CN110846323A

CN110846323A - Wheat TaARF12 gene and application thereof

Info

Publication number: CN110846323A
Application number: CN201911081824.5A
Authority: CN
Inventors: 李爱丽; 王芳; 耿帅锋; 毛龙
Original assignee: Institute of Crop Sciences of Chinese Academy of Agricultural Sciences
Current assignee: Institute of Crop Sciences of Chinese Academy of Agricultural Sciences
Priority date: 2019-11-07
Filing date: 2019-11-07
Publication date: 2020-02-28
Anticipated expiration: 2039-11-07
Also published as: CN110846323B

Abstract

The invention provides a wheat TaARF12 gene and application thereof, belonging to the field of crop molecular biology. The invention designs a primer to clone a coding region sequence of TaARF12 from cDNA of young ears in spring of China, and the sequences of the coding region sequence of the TaARF12 gene in A, B, D homologous chromosomes are respectively shown in SEQ ID NO. 1-3. The invention selects a specific RNAi fragment of TaARF12, constructs an RNAi vector and converts the RNAi vector into Fielder. Meanwhile, a gene editing vector containing two target sites is constructed by using the CRISPR/Cas9 vector and the wild-type Fielder is transformed. The obtained RNAi transgenic line and the gene editing line have similar phenotypes and show that the plant height is shortened and the spike is lengthened. The wheat TaARF12 gene can regulate and control the height and the ear length of the plant, and the plant is shown to be dwarfed and the ear is increased after the gene is interfered to express.

Description

Wheat TaARF12 gene and application thereof

Technical Field

The invention relates to the field of crop molecular biology, in particular to cloning of a wheat TaARF12 gene, a construction method of a TaARF12 RNAi (RNA interference) vector, application of a CRISPR/Cas9-TaARF12 vector and application of a TaARF12 gene in regulation of plant height and spike length.

Background

Common wheat is an important food crop, and wheat is taken as a staple food in people with more than 1/3 all over the world. The wheat plant height and the wheat ear length have important influence on the yield formation, and the research on the development genetic rule of the wheat plant height and the wheat ear length is helpful for understanding the yield formation mechanism. In the 70 s of the 20 th century, the green revolution dominated by the utilization of the semi-dwarf gene of wheat brought great increase to the global wheat yield. The lodging resistance of wheat can be improved by reducing the plant height, and lodging-resistant, big ear and high yield varieties can be bred by fully utilizing the short stalk genes in breeding. The ear length is an important agronomic character of wheat, the ear length character of the wheat is closely related to three yield forming factors of the wheat, and longer ears provide possibility for increasing the number of small ears, the number of grains per ear and the thousand grain weight, thereby being beneficial to improving the yield of the wheat.

Auxin is a ubiquitous plant hormone in plants and plays an important role in the growth and development stages of plants such as apical dominance and root and stem morphogenesis. Auxin Response Factors (ARF) are a family of transcription factors that bind cis-response elements and mediate auxin signaling responses. The ARF protein comprises 3 conserved structural domains, an N-terminal B3 DNA binding structural domain and has the function of binding downstream genes; an intermediate Activation Domain (AD) and an inhibition domain (RD) that determine whether ARF exerts an activating or inhibitory effect; the CTD domain at the C-terminus determines the interaction of ARF with other proteins. At present, the research on ARF genes generally focuses on root systems, such as OsARF12, transcription activator of auxin response genes, and regulation of root elongation in rice. However, research on ARF genes in wheat has been rare so far, especially for functional research and production application of TaARF12 in wheat. Therefore, RNAi and knockout of TaARF12 in wheat are necessary, and the role of TaARF12 in wheat is deeply researched.

Disclosure of Invention

The invention aims to provide a wheat TaARF12 gene and application thereof.

The TaARF12 gene is amplified in the young ear of hexaploid wheat in Chinese spring to obtain a gene sequence on A, B, D homologous chromosomes, which are respectively shown as SEQ ID NO.1-3, and the gene is named as TaARF12 and is positioned on a second chromosome homologous group.

The invention provides application of a wheat TaARF12 gene in wheat breeding.

The invention provides application of a wheat TaARF12 gene in regulating and controlling plant height.

The invention provides application of a wheat TaARF12 gene in preparation of transgenic plants.

The invention provides application of a wheat TaARF12 gene in regulation of ear elongation.

The invention provides application of a wheat TaARF12 gene in improvement of plant germplasm resources.

Such plants include, but are not limited to, wheat.

Specifically, the wheat TaARF12 gene is located on a second wheat homologous group, the sequence of the wheat TaARF12 gene on a wheat 2A homologous chromosome is shown as SEQ ID NO.1, the sequence of the wheat 2B homologous chromosome is shown as SEQ ID NO.2, and the sequence of the wheat TaARF12 gene on a wheat 2D homologous chromosome is shown as SEQ ID NO. 3.

The invention provides a primer combination for cloning a wheat TaARF12 gene, and the nucleotide sequence of the primer combination is shown as SEQ ID NO. 4-5.

Correspondingly, the invention provides a cloning method of a wheat TaARF12 gene, which utilizes a specific primer combination shown in SEQ ID NO.4-5 and takes wheat spike cDNA as a template to obtain the wheat TaARF12 gene by PCR amplification.

The invention provides an RNAi fragment of a wheat TaARF12 gene, and the nucleotide sequence of the RNAi fragment is shown in SEQ ID NO. 12.

The invention provides an RNAi vector containing the RNAi fragment of the wheat TaARF12 gene.

The invention also provides a construction method of the wheat TaARF12 RNAi vector, which is constructed by the following method and comprises the following steps:

(1) carrying out PCR amplification by using SEQ ID NO.4-5 as a primer and Chinese spring young ear cDNA as a template, and recovering a PCR product for sequencing;

(2) using SEQ ID NO.6-7 as a primer and the correct sequencing plasmid of (1) as a template to perform PCR amplification, recovering a PCR product, and using SEQ ID NO.8 to perform sequencing;

(3) performing double enzyme digestion on the recovered product in the step (2) and the pWMB006 vector by using BamH I and Kpn I, recovering, and performing connecting sequencing;

(4) using SEQ ID NO.9-10 as a primer and the correct sequencing plasmid of (1) as a template to perform PCR amplification, recovering a PCR product, and using SEQ ID NO.11 to perform sequencing;

(5) carrying out double enzyme digestion on the recovered product in the step (4) and the vector successfully subjected to the ligation sequencing in the step (3) by using Sac I and Spe I, recovering, and then performing ligation sequencing to construct an intermediate vector pWMB006-TaARF 12;

(6) hind III is used for digesting pWMB006-TaARF12 and pWMB111 vectors, a fragment with a TaARF12 gene sequence and pWMB111 are recovered, and the pWMB111-TaARF12 RNAi vector is constructed through ligation detection.

The invention provides a method for identifying wheat RNAi transgenic plants, which uses primers SEQ ID NO.13-14, takes DNA of the transgenic plants as a template, and obtains positive plants with 430bp bands through PCR amplification.

The invention provides a method for identifying the expression quantity of a TaARF12 gene in an RNAi plant, wherein the used fluorescent quantitative primer is SEQ ID NO. 15-16.

Compared with the wild type, the plant height of the TaARF12 RNAi transgenic plant provided by the invention is obviously reduced.

Compared with the wild type, the spike phenotype of the TaARF12 RNAi transgenic plant provided by the invention is obviously longer.

The invention provides a target site for constructing a TaARF12 CRISPR/Cas9 vector and application thereof.

The invention provides a target site sequence of a wheat TaARF12 CRISPR/Cas9 vector, and the nucleotide sequence of the target site is SEQ ID NO.17 and SEQ ID NO. 18.

The CRISPR/Cas9 vector containing the target site sequence belongs to the protection scope of the invention.

The invention provides a method for identifying a wheat TaARF12 CRISPR/Cas9 transgenic plant, which uses a primer SEQID NO.13-14, takes DNA of the transgenic plant as a template, and obtains a positive plant with a 430bp strip by PCR amplification.

The invention provides a TaARF12 gene CRISPR/Cas9 transgenic plant which has a phenotype that the plant height is obviously reduced.

The invention provides a TaARF12 gene CRISPR/Cas9 transgenic plant which has a phenotype that the ear is obviously lengthened.

The invention provides a cloning method of a wheat TaARF12 gene and a biological function of the wheat TaARF12 gene in regulating and controlling plant height and spike length of a plant, and experiments show that after the wheat TaARF12 gene is silenced or is subjected to interference expression, the plant shows that the plant height is reduced and the spike length is lengthened. The wheat TaARF12 gene can be widely applied to the fields of wheat genetic breeding, germplasm resource improvement and cultivation of TaARF12 gene-transformed plants, and has an important effect on improving and improving the germplasm resources of crops such as wheat.

Drawings

FIG. 1 is a plasmid map of pWMB006 vector.

FIG. 2 is a plasmid map of the pWMB111 vector.

FIG. 3 shows the identification of positive plants of Fielder T3 transformed with TaARF12 RNAi. M is Marker, WT is wild-type Fielder as negative control, RNAi-L2, RNAi-L6, RNAi-L3 represent TaARF12-ARNAi wheat T3 generation plant (the same below), and the used template is DNA of three-leaf stage seedling. The 430bp band in the figure indicates that the transgenic plant is a positive plant.

FIG. 4 shows the expression level of TaARF12 in ears of wild-type Fielder and RNAi plants.

FIG. 5 is a plant height phenotype diagram of TaARF12 RNAi transgenic plant.

Fig. 6 is a statistical plot of plant heights of TaARF12 RNAi transgenic plants, which represent very significant differences.

FIG. 7 is a graph of spike length phenotype of TaARF12 RNAi transgenic plants.

Fig. 8 is a statistical plot of spike length of TaARF12 RNAi transgenic plants, representing very significant differences.

FIG. 9 shows the identification of positive plants of Fielder T1 generation transformed by TaARF12 CRISPR/Cas 9. M is Marker, WT is wild-type Fielder as negative control arf12-2, arf12-5, arf12-11 and arf12-9 represent TaARF12 CRISPR/Cas9 wheat T1 generation plant (the same below), and the used template is DNA of trefoil seedling. The 430bp band in the figure indicates that the transgenic plant is a positive plant.

FIG. 10 is gene editing site information of TaARF12 CRISPR/Cas9 transgenic plant.

FIG. 11 is a plant height phenotype diagram of TaARF12 CRISPR/Cas9 transgenic plant, Bar is 10 cm.

Fig. 12 is a statistical graph of plant heights of TaARF12 CRISPR/Cas9 transgenic plants, which represents the differences are very significant.

FIG. 13 is a spike length phenotype diagram of TaARF12 CRISPR/Cas9 transgenic plant, Bar 1 cm.

Fig. 14 is a statistical plot of tasrf 12 CRISPR/Cas9 transgenic plant spike length, which represents very significant differences.

Detailed Description

The following examples are intended to illustrate the invention but are not intended to limit the scope of the invention. It is within the scope of the present invention to modify or replace methods, steps or conditions of the present invention without departing from the spirit and substance of the present invention.

Unless otherwise specified, the chemical reagents used in the examples are all conventional commercially available reagents, and the technical means used in the examples are conventional means well known to those skilled in the art.

Example 1 cloning of the wheat TaARF12 Gene

1. Extraction of wheat young ear total RNA

Total RNA was extracted from young ears of spring China (Triticum aestivum L.) using the Plant mini Kit (QIAGEN).

2. First Strand cDNA Synthesis

The procedure was followed using the reverse transcriptase EasyScript One-Step gDNA Removal and cDNA Synthesis SuperMix (Kyoto Seiko Seiki Biotech Co., Ltd.).

3. The coding region sequence of TaARF12 was cloned from cDNA of young ears of spring China (Triticum aestivum L.). The sequence of the forward primer is shown as SEQ ID NO.4, and the sequence of the reverse primer is shown as SEQ ID NO. 5.

The PCR system and procedure were carried out with reference to the instructions of TransStart FastPfu DNA Polymerase (Beijing Kogyo gold Biotechnology Co., Ltd.).

After the PCR product is cut, recovered and purified, the product is cloned and connected to a Blunt Zero Cloning vector according to a Blunt Zero Cloning Kit Cloning method provided by Beijing all-purpose gold biotechnology limited, the connection product is transformed into escherichia coli DH5 α and is propagated therein, TaARF12 is obtained by positive Cloning through sequencing and screening, the obtained fragment is sent to a sequencing company for sequencing, and is compared with a TaARF12 reference sequence of hexaploid wheat to determine that the homologous chromosome sequences of the TaARF12 gene in A, B, D are respectively shown in SEQ ID NO. 1-3.

Example 2 construction of TaARF12 RNAi vector and identification and statistics of transgenic plants

Construction of pWMB006-TaARF12 intermediate vector

(1) Amplifying a section of specific sequence of TaARF12-A with BamH I and Kpn I enzyme cutting sites by using primers SEQ ID NO.6 and SEQ ID NO.7 and sequenced TaARF12-A plasmid as a template, carrying out double enzyme digestion on a purified PCR product, and recovering a target fragment by using a gel recovery kit;

(2) the vector pWMB006 (see figure 1) is digested in two enzymes, and the linearized vector is recovered by using a gel recovery kit;

(3) the connection and reaction system is as follows: mu.L of the target fragment obtained in the step (1), 2. mu.L of the linearized vector pWMB 0062. mu.L, 1. mu.L of T4 ligase, 1. mu.L of Buffer connected with T4, and ddH₂O to 10. mu.L, and ligation was performed overnight at 16 ℃;

(4) and (4) transforming a connecting product and selecting a positive clone for sequencing.

(5) And (3) constructing the reverse complementary fragment by the same method as the above, wherein the enzyme cutting sites are Sac I and Spe I, constructing the reverse complementary fragment into the vector with correct sequencing in the step (4) by using an enzyme cutting and connecting method, and finally constructing to obtain an intermediate vector pWMB006-TaARF 12.

Construction of pWMB111-TaARF12 RNAi vector

(1) The correct plasmids, pWMB006-ARF12 and pWMB111 (see FIG. 2), were sequenced in HandIII enzyme a (5), and the desired fragment and linearized vector were recovered using a gel recovery kit.

(2) Ligation, transformation and positive clone sequencing were performed in the same manner as a (3) - (4), and the pWMB111-ARF12 was constructed if the sequencing was correct.

c. Identification and statistics of transgenic plants

(1) PCR identification was performed in transgenic wheat leaves using the nucleotide sequence SEQ ID NO.13-14, and a 430bp band represented a positive plant (see FIG. 3).

(2) Using wild-type Fielder and young ears of transgenic plants, expression identification is carried out by using fluorescent quantitative primers SEQ ID NO.15-16, and the expression levels of RNAi-L2 and RNAi-L6 are obviously reduced (see figure 4).

(3) Compared with the wild-type Fielder, the heights of the transgenic plants RNAi-L2 and RNAi-L6 are obviously reduced (see figure 5 and figure 6).

(4) The transgenic plants, RNAi-L2 and RNAi-L6, had significantly longer ear lengths compared to the wild type Fielder (see FIGS. 7 and 8).

Example 3 TaARF12 CRISPR/Cas9 transgenic plant Gene editing detection

(1) Based on the position information of the target site, primers spanning the target site were designed, and the primers for target site 1 were SEQ ID Nos. 19-20 and target site 2 were SEQ ID Nos. 21-22.

(2) PCR identification was performed in transgenic wheat leaves using the nucleotide sequence SEQ ID NO.13-14, and a 430bp band represented a positive plant (see FIG. 9).

(3) PCR was performed on the DNA of the transgenic plants using primers SEQ ID NO.19-20 and SEQ ID NO.21-22, respectively. The PCR system and procedure were carried out with reference to the instructions of TransStart FastPfu DNA Polymerase (Beijing Kogyo gold Biotechnology Co., Ltd.).

(4) After the PCR product was recovered and purified by cutting gel, the product was ligated to Blunt Zero Cloning vector according to the Blunt Zero Cloning Kit (Beijing all-purpose gold Biotechnology Co., Ltd.) Cloning method, and the ligation product was transformed into E.coli DH5 α, and the positive clone was sequenced.

(5) The clone sequencing sequence and the sequence of the wild-type Fielder were aligned using DNAMAN to obtain gene editing information (see fig. 10). In the invention, 12 transgenic plants are obtained in total, and through detection, A, B, D3 copies are detected and edited simultaneously by 9 plants in the target site 2, and only 1 or 2 copies are edited by the other 3 plants. Only 3 plants in target site 1 tested 1 copy of the edit.

(6) Compared with wild-type Fielder, the plant height of the gene-edited plant is obviously reduced (see fig. 11 and fig. 12).

(7) The gene-edited plants showed significantly longer spike length compared to the wild-type Fielder (see fig. 13 and 14).

Although the invention has been described in detail hereinabove with respect to a general description and specific embodiments thereof, it will be apparent to those skilled in the art that modifications or improvements may be made thereto based on the invention. Accordingly, such modifications and improvements are intended to be within the scope of the invention as claimed.

Sequence listing

<110> institute of crop science of Chinese academy of agricultural sciences

<120> wheat TaARF12 gene and application thereof

<130>KHP191115676.7

<160>22

<170>SIPOSequenceListing 1.0

<210>1

<211>2496

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>1

atgagctcct cgtcgggggc cagcctcggc ggccagccgc cgcccgccgc gccgccggag 60

gaagagaaga agaacctcaa ctcggagctg tggcacgcct gcgccggccc gctcgtctgc 120

ctccccaccc tcggcacgcg cgtcgtctac ttcccgcagg gccacagcga gcaggtggcg 180

gcgtcgacga acaaggaggt ggaggggcac atccccaact acccaaacct gccgccgcag 240

ctcatctgcc agctgcacga tgtcacaatg catgctgatg tggagaccga tgaagtgtac 300

gcgcagatga cgctgcagcc gctgaaccca caagagcaaa acgacgccta cctgccggcg 360

gagatgggga tcatgagcaa gcagccgacc aactacttct gcaagacgct gacggccagc 420

gacaccagca cgcacggcgg cttctccgtg ccccgccgtg ccgccgagcg cgtcttcccc 480

cctctggatt tcacgcagca gcctcctgct caggagctaa ttgcgcggga tattcatgac 540

gtcgagtgga agttcagaca catcttccga ggccagccca aacgacactt gctaactact 600

ggctggagtg tgtttgttag cgccaaaaga ctagttgctg gagactcagt gctcttcata 660

tggaacgaga aaaaccagct ttggctagga atcaggcgtg ccaaccggac acagactgtg 720

atgccttcct ctgttctttc gagtgacagc atgcacatag ggctccttgc agctgcggct 780

catgctgctt ctacaaacag ccgcttcaca attttctaca atccgagggc atgtccatca 840

gaatttgtca taccactctc aaagtacatc aaggctgttt ttcacacccg gatatcggtt 900

ggcatgcggt tcaggatgct ctttgagacc gaggaatcta gtgttcgcag gtatatgggg 960

acgataacag aagtgagtga tgccgatcca gtgcgttggg ctagttccta ctggagatca 1020

gttaaggttg gttgggatga atcaactgct ggggaaaggc cgcctagagt ttctttatgg 1080

gagattgaac cattgacaac ctttcctatg tatccgtctt tgtttccgct gagggttaaa 1140

catccctggt attctggtgt agcaggcctt caagatgaca gcaatgcttt gatgtggctg 1200

agaggagttg ctggagatgg aggttatcag tctatgaact ttcagtcacc tggtattggc 1260

tcctggggac aacagaggct ccatccttct ttgatgagta ccgaccatga tcagtaccaa 1320

gcagtagttg ctgctgctgc cgccgcctcc cagtctggtg gttacatgaa acaacaattc 1380

ctaaaccttc agcagcctat gcagtcacct caagaacact gtaacctcaa cccgctgttg 1440

cagcaacaga tcttgcagca agctagccaa cagcaaactg ttagtgctga tagtcagaat 1500

attcagacaa tgctgaactc aagtgctatc cagcaccaac ttcaacagct ccagcaactg 1560

cagcaggtgc accaggtgca gcaggcgcag caggcccaca ttgatcagaa gcagaagatt 1620

caatcagatc aaacatatca tgttcctact agtgcgtctc tcccaagtcc aacgtcgcta 1680

ccaagccatc tgcgtgaaaa atttggcttc tctgatccta atgctaattc gtcaagcttc 1740

accacttcta gcagcagcga caacatgctg gaatcgaact tccttcaggg gaattcgaaa 1800

gctgtgaact tgtctagatt caatcagcca gtagctagcg atcagcagca gcagcaacaa 1860

cagcaacagc aacagcaggc ttggaagcaa aagtttatgg gttcacaatc actgtctttt 1920

gggggctcgg gtttgcttaa ctcacccaca agtaaagacg gttctcttga gagcaaaatt 1980

ggttctgatg tgcaacatca gtcccttttt agtcctcaag ttgattcttc ctccctactg 2040

tacaacatgg tgcctaacat gacttcaaat gttgcggata ataacatgtc tacgattcct 2100

tctgggtcaa catatctgca aagtcccatg tatggttgtt tggacgactc ttctggtatt 2160

tttcagaata caggagagaa tgacccaaca agcagaacat tcgtgaaggt ttataagtca 2220

ggatcagtgg ggaggtcctt ggacatcacc cggttctcca attatgctga acttcgtgaa 2280

gaactgggtc agatgtacgg catcaggggt cagttggatg accccgatag atcaggctgg 2340

cagcttgtat tcgtcgacag ggagaatgat gtgcttctcc ttggagacga cccttgggag 2400

tcatttgtga atagtgtatg gtacatcaag atactttcac cagaggatgt gcacaagttg 2460

ggcaagcaag gaaatgatcc acgttacctt tcctaa 2496

<210>2

<211>2502

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>2

atgagctcct cgtccggggc cagcctcggc ggccagccgc cgccgccgcc gcccgccgcg 60

ccgccggagg aagagaagaa gaacctcaac tcggagctgt ggcacgcctg cgccggcccg 120

ctcgtctgcc tccccaccct cggcacgcgc gtcgtctact tcccgcaggg ccacagcgag 180

caggtggcgg cgtcgacgaa caaggaggtg gaggggcaca tccccaacta ccccaacctg 240

ccgccgcagc tcatctgcca gctgcacgac gtcacaatgc atgccgatgt ggagaccgac 300

gaagtgtacg cgcagatgac gctgcagccg ctgaacccgc aagagcagaa cgacgcgtac 360

ctgccggcgg agatggggat catgagcaag cagccgacca actacttctg caagacgctg 420

acggccagcg acaccagcac gcacggcggc ttctccgtgc cgcgccgtgc cgccgagcgc 480

gtcttccccc ctctggattt cacgcagcag cctcctgctc aggagctaat tgcgcgggat 540

attcacgacg tggagtggaa gttcaggcac atcttccgag gccagcccaa acgacacttg 600

ctaactactg gctggagtgt gttcgttagc gccaaaagac tagttgctgg agactcggtg 660

ctcttcatat ggaacgagaa aaaccagctt tggctaggaa tcaggcgtgc caaccggaca 720

cagactgtga tgccttcctc tgttctttcg agtgacagca tgcacatagg gctccttgca 780

gctgcggctc atgctgcttc tacaaacagc cgcttcacaa ttttctacaa tccgagggca 840

tgtccatcag aatttgtcat accactctca aagtacatca aggctgtttt tcacacccgg 900

atatcggtcg gcatgcggtt caggatgctc tttgagaccg aggaatctag tgttcgcagg 960

tacatgggga caataacaga agtaagtgat gctgatccag tgcgttgggc tagttcctac 1020

tggagatcgg ttaaggttgg ttgggatgaa tcaactgctg gggaaagacc gcctagagtt 1080

tctttatggg agattgaacc attgacaacc ttccctatgt atccgtcatt gtttccgctg 1140

agggttaagc atccctggta ttctggtgta gcaggccttc aagatgacag caatgctttg 1200

atgtggctga gaggagttgc tggagatgga ggttatcagt ctatgaactt tcagtcacct 1260

ggtattggct cctggggaca acagaggctc catccttctt tgatgagtac ggagcatgat 1320

cagtaccaag cagtagttgc tgctgctgcc gccgcctccc agtctggtgg ttatatgaaa 1380

caacaattcc taaaccttca gcagcctatg cagtcgcctc aagaacactg caacctcaac 1440

ccgctgttgc agcaacagat cttgcagcaa gcaagccaac agcaaactgt tagtgctgat 1500

agtcagaata ttcagacaat gctgaactca agtgctatcc agcaccaact tcaacagctc 1560

cagcaactgc agcaggtgca ccaggtgcag caggcccagc aggctcacat tgatcagaag 1620

cagaagattc aatcagatca aacatatcat gttcctacta gtgcgtctct cccaagtcca 1680

acatcactac caagccatct gcgtgaaaaa tttggcttct ctgatcctaa tgctaattcg 1740

tcaagcttca ccacttctag cagcagcgac aacatgctgg aatcgaactt ccttcagggg 1800

aattcgaaag ctgtggactt gtctagattc aatcagccag tagctagcga tcagcagcag 1860

cagcagcagc aacagcagca gcaggcttgg aagcagaagt ttatgggttc acagtcactg 1920

tcttttgggg gctcgggttt gcttaattca cccacaagta aagatggttc tcttgagagc 1980

aaaattggtt ctgatgtgca aaatcagtcc ctttttagtc ctcaagttga ttcttcctcc 2040

ctactgtaca acatggtgcc taacatgact tcaaatgttg cggataataa catgtctacg 2100

attccttctg gatcaacata tctgcaaagt cccatgtatg gttgtttgga cgactcttct 2160

ggtatatttc agaatacagg agagaatgac ccaacaagca gaacattcgt gaaggtttat 2220

aagtcaggat cagtggggag gtccttggac atcacccggt tctccaatta tgctgaactt 2280

cgggaagaac tgggtcagat gtacggcatt aggggtcagt tggatgaccc cgatagatca 2340

ggctggcagc ttgtattcgt cgacagggag aatgatgtgc ttctccttgg agacgaccct 2400

tgggagtcat ttgtcaatag tgtatggtac atcaagatac tttcaccaga ggatgtgcac 2460

aagttgggca agcaaggaaa tgatccacgt tacctttcct aa 2502

<210>3

<211>2502

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>3

atgagctcct cgtcaggggc cagccttggc ggccagccgc cgccgccgcc gcccgccgcg 60

ccgccggagg aagagaagaa gaacctcaac tcggagctgt ggcacgcatg cgccggcccg 120

ctcgtctgcc tccccaccct cggcacgcgc gtcgtctact tcccgcaggg ccacagcgag 180

caggtggcgg cgtccacgaa caaggaggtg gaggggcaca tccccaacta ccccaacctg 240

ccgccgcagc tcatctgcca gctgcacgat gtcacaatgc atgctgatgt ggagaccgac 300

gaagtgtacg cgcagatgac gctgcagccg ctgaatccac aagagcagaa cgacgcctac 360

ctgccggcgg agatggggat catgagcaag cagccgacca actacttctg caagacgctg 420

acggccagcg acaccagcac gcacggcggc ttctccgtgc cccgccgtgc cgccgagcgc 480

gtcttccccc ctctggattt cacgcagcag cctcctgctc aggagctaat tgcgcgggac 540

attcatgatg tggagtggaa gtttaggcac atcttccgag gccagcccaa acgacacttg 600

ctaactactg gctggagtgt gttcgttagc gccaaaagac tagttgctgg agactcagtg 660

ctcttcatat ggaacgagaa aaaccagctt tggctaggaa tcaggcgtgc caaccggaca 720

cagactgtga tgccttcctc tgttctttcg agtgacagca tgcacatagg gctccttgca 780

gctgcggctc acgctgcttc tacaaacagccgcttcacaa ttttctacaa tccgagggca 840

tgtccatcag aatttgtcat accactctca aagtatatca aggctgtttt tcacacccgg 900

atatcggtcg gcatgcggtt caggatgctc tttgagaccg aggaatctag tgttcgcagg 960

tatatgggga cgataacaga agtgagtgat gctgatccag tgcgttgggc tagttcctac 1020

tggagatcag ttaaggttgg ttgggatgaa tcaactgctg gggaaaggcc gcctagagtt 1080

tctttatggg agattgaacc attgacaacc tttcctatgt atccgtcttt gtttccgctg 1140

agggttaagc atccctggta ttctggtgta gcaggccttc aagatgacag caatgctttg 1200

atgtggctga gaggagttgc tggagatgga ggttatcagt ctatgaactt tcagtcacct 1260

ggtattggct cctggggaca acagaggctc catccttctt tgctgagtac cgaccatgat 1320

cagtaccaag ctgtagttgc tgctgctgcc gccgcctccc agtctggtgg ttatatgaaa 1380

caacaattcc taaaccttca gcagcctatg cagtcgcctc aagaacactg caacctcaac 1440

ccgctcttgc agcaacagat cttgcagcaa gcaagccaac aacaaaccgt tagtgctgat 1500

agtcagaata ttcaggcaat gctgaactca agtgctatgc agcaccaact tcaacagctc 1560

cagcaactgc agcaggtgca ccaggtgcag caggcgcagc aggctcacat tgatcagaag 1620

cagaagattc aatcagatca aacatatcat gttcctacta gtgcgtctct cccaagtcca 1680

acatcactac caagccatct gcgtgaaaaa tttggcttct ctgatcctaa tgctaattcg 1740

tcaagcttca ccacttctag cagcagcgac aacatgctgg aatcgaactt ccttcagggg 1800

aattcgaaag ctgtagactt gtctagattc aatcagccag tagctagcga tcagcagcag 1860

cagcagcaac aacagcaaca gcaggcttgg aagcaaaagt ttatgggttc acaatcactg 1920

tcttttgggg gctcgggttt gcttagctca cccacaagta aagacggttc tcttgagagc 1980

aaaattggtt ctgatgtgca aaatcagtcc ctttttagtc ctcaagttga ttcttcctcc 2040

ctactgtaca acatggtgcc taacatgact tcaaatgttg cggataacaa catgtctacg 2100

attccttctg gatcaacata tctgcaaagt cccatgtatg gttgtttgga cgactcttct 2160

ggtatatttc agaatacagg agagaatgac ccaacaagca gaacattcgt gaaggtttat 2220

aagtcaggat cagtggggag gtccttggac atcacccggt tctccaatta tgctgaactt 2280

cgggaagaac tgggtcagat gtacggcatt aggggtcagt tggatgaccc cgatagatca 2340

ggctggcagc ttgtattcgt cgacagggag aatgatgtgc ttctccttgg agacgaccct 2400

tgggagtcat ttgtcaatag tgtatggtac atcaagatac tttcaccaga ggatgtgcac 2460

aagttgggca agcaaggaaa tgatccacgt tacctttcct aa 2502

<210>4

<211>21

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>4

ggttttttgg tcctggtgtt g 21

<210>5

<211>21

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>5

taccagaaac agcacaatga t 21

<210>6

<211>28

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>6

ccggatccgt ttccgctgag ggttaaac 28

<210>7

<211>28

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>7

ccggtacctg ctggagctgt tgaagttg 28

<210>8

<211>24

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>8

catgaacatt aaagtgatac gtgg 24

<210>9

<211>28

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>9

ccgagctcgt ttccgctgag ggttaaac 28

<210>10

<211>28

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>10

ccactagttg ctggagctgt tgaagttg 28

<210>11

<211>24

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>11

cggcagtaga taaagagtac ccac 24

<210>12

<211>435

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>12

gtttccgctg agggttaaac atccctggta ttctggtgta gcaggccttc aagatgacag 60

caatgctttg atgtggctga gaggagttgc tggagatgga ggttatcagt ctatgaactt 120

tcagtcacct ggtattggct cctggggaca acagaggctc catccttctt tgatgagtac 180

cgaccatgat cagtaccaag cagtagttgc tgctgctgcc gccgcctccc agtctggtgg 240

ttacatgaaa caacaattcc taaaccttca gcagcctatg cagtcacctc aagaacactg 300

taacctcaac ccgctgttgc agcaacagat cttgcagcaa gctagccaac agcaaactgt 360

tagtgctgat agtcagaata ttcagacaat gctgaactca agtgctatcc agcaccaact 420

tcaacagctc cagca 435

<210>13

<211>23

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>13

tgcaccatcg tcaaccacta cat 23

<210>14

<211>21

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>14

gctgccagaa acccacgtca t 21

<210>15

<211>21

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>15

ggacgataac agaagtgagt g 21

<210>16

<211>21

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>16

agacggatac ataggaaagg t 21

<210>17

<211>22

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>17

caaaacgacg cctacctgcn gg 22

<210>18

<211>22

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>18

ccttgatgta ctttgagagn gg 22

<210>19

<211>19

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>19

tggtgctgag tttggtgac 19

<210>20

<211>18

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>20

gctgctgcgt gaaatcct 18

<210>21

<211>19

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>21

ttggctagga atcaggcgt 19

<210>22

<211>21

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>22

gtcattgcca ttacatcctg c 21

Claims

1. Any one of the following applications of wheat TaARF12 gene,

(1) the application in wheat breeding;

(2) the application in regulating and controlling plant height;

(3) the application in regulating the wheat head length;

(4) the application in preparing transgenic plants;

(5) application in plant germplasm resource improvement.

2. The use according to claim 1, wherein the wheat TaARF12 gene is located on a second wheat homologue, which has the sequence on the wheat 2A homologue as shown in SEQ ID No.1, on the wheat 2B homologue as shown in SEQ ID No.2, and on the wheat 2D homologue as shown in SEQ ID No. 3.

3. The primer group for cloning the wheat TaARF12 gene is characterized in that the nucleotide sequence is shown as SEQ ID NO. 4-5.

4. The cloning method of the wheat TaARF12 gene is characterized in that a specific primer group is utilized, wheat young ear cDNA is taken as a template, the PCR amplification is carried out to obtain the wheat TaARF12 gene, and the nucleotide sequence of the specific primer group is shown as SEQ ID NO. 4-5.

5. An RNAi fragment of wheat TaARF12 gene, characterized in that the nucleotide sequence is shown in SEQ ID NO. 12.

6. An RNAi vector of wheat TaARF12 gene, comprising the RNAi fragment of claim 5, wherein the RNAi vector is prepared by a method comprising the steps of:

(1) amplifying an RNAi fragment of a TaARF12 gene by using a pair of primers with BamH I and Kpn I enzyme cutting sites respectively, and connecting the amplified RNAi fragment to a linearized pWMB006 vector after enzyme cutting to obtain a new linearized vector; the nucleotide sequence of the primer is shown as SEQ ID NO. 6-7;

(2) utilizing a pair of primers with Sac I and Spe I enzyme cutting sites respectively to amplify a reverse complementary fragment of the TaARF12 RNAi fragment, connecting the amplified reverse complementary fragment to the new linearized vector after enzyme cutting, and constructing an intermediate vector pWMB006-TaARF12, wherein the nucleotide sequence of the primers is shown as SEQ ID NO. 9-10;

(3) HindIII is used for digesting pWMB006-TaARF12 and pWMB111, a band with a TaARF12 interference fragment is recovered by glue and is connected to a linearized pWMB111 vector to obtain a pWMB111-TaARF12 RNAi vector.

7. The identification method of wheat TaARF12 RNAi transgenic positive plants is characterized in that PCR amplification is carried out by using primers for detecting Bar genes, and the nucleotide sequences of the primers are shown as SEQ ID NO. 13-14.

8. The sgRNA of the specific targeting wheat TaARF12 gene is characterized in that the DNA sequence of the sgRNA is shown in SEQ ID NO.17 or SEQ ID NO. 18.

9. A CRISPR/Cas9 vector containing the DNA sequence of the sgRNA of claim 8.

10. Use of an expression inhibitor of wheat TaARF12 gene of claim 1, an RNAi fragment of claim 5, an RNAi vector of claim 6, or a CRISPR/Cas9 vector of claim 9 for reducing plant height or promoting plant ear lengthening.