg
Gln Gln Asp Lys Thr Pro Arg Ala Ser Pro Lys Ser Arg Lys Lys Phe
Glu Ala Thr Thr Glu Val Arg Arg Ser Ser Arg Ala Arg Thr Thr Val
Ser Tyr Lys Asp Asp Phe Pro Glu Leu Asp Asp Phe Val Arg Arg Arg
Arg Val Ser Lys Ser Val Asp Asn Gly Arg Gly Tyr Thr Gly Arg Ile
Ser Ser Tyr Gln Gln Gln Gln Arg Ala Phe Lys Arg Ala Glu Lys Leu
Gln Asp Ser Leu Asp Pro Asp Asn Pro Ser Phe Val Lys Thr Met Val
Arg Ser His Val Ser Ser Cys Phe Trp Leu Gly Leu Pro Ser Ser Phe
Cys Lys Asp His Leu Pro Pro Arg Glu His Lys Met Val Leu Glu Asp
Glu Glu Gly Val Glu Phe Asp Ala Val Tyr Ile Gly Asn Arg Thr Gly
Leu Ser Gly Gly Trp Arg Gly Phe Ser Met His His Asp Leu Glu Asp
Gly Asp Ser Leu Val Phe Glu Leu Ala Glu Pro Asp Arg Phe Lys Ile
Tyr Ile Ser Lys Ala Ile Glu Asp Gly Lys Glu Ala Glu Pro Asn Asp
Lys Asn Ala Asp Val Asp Ser Asp Ser Ala Gln Glu Val Pro Asp Gln
Thr Asp Ser Pro Val Ser Glu Pro Pro Ser Ser Pro Glu Pro Leu Lys
Gly Ala Lys Arg Arg Lys Leu Arg Gly Arg Arg
SEQ ID NO.6，>TraesCS1D02G302100
Met Ala Thr Ala Glu Ala Gly Ser Ala Ser Gly Ala Gly Ala Ala Tyr
Glu Glu Glu Arg Gln Lys Arg Ile Leu Asp Asn Leu Lys His Leu Glu
Asp Leu Gly Ile Ser Lys Met Ala Lys Ser Leu Ile Gln Ala Thr Arg
Gln Gln His Lys Ile Pro Arg Ala Ser Pro Lys Ser Arg Lys Lys Phe
Glu Ala Thr Thr Glu Val Arg Arg Ser Ser Arg Ala Arg Thr Thr Val
Ser Tyr Lys Asp Asp Phe Pro Glu Leu Asp Asp Phe Val Arg Arg Arg
Arg Val Ser Lys Ser Val His Ser Gly Arg Gly Tyr Thr Gly Arg Ile
Ser Ser Tyr Gln Gln Gln Gln Arg Ala Phe Lys Arg Ala Glu Lys Leu
Gln Asp Ser Leu Asp Pro Asp Asn Pro Ser Phe Val Lys Thr Met Val
Arg Ser His Val Ser Ser Cys Phe Trp Leu Gly Leu Pro Ser Ser Phe
Cys Lys Asp His Leu Pro Pro Arg Glu His Lys Met Val Leu Glu Asp
Glu Glu Gly Val Glu Phe Asp Ala Val Tyr Ile Gly Asn Arg Thr Gly
Leu Ser Gly Gly Trp Arg Gly Phe Ser Met His His Asp Leu Glu Asp
Gly Asp Ser Leu Val Phe Glu Leu Ala Glu Pro Asp Arg Phe Lys Ile
Tyr Ile Phe Lys Ala Ile Glu Asp Gly Lys Glu Ala Glu Pro Asn Asp
Asn Asn Ala Asp Val Asp Ser Asp Ser Ala Gln Glu Val Pro Asp Gln
Thr Asp Ser Pro Val Ser Glu Pro Pro Ser Ser Pro Glu Pro Leu Lys
Gly Ala Lys Arg Arg Lys Leu Arg Gly Arg Arg
The invention provides application of a wheat TaB3-like-A gene in regulating and controlling plant height.
Such plants include, but are not limited to, wheat.
Specifically, the wheat TaB3-like gene is located on a first wheat homologous group, the sequence of the gene on a wheat 1A homologous chromosome is shown as SEQ ID NO.1, the sequence of the gene on a wheat 1B homologous chromosome is shown as SEQ ID NO.2, and the sequence of the gene on a wheat 1D homologous chromosome is shown as SEQ ID NO. 3.
The invention provides a B3-like-A gene mutant plant, and the plant height of the plant is obviously reduced compared with that of a wild type.
The invention provides the biological functions of wheat TaB3-like-A gene and wheat B3-like-A gene in regulating and controlling the plant height of wheat, and experiments show that after the wheat B3-like-A gene is mutated, the plant height of the wheat is obviously reduced. The wheat TaB3-like-A gene can be widely applied to the fields of wheat genetic breeding, germplasm resource improvement and plant cultivation and editing of the TaB3-like gene, and plays an important role in improving and modifying the germplasm resources of crops such as wheat.
The technical solution of the present invention will be further described with reference to the following examples.
Example 1: genotyping of TaB3-like-A Gene in core germplasm Material
1. Wheat micro-core seed materials (105 parts of bred varieties and 157 parts of local varieties) distributed in different wheat areas in China are selected as the discovery materials of polymorphic SNP sites.
2. SNP for obtaining micro-core seed material by capturing exons
DNA of 262 parts of material was subjected to library construction and sequencing by using a Roche exon Capture Kit (SeqCap Pure Capture Bead Kit,06977952001, Roche), and the specific method is described in the Kit specification.
3. The genotype of the gene in 262 material was obtained by whole genome sequence alignment with BWA software, mutation detection and genotyping with GATK software.
Example 2: association analysis of TaB3-like-A gene SNP locus and plant height trait
The association analysis is carried out by using plant height phenotype data of 262 parts of micro-core seed materials of three-year three-point (Luo Yang Henan 2002, Luo Yang Henan 2005, Beijing 2006) in the plant height. The results of the association between the TaB3-like-A gene and the plant height are shown in Table 1, and it can be seen that the TaB3-like-A gene is significantly related to the SNP sites of the wheat material plant height trait.
TABLE 1 SNP sites with significant association of plant heights
Example 3: wheat TaB3-like-A gene sequence
According to the TravesCS 1A02G302700 gene number, the homologous gene numbers TravesCS 1B02G312900 and TravesCS 1D02G302100 are obtained by comparison on a wheat genome database website, and the gene sequences of the TaB3-like gene on A, B, D homologous chromosomes are obtained and are respectively shown as SEQ ID NO.1-3, and the gene is positioned on a first chromosome homologous group.
Example 4: expression of TaB3-like Gene
According to the gene number, the expression condition of the gene is inquired in a wheat transcriptome database, and the expression of the gene is shown in figure 1 and is higher in ears.
Example 5: phenotypic statistics of B3-like-A gene mutant
In order to verify that the function of the TaB3-like gene is related to plant height, the invention utilizes EMS mutagenesis library of tetraploid wheat to obtain a mutant of the gene A copy, and the specific information is shown in Table 2.
TABLE 2B 3-like-A Gene mutation information
The plant height of the mutant line Kronos2169 was significantly reduced compared to the wild-type Kronos plant height (see fig. 2), indicating that the B3-like-a gene was able to significantly reduce the plant height of wheat.
The above description is only for the purpose of illustrating the present invention and the appended claims are not to be construed as limiting the scope of the invention, which is intended to cover all modifications, equivalents and improvements that are within the spirit and scope of the invention as defined by the appended claims.
Sequence listing
<110> institute of crop science of Chinese academy of agricultural sciences
<120> wheat TaB3-like-A gene and application thereof
<160> 6
<170> SIPOSequenceListing 1.0
<210> 1
<211> 897
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 1
atggcgacgg cggaggcggg cagcgccagc ggcgcgggcg ccgcctacga ggaggagcgc 60
cggaagcgga tcctcgacaa cctcaagcac ctcgaggatt tgggcatatc gaagatggcc 120
aagagcctga tccaggccac gaggcagcag gacaagaccc ctcgggcgag cccaaagtcc 180
aggaagaagt tcgaggccac cactgaagtc aggcgctcct ccagggccag gaccactgtt 240
tcctacaagg atgattttcc ggaacttgat gattttgtgc gccgcagaag gataagtaaa 300
agtgtggaca atggtagggg atacactggg agaatttctt cttatcaaca acaacagcgt 360
gcttttaaaa gagctgagaa acttaaagat agtctagacc ctgacaaccc gtcgtttgtc 420
aagaccatgg ttcgatcaca tgtatccagc tgcttttggc ttggtctccc ttctagtttc 480
tgcaaagatc atctgcctcc cagagaacat aagatggtgt tggaggatga agagggtgtt 540
gaatttgatg ccgtatacat cggaaatcga acaggtctga gtggtggatg gagaggcttc 600
tcaatgcacc atgacttgga agatggggat tcattggcct ttgaattggc tgaacctgac 660
agatttaaga tttacatttt taaagctatc gaagatggaa aagaggccga gcctaatgat 720
aagaatactg atgtggacag tgattcagcc caggaagttc ctgaccagac ggattcacct 780
gtttctgaac ccccttccag ccctgaacct ctaaaaggag ctaaaagaag aaagctccct 840
tccagccctg aacctctaaa aggagctaaa agaagaaagc tccgtgggcg acggtag 897
<210> 2
<211> 852
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 2
atggcgacgg cggaggcgag cagcgccagc ggcgcgggcg ccgcctacga ggaggagcgc 60
cggaagcgga tcctcgacaa cctcaagcac ctcgaggatt tgggcatatc gaagatggcc 120
aagagcctga tccaggccac gaggcagcag gacaagactc ctcgggcgag cccaaagtcc 180
aggaagaagt tcgaggctac caccgaagtc aggcgctcct ccagggccag gaccactgtt 240
tcctacaagg atgattttcc cgaacttgat gattttgtgc gccgcagaag ggtaagtaaa 300
agtgtggaca atggtagggg atacaccggg agaatttctt cttatcaaca acaacagcgt 360
gcttttaaaa gagctgagaa acttcaagat agtctagacc ctgacaaccc gtcgtttgtc 420
aagaccatgg ttcgatcaca tgtatccagc tgcttttggc ttggtctccc ttctagtttc 480
tgcaaagatc atctgcctcc cagagaacat aagatggtgt tggaggatga agaaggtgtt 540
gaatttgatg ctgtatacat cggaaatcga acaggtctga gtggtggatg gagaggcttc 600
tcgatgcacc atgacttgga agatggggac tcattggtct ttgaattggc tgagcctgac 660
agatttaaga tttacatttc taaagctatc gaagatggaa aagaggctga gcctaatgat 720
aagaatgctg atgtggacag tgattcagcc caggaagttc ctgaccagac ggattcacct 780
gtttctgaac ccccttccag ccctgagcct ctaaaaggag ctaaaagaag aaaactccgt 840
gggcgacggt ag 852
<210> 3
<211> 852
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 3
atggcgacgg cggaggcggg cagcgccagc ggcgcgggcg ccgcctacga ggaggagcgc 60
cagaagcgga tccttgacaa cctcaagcac ctcgaggatt tgggcatatc gaagatggcc 120
aagagcctga tccaggccac gaggcagcag cacaagatcc ctcgggcgag cccaaagtcc 180
aggaagaagt tcgaggccac cactgaagtc aggcgctcct ccagggccag gaccaccgtt 240
tcctacaagg acgattttcc cgaactcgat gatttcgtgc gccgcagaag ggtaagtaaa 300
agtgtgcaca gtggtagggg atacaccggg agaatttctt cttatcaaca acaacagcgt 360
gcttttaaaa gagctgagaa acttcaagat agtctagacc ctgacaaccc gtcgtttgtc 420
aagaccatgg ttcgatcaca tgtatccagc tgcttttggc ttggtctccc ttctagtttc 480
tgcaaagatc atctgcctcc cagagaacat aagatggtgt tggaggatga agagggtgtt 540
gaatttgatg ccgtatacat cggaaatcga acaggtctga gtggtggatg gagaggcttc 600
tcgatgcacc acgacttgga agatggggat tcattggtct tcgaattggc tgagcctgac 660
agatttaaga tttacatttt taaagctatc gaagatggaa aagaggccga gcctaatgat 720
aataatgctg atgtggacag tgattcagcc caggaagttc ctgaccagac ggattcacct 780
gtttctgaac ccccttccag ccctgaacct ctaaaaggag ctaaaagaag aaagctccgt 840
gggcgacggt ag 852
<210> 4
<211> 298
<212> PRT
<213> Artificial Sequence (Artificial Sequence)
<400> 4
Met Ala Thr Ala Glu Ala Gly Ser Ala Ser Gly Ala Gly Ala Ala Tyr
1 5 10 15
Glu Glu Glu Arg Arg Lys Arg Ile Leu Asp Asn Leu Lys His Leu Glu
20 25 30
Asp Leu Gly Ile Ser Lys Met Ala Lys Ser Leu Ile Gln Ala Thr Arg
35 40 45
Gln Gln Asp Lys Thr Pro Arg Ala Ser Pro Lys Ser Arg Lys Lys Phe
50 55 60
Glu Ala Thr Thr Glu Val Arg Arg Ser Ser Arg Ala Arg Thr Thr Val
65 70 75 80
Ser Tyr Lys Asp Asp Phe Pro Glu Leu Asp Asp Phe Val Arg Arg Arg
85 90 95
Arg Ile Ser Lys Ser Val Asp Asn Gly Arg Gly Tyr Thr Gly Arg Ile
100 105 110
Ser Ser Tyr Gln Gln Gln Gln Arg Ala Phe Lys Arg Ala Glu Lys Leu
115 120 125
Lys Asp Ser Leu Asp Pro Asp Asn Pro Ser Phe Val Lys Thr Met Val
130 135 140
Arg Ser His Val Ser Ser Cys Phe Trp Leu Gly Leu Pro Ser Ser Phe
145 150 155 160
Cys Lys Asp His Leu Pro Pro Arg Glu His Lys Met Val Leu Glu Asp
165 170 175
Glu Glu Gly Val Glu Phe Asp Ala Val Tyr Ile Gly Asn Arg Thr Gly
180 185 190
Leu Ser Gly Gly Trp Arg Gly Phe Ser Met His His Asp Leu Glu Asp
195 200 205
Gly Asp Ser Leu Ala Phe Glu Leu Ala Glu Pro Asp Arg Phe Lys Ile
210 215 220
Tyr Ile Phe Lys Ala Ile Glu Asp Gly Lys Glu Ala Glu Pro Asn Asp
225 230 235 240
Lys Asn Thr Asp Val Asp Ser Asp Ser Ala Gln Glu Val Pro Asp Gln
245 250 255
Thr Asp Ser Pro Val Ser Glu Pro Pro Ser Ser Pro Glu Pro Leu Lys
260 265 270
Gly Ala Lys Arg Arg Lys Leu Pro Ser Ser Pro Glu Pro Leu Lys Gly
275 280 285
Ala Lys Arg Arg Lys Leu Arg Gly Arg Arg
290 295
<210> 5
<211> 283
<212> PRT
<213> Artificial Sequence (Artificial Sequence)
<400> 5
Met Ala Thr Ala Glu Ala Ser Ser Ala Ser Gly Ala Gly Ala Ala Tyr
1 5 10 15
Glu Glu Glu Arg Arg Lys Arg Ile Leu Asp Asn Leu Lys His Leu Glu
20 25 30
Asp Leu Gly Ile Ser Lys Met Ala Lys Ser Leu Ile Gln Ala Thr Arg
35 40 45
Gln Gln Asp Lys Thr Pro Arg Ala Ser Pro Lys Ser Arg Lys Lys Phe
50 55 60
Glu Ala Thr Thr Glu Val Arg Arg Ser Ser Arg Ala Arg Thr Thr Val
65 70 75 80
Ser Tyr Lys Asp Asp Phe Pro Glu Leu Asp Asp Phe Val Arg Arg Arg
85 90 95
Arg Val Ser Lys Ser Val Asp Asn Gly Arg Gly Tyr Thr Gly Arg Ile
100 105 110
Ser Ser Tyr Gln Gln Gln Gln Arg Ala Phe Lys Arg Ala Glu Lys Leu
115 120 125
Gln Asp Ser Leu Asp Pro Asp Asn Pro Ser Phe Val Lys Thr Met Val
130 135 140
Arg Ser His Val Ser Ser Cys Phe Trp Leu Gly Leu Pro Ser Ser Phe
145 150 155 160
Cys Lys Asp His Leu Pro Pro Arg Glu His Lys Met Val Leu Glu Asp
165 170 175
Glu Glu Gly Val Glu Phe Asp Ala Val Tyr Ile Gly Asn Arg Thr Gly
180 185 190
Leu Ser Gly Gly Trp Arg Gly Phe Ser Met His His Asp Leu Glu Asp
195 200 205
Gly Asp Ser Leu Val Phe Glu Leu Ala Glu Pro Asp Arg Phe Lys Ile
210 215 220
Tyr Ile Ser Lys Ala Ile Glu Asp Gly Lys Glu Ala Glu Pro Asn Asp
225 230 235 240
Lys Asn Ala Asp Val Asp Ser Asp Ser Ala Gln Glu Val Pro Asp Gln
245 250 255
Thr Asp Ser Pro Val Ser Glu Pro Pro Ser Ser Pro Glu Pro Leu Lys
260 265 270
Gly Ala Lys Arg Arg Lys Leu Arg Gly Arg Arg
275 280
<210> 6
<211> 283
<212> PRT
<213> Artificial Sequence (Artificial Sequence)
<400> 6
Met Ala Thr Ala Glu Ala Gly Ser Ala Ser Gly Ala Gly Ala Ala Tyr
1 5 10 15
Glu Glu Glu Arg Gln Lys Arg Ile Leu Asp Asn Leu Lys His Leu Glu
20 25 30
Asp Leu Gly Ile Ser Lys Met Ala Lys Ser Leu Ile Gln Ala Thr Arg
35 40 45
Gln Gln His Lys Ile Pro Arg Ala Ser Pro Lys Ser Arg Lys Lys Phe
50 55 60
Glu Ala Thr Thr Glu Val Arg Arg Ser Ser Arg Ala Arg Thr Thr Val
65 70 75 80
Ser Tyr Lys Asp Asp Phe Pro Glu Leu Asp Asp Phe Val Arg Arg Arg
85 90 95
Arg Val Ser Lys Ser Val His Ser Gly Arg Gly Tyr Thr Gly Arg Ile
100 105 110
Ser Ser Tyr Gln Gln Gln Gln Arg Ala Phe Lys Arg Ala Glu Lys Leu
115 120 125
Gln Asp Ser Leu Asp Pro Asp Asn Pro Ser Phe Val Lys Thr Met Val
130 135 140
Arg Ser His Val Ser Ser Cys Phe Trp Leu Gly Leu Pro Ser Ser Phe
145 150 155 160
Cys Lys Asp His Leu Pro Pro Arg Glu His Lys Met Val Leu Glu Asp
165 170 175
Glu Glu Gly Val Glu Phe Asp Ala Val Tyr Ile Gly Asn Arg Thr Gly
180 185 190
Leu Ser Gly Gly Trp Arg Gly Phe Ser Met His His Asp Leu Glu Asp
195 200 205
Gly Asp Ser Leu Val Phe Glu Leu Ala Glu Pro Asp Arg Phe Lys Ile
210 215 220
Tyr Ile Phe Lys Ala Ile Glu Asp Gly Lys Glu Ala Glu Pro Asn Asp
225 230 235 240
Asn Asn Ala Asp Val Asp Ser Asp Ser Ala Gln Glu Val Pro Asp Gln
245 250 255
Thr Asp Ser Pro Val Ser Glu Pro Pro Ser Ser Pro Glu Pro Leu Lys
260 265 270
Gly Ala Lys Arg Arg Lys Leu Arg Gly Arg Arg
275 280
Claims (7)
1. A wheat TaB3-like-A gene is characterized in that the wheat TaB3-like-A gene is located on a first wheat homologous group, the sequence of the wheat TaB3-like-A gene on a wheat 1A homologous chromosome is shown as SEQ ID No.1, the sequence of the wheat TaB3-like-A gene on a wheat 1B homologous chromosome is shown as SEQ ID No.2, and the sequence of the wheat TaB3-like-A gene on a wheat 1D homologous chromosome is shown as SEQ ID No. 3; the protein sequences are respectively SEQ ID NO.4-SEQ ID NO. 6.
2. Use of the wheat TaB3-like-A gene of claim 1 in wheat breeding.
3. The use of the wheat TaB3-like-A gene of claim 1 in regulating plant height.
4. Use of the wheat TaB3-like-A gene of claim 1 in the preparation of a transgenic plant.
5. The application of the wheat TaB3-like-A gene as defined in claim 1 in improvement of plant germplasm resources.
6. Use of the wheat TaB3-like-A gene of claim 1 in the preparation of an expression inhibitor.
7. Use of an inhibitor of expression of the wheat TaB3-like-A gene of claim 6 for reducing plant height.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202110246349.3A CN112760328B (en) | 2021-03-05 | 2021-03-05 | Wheat TaB3-like-A gene and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202110246349.3A CN112760328B (en) | 2021-03-05 | 2021-03-05 | Wheat TaB3-like-A gene and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN112760328A true CN112760328A (en) | 2021-05-07 |
| CN112760328B CN112760328B (en) | 2022-09-30 |
Family
ID=75690833
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202110246349.3A Active CN112760328B (en) | 2021-03-05 | 2021-03-05 | Wheat TaB3-like-A gene and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN112760328B (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN116218871A (en) * | 2023-01-18 | 2023-06-06 | 上海师范大学 | Gene PeNGA for regulating butterfly orchid leaf growth, virus plasmid, recombinant transformant and application |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106834338A (en) * | 2016-12-23 | 2017-06-13 | 青岛农业大学 | The expression vector of arabidopsis gene REM16 and its in the regulation and control interim application of plant blossom |
| CN110846323A (en) * | 2019-11-07 | 2020-02-28 | 中国农业科学院作物科学研究所 | Wheat TaARF12 gene and application thereof |
-
2021
- 2021-03-05 CN CN202110246349.3A patent/CN112760328B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106834338A (en) * | 2016-12-23 | 2017-06-13 | 青岛农业大学 | The expression vector of arabidopsis gene REM16 and its in the regulation and control interim application of plant blossom |
| CN110846323A (en) * | 2019-11-07 | 2020-02-28 | 中国农业科学院作物科学研究所 | Wheat TaARF12 gene and application thereof |
Non-Patent Citations (6)
| Title |
|---|
| CHRISTINE D. ZANKE等: "Whole Genome Association Mapping of Plant Height in Winter Wheat (Triticum aestivum L.)", 《PLOS ONE》 * |
| JINGYI WANG等: "TaARF4 genes are linked to root growth and plant height in wheat", 《ANNALS OF BOTANY》 * |
| NONE: "PREDICTED: Aegilops tauschii subsp. tauschii B3 domain-containing protein Os05g0481400 (LOC109743425), mRNA", 《NCBI REFERENCE SEQUENCE: XM_020302515.1》 * |
| NONE: "PREDICTED: Triticum dicoccoides B3 domain-containing protein Os05g0481400-like (LOC119284054), mRNA", 《NCBI REFERENCE SEQUENCE: XM_037563351.1》 * |
| NONE: "PREDICTED: Triticum dicoccoides B3 domain-containing protein Os05g0481400-like (LOC119348708), mRNA", 《NCBI REFERENCE SEQUENCE: XM_037616683.1》 * |
| 张红杰等: "CIMMYT 新引进合成小麦株高性状全基因组关联分析", 《植物遗传资源学报》 * |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN116218871A (en) * | 2023-01-18 | 2023-06-06 | 上海师范大学 | Gene PeNGA for regulating butterfly orchid leaf growth, virus plasmid, recombinant transformant and application |
Also Published As
| Publication number | Publication date |
|---|---|
| CN112760328B (en) | 2022-09-30 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN112390865B (en) | Application of Zm5008 gene in regulating and controlling plant height and internode distance of corn | |
| CN103451200A (en) | Molecular marker for controlling corn plant height and applications thereof | |
| CN112500463B (en) | Gene ZmCOL14 for controlling plant height and ear position height of corn and application thereof | |
| CN114990139B (en) | Application of CsHLS1 gene or protein encoded by same in regulation and control of organ size of cucumber plant | |
| CN112760328B (en) | Wheat TaB3-like-A gene and application thereof | |
| CN113004383B (en) | Application of corn gene ZmEREB102 in improving corn yield | |
| CN109721649A (en) | A kind of plant type of rice regulation related gene, protein and application | |
| CN108570474A (en) | Rice flower development gene EH1 and its application | |
| CN112574289B (en) | Application of wheat TaTFIIB gene in regulation of wheat plant height development | |
| CN114395580B (en) | Gene for controlling maize plant height | |
| CN112574288B (en) | Application of wheat TaFBX113 gene in regulation of grain thickness development | |
| CN111979233A (en) | Method for increasing rice grain type and application thereof | |
| CN114921583A (en) | QTL for controlling wheat plant height, candidate gene TaDHL-7B thereof and application | |
| CN112159464B (en) | Wheat TaSEP gene and application thereof in regulating growth and development | |
| CN114230648A (en) | Application of rice gene PANDA in improving plant yield | |
| CN114891826A (en) | Method for improving corn ear shape | |
| CN108342393B (en) | Mutant gene Oslrt1 for controlling lateral root-free character of rice, and detection and application thereof | |
| CN109161554B (en) | Regulatory gene of rice dwarf fragile-stem mutant DBC1 and application thereof | |
| CN109097390B (en) | Application of AtFKBP15 gene in regulating and controlling growth of lateral roots of arabidopsis thaliana | |
| CN111172171A (en) | Gene for controlling plant height and flowering phase of corn and application thereof | |
| CN112574287B (en) | Application of wheat TaC3HC4-like gene in regulation of wheat grain thickness development | |
| CN112608373B (en) | Application of wheat TaMYB1 gene in regulation and control of wheat plant height development | |
| CN112080481B (en) | Spike-type related gene OsFRS5 and application and phenotype recovery method thereof | |
| CN114940708B (en) | Application of OsPIL16 gene or protein thereof in regulating and controlling rice stem thickness | |
| CN112442115B (en) | Application of wheat TaPRR95-B protein or coding gene thereof in regulating and controlling plant height |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |