CN113004383B

CN113004383B - Application of corn gene ZmEREB102 in improving corn yield

Info

Publication number: CN113004383B
Application number: CN202110392603.0A
Authority: CN
Inventors: 张祖新; 简逸楠; 宁强
Original assignee: Huazhong Agricultural University
Current assignee: Huazhong Agricultural University
Priority date: 2021-04-13
Filing date: 2021-04-13
Publication date: 2022-03-15
Anticipated expiration: 2041-04-13
Also published as: CN113004383A

Abstract

The invention belongs to the technical field of plant genetic engineering, and particularly relates to a corn geneZmEREB102The gene has the coded amino acid sequence shown in SEQ ID NO.2 and can be applied to the improvement of the yield of corn. The gene is located in the 7 th chromosome of corn and controls the length of corn ears, the number of seeds in each row and the number of seeds in each ear. The expression level of this gene is inversely related to ear length and seed number per row between isogenic lines and in the natural population. The gene is knocked out by using a CRISPR/Cas9 technology, the expression of the gene is inhibited, and the ear length and the seed number of each row of a maize inbred line under drought stress and normal environment can be increased.

Description

Application of corn gene ZmEREB102 in improving corn yield

Technical Field

The present invention belongs to the field of plant gene engineering technology. The gene is positioned on the 7 th chromosome of the corn and controls important yield traits of the ear length and/or the row grain number of the female ear of the corn.

Background

Corn (Zea mays L.) is an important grain, feed, industrial raw material and energy crop in the world at present, and plays a great role in guaranteeing the grain safety and economic development in the world, relieving energy crisis and the like. The method faces to the problem that the rigidity restriction of land supply cannot be flexibly coordinated on one hand, and structural reform of the agricultural supply side faces to great challenge on the other hand, and is a major topic of the genetic breeding discipline for meeting the requirement of the economic sustainable development of China on the corn and further improving the yield of the corn in unit area of China.

Maize yield is a complex quantitative trait, controlled by multiple genes. Ear length, row grain number, ear row number, ear weight, and cob weight are important corn yield components. The yield character of the corn is divided into different yield factors for research, which is beneficial to analyzing the genetic basis formed by the yield character, is beneficial to a breeder to design a breeding strategy by more effectively utilizing gene resources, and achieves the aim of high-efficiency breeding. Under a specific planting density, the yield of the corn per unit area is determined by the yield of single-ear grains and the number of ears; the yield of single-spike grains is determined by the grain number of each spike and the weight of each hundred grains, and the grain number of each spike is determined by the number of rows of the spike and the number of lines of the spike; the ear length and ear thickness of corn are significantly related to the number of grains in a row and the number of rows in an ear, respectively. By reference to the yield and related trait data published in Argentina for 32 different maize varieties during 1965-. The results show that in the breeding process of the last 50 years, the corn yield is increased at the speed of 113kg/ha/year on average, the yield is increased, the number of seeds per spike is increased positively, the weight of a single seed is changed, the biomass accumulation of the single spike is increased year by year, the interval period of tasseling and silking is shortened, and the flowering period is consistent; but the efficiency of kernel formation is kept unchanged, and the gradual change trend of all the traits is in line with the expectation, which indicates that the increase of the number of kernels per spike is an important reason for the annual increase of the yield. The analysis of the genetic basis of the ear length and the grain number has important significance for recognizing the mechanism of corn yield formation and also provides a theoretical basis for breeding practice.

In view of the above, the present study utilizes genetic methods to isolate a gene ZmEREB102 located on chromosome 7 of maize and capable of controlling maize ear length and kernel number, which encodes an APETALA2/Ethylene RESPONSE FA CTOR (AP2/ERF) transcription factor involved in signaling in the ETHYLENE signaling pathway. Based on genetic phenotype and related molecular biology analysis of transgenic materials, biological functions of the gene in controlling traits such as ear length, row grain number, ear grain number and the like are verified, and genetic transformation research of ZmEREB102 can provide gene resources and theoretical support for corn breeding.

Disclosure of Invention

The invention aims to provide application of a corn gene ZmEREB102 in improving the corn yield, and an amino acid sequence coded by the gene is shown in SEQ ID NO. 2.

In order to achieve the purpose, the invention adopts the following technical measures:

the application of a corn gene ZmEREB102 in improving the corn yield, wherein the amino acid sequence coded by the gene is shown in SEQ ID NO. 2; comprises reducing the expression level of the corn gene ZmEREB102 in corn or not expressing the corn gene ZmEREB102 in corn by using the conventional mode in the field so as to improve the yield of the corn.

The application of a corn gene ZmEREB102 in increasing the length of a corn ear is disclosed, wherein the amino acid sequence coded by the gene is shown in SEQ ID NO. 2; including reducing the expression level of the maize gene ZmEREB102 in maize or not expressing it in maize to increase maize ear length using conventional means in the art including, but not limited to, knocking out or silencing the gene.

The application of the corn gene ZmEREB102 in increasing the number of grains in a corn row, wherein the amino acid sequence coded by the gene is shown in SEQ ID NO. 2; including decreasing the amount of corn gene ZmEREB102 expressed in corn or not in corn to increase corn kernel number using conventional means in the art including, but not limited to, knocking out or silencing the gene.

The application of the corn gene ZmEREB102 in increasing the number of grains per ear of corn is disclosed, wherein the amino acid sequence of the gene code is shown in SEQ ID NO. 2; including decreasing the amount of corn gene ZmEREB102 expressed in corn or not in corn to increase corn kernel number using conventional means in the art including, but not limited to, knocking out or silencing the gene.

Compared with the prior art, the invention has the following advantages:

the invention clones and verifies a gene ZmEREB102 for controlling the ear length and the number of grains in a row in corn, verifies the relation between the ear length and the number of grains in the row and the expression level of the ZmEREB102, and can increase the ear length and the number of grains in the row of corn by reducing the expression level. The difference in grain number between the transgenic material and the wild-type material is due to the decrease in protein levels encoded by the gene as a result of editing of the coding region of the gene. In the action mechanism, the gene is considered to participate in the signal response of ethylene in a plant body, the response of ethylene is increased, the expression of a downstream gene is further regulated, the differentiation activity of a maize inflorescence meristem is finally regulated, and the yield traits of maize, such as spike length, row grain number and the like, are influenced. Therefore, the invention provides a new gene resource for improving the yield of the corn.

Drawings

FIG. 1 is a schematic representation of a maize ZmEREB102 knock-out material;

wherein: a is a phenotype schematic diagram of a corn ZmEREB102 gene knockout material, and the phenotype schematic diagram from left to right comprises the following components: separating a wild type family (control) obtained by the transgenic heterozygous plant, and editing the families ereb102-cr1 and ereb102-cr2 by two ZmEREB102 genes;

b is a schematic diagram of the ear length of the corn ZmEREB102 gene knockout material, and histograms from left to right are respectively a wild type family (control), two ZmEREB102 gene editing families ereb102-cr1 and ereb102-cr 2;

c is a line particle number diagram of corn ZmEREB102 gene knockout materials, and the bar charts are respectively a wild type family (control), two ZmEREB102 gene editing families ereb102-cr1 and ereb102-cr2 from left to right.

FIG. 2 is a schematic diagram showing the expression difference of the maize ZmEREB102 gene in different tissues of B73;

wherein: a: ZmEREB102 is highly expressed in young ears of 2 mm; b: in situ hybridization results showed that ZmEREB102 was specifically expressed in IM (infliximeristem) and SPM (spikelet pair meristm) of 2mm scion.

FIG. 3 is a schematic diagram of the CPB-ZmUbi-hspCas9 vector.

FIG. 4 shows the crossing of ZmEREB102 gene knockout material of corn with 3 inbred lines F₁A schematic diagram of (a);

wherein A is 6 hybrids F₁Combined mature cluster photo, B-E is the F hybridization of 3 inbred lines with control and ereb102-cr1 respectively₁And (4) performing phenotype comparison analysis on ear length, row grain number, ear weight and single ear grain weight in the generation.

Detailed Description

The following examples further define the invention, and in light of the following description and examples, one skilled in the art can ascertain the essential characteristics of this invention, and without departing from the spirit and scope thereof, can make appropriate improvements and modifications to the invention to adapt it to various usages and conditions. The technical schemes of the invention are conventional schemes in the field if not particularly stated; the reagents or materials, unless otherwise specified, are commercially available or disclosed.

Example 1:

ZmEREB102 cloning

Extracting total DNA of Plant leaves of an inbred line KN5585(Liu, et al, high-throughput CRISPR/Cas9 mutagenesis in main, the Plant Cell,2020,32: 1397-.

The extraction of the total DNA of the plant leaves adopts a CTAB method, and the PCR amplification procedure is as follows: pre-denaturation at 94 ℃ for 5min, followed by denaturation at 94 ℃ for 30s, annealing at 58 ℃ for 30s, and extension at 72 ℃ for 60s, for 34 cycles, and final extension at 72 ℃ for 5 min.

The PCR amplification system is as follows:

TABLE 1 primers and sequences thereof used in the present invention

Example 2: genetic transformation of ZmEREB102 in maize

The genetic transformation of ZmEREB102 gene knockout is realized by taking ZmEREB102 in a transgenic receptor material KN5585 as an application gene, and the sequence is shown as SEQ ID NO. 1. Using CRISPR-P website (http://cbi.hzau.edu.cn/ crispr/) Gene Target design is carried out, and two Guide RNAs are finally obtained (Target1: GCAACCGCGAAGATCTTGCGTGG; target2: GCAAACCTCGTCGGCTCCGGCGG). ZmU6-Target1-SgRNA and ZmU6-Target2-SgRNA fragments (ZmU6 sequence is shown as SEQ ID NO.3, and SgRNA sequence is shown as SEQ ID NO. 4) are respectively synthesized by using a gene synthesis mode and are respectively constructed on a pEASY-T1 commercial vector. Two fragments were amplified by PCR using two pairs of primers, pU6F1 and gRR0, pU6F2 and gRR1 (see Table 1 for primer ID2) respectivelyThe CPB-ZmUbi-hspCs 9 vector is linearized by HindIII single digestion, recovered by electrophoresis gel cutting and detected, and two Guide RNAs are connected to the target vector CPB-ZmUbi-hspCs 9 by homologous recombination (see the vector schematic in figure 3). And finally, sequencing the obtained clone by using a CRISPR vector detection primer (the primer sequence is shown in the table 1, and the primer ID is 3) and determining that the target fragment is connected to the vector. The correctly cloned plasmid is transformed into a maize inbred line KN5585 through agrobacterium mediation (genetic transformation is completed by life science and technology center of China seed group, Inc.). Thus, 2 maize transformation events (A in FIG. 1), ereb102-cr1 and ereb102-cr2 in the background of KN5585 were obtained, wherein the control was a wild-type sister line isolated from transgenic heterozygous plants. The phenotypic values of the ear length and the row grain number of the corn are examined in Gansu 2020, and the results show that: in the two transformation events of ereb102-cr1 and ereb102-cr2, compared with control, after the function of ZmEREB102 gene is lost, the ear length of the corn is respectively increased by 14.6% and 14.0% (B in figure 1), and the number of grains in the corn is respectively increased by 10.3% and 15.3% (C in figure 1); based on the results, the expression of the ZmEREB102 gene is reduced, the response of an ethylene signal in young ears is reduced, and the ear length and the row grain number of the corn can be improved.

Example 3: expression analysis of ZmEREB102

Extracting different tissues such as roots, stems, leaves, 2mm and 2-3cm young ears and the like of B73 seedling stage, extracting total RNA by using a TRIZOL reagent, and carrying out reverse transcription to synthesize cDNA. Quantitative PCR analysis was performed using cDNA as a template and a gene-specific primer set (Table 1, primer ID 4). The ZmEREB102 gene has the highest expression level at the root of the seedling stage and is also highly expressed in 2mm young ears, and the expression level of the ZmEREB102 gene is obviously reduced in 2-3cm young ears (A in figure 2); meanwhile, the specific expression mode of ZmEREB102 in 2mm young ears is verified by using RNA in situ hybridization (B in figure 2, the primer sequence is shown in table 1, and the primer ID is 5); the gene is supposed to be highly expressed mainly in the early stage of young maize ears, and further influences the properties of maize, such as ear length, row grain number and the like.

Example 4: effect analysis of ZmEREB102 in increasing maize yield

Using the knockout material ereb102-cr1 of ZmEREB102 and its corresponding sister series control to respectively react withThe inbred line B73, Chang7-2 (Chang 7-2) and HSZ (Huangzao four) are hybridized to assemble F₁The combinations were hybridized (A in FIG. 4). The phenotypic data of the corn ear length, the row grain number, the ear weight and the single ear seed weight are examined in the northwest of Hubei Xiangyang in 2020, and the results show that: f compared to "wired line × control₁Hybrid combinations "F of" woven line × ereb102-cr1₁The hybrid combination increased ear length by 3.5-7.2% (B in FIG. 4), increased row size by 4.0-7.1% (C in FIG. 4), increased ear weight by 5.5-15.5% (D in FIG. 4), and increased ear weight by 8.2-10.9% (E in FIG. 4). Based on the results, the expression of the ZmEREB102 gene is reduced, and the ear length, the row grain number, the ear weight and the grain number per ear of the corn hybrid can be effectively improved, so that the method is applied to the genetic improvement of the corn.

Sequence listing

<110> university of agriculture in Huazhong

Application of <120> corn gene ZmEREB102 in improving corn yield

<160> 19

<170> SIPOSequenceListing 1.0

<210> 1

<211> 2798

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

tcccaagtcc cacccccact ccctcgctca ccagaggaac tagcggccag gcaaagccga 60

gccgcaaccg cgaagatctt gcgtggcctc cttttcccag ctcgtcactg tgccgctcgt 120

gtccttcact cccggtccgc ccaaccaata atccatcgat ccatccacca ccaccacccc 180

gctgcggcga tgtgcggcgg cgccatcctc tcgggtttca tcccgccgtc cggggtggcg 240

gcggcggcgg cggcggcggc caagaagaag cagcagcagc ggtgccgtgt gactgcggac 300

ctgctatggc cggggcccgg cagtaaggga gctccccagg acaaggagga ggacttcgag 360

gccgacttcc gcgagttcga gcgcggcctc ggcgaggatg acgtggacag cgccggcgaa 420

ggcggcgacc ccgaggtcca ggagcttcct ccgccggagc cgacgaggtt tgccttcgcc 480

accgcggcca aggcagcagt tggtgagcac cgcattaaag ccgctacttc gttttttcct 540

tatatatata tcgcgcgcac acacacactt ggacgggcga aagaaagatg cctcttttgc 600

ggcgctgttt ctcgaatctc ctttggttgt tgatgagata gccgaggttc ctttgcggtc 660

cagccaagca gggaaatttt gtcttcattt ctctggttag cctttagcca tggagtgggc 720

aaggctgttc aattctctgg ctagcctttt tagccttggt attttgtatg caatccgcta 780

gcttacgatt aacacaaatg atctattgag cgattatgaa aataagtact tatttatgtt 840

agggcgtgtt gagtttagtt gtgttcgaat tggccatctt attcagaata tgatgtttag 900

ttaagttgag aataatttct ggaatttttt ccttgctaac tgttgtctcc ttatatagat 960

ccttcaggtc gaagcttctt tattatctgt caactttatt tgtttagatc cgggttattg 1020

ttggtcttca tagctgactg attgcaatag atgtagaaaa ttgctatatg tttgttcttg 1080

taagctcttg tttttttttc tctttttctg agagaaggac attatttatg cttcagcctc 1140

tttgttgttt gctacttttt ctccaattca gcaaccggaa caaactaccc ctacaaacaa 1200

gtagagtagc cattcgttga ttacaaacaa acaaacaatt catgctagat acgttttgtt 1260

gagacggact gactgataga cgacagcttt tttattatag atggcgtgat gacgacgact 1320

ccaaaggatg tgcaaggaga tagagcagta aaaaagcgcg gccggaagaa ccagtacagg 1380

ggaatcaggc agcggccttg gggcaaatgg gcagctgaga tcagggaccc caacaagggc 1440

gtccgcgtct ggctcggaac ctacaacacc gccgaggagg cagctagggc atacgacgcc 1500

gaagctcgca agatccgcgg caagaaagcg aaggtgaatt tccccgatga cgacgcgaca 1560

ggcactcgtc acaggccaac gaacgccgcg aacgcagcga ggctagtagc tccaccccca 1620

cccccgaagg cctgcgccga tgagatgttt aacaacctga agaacgacga cggcgacaac 1680

aacaacaacg atgatctgtt tgcgatgttt gcgttcggtg acaataagaa gaaggttcct 1740

gcagcgaagc cagccgccga cgaggttggc agtggcagtg gcagcttcct cgtccctgcg 1800

cctgcggtgg cggcggtgcc cggtaacaag aggaggtcgt ccgcgaccaa cattatgctc 1860

tccgtctccg acgaccagag cagcaactcc tacggctccg gctcctccgc cgacttggtg 1920

gggtcgtggt cgtgggacga cgacgacgcc gccgccgccg ccgccgccgc cgccatgacc 1980

tcggactaca cctcctcggt cttagctccg gcgtcttact cttacatgca aggcggagcg 2040

ccgaagagaa tgaggaggag ctacggcggc gcgccgccca gcctcgcaca tgacgcggcc 2100

atgcctggtt ttggccttga taaagtgagc taccactacc agccgttgcc gttgcctcct 2160

tattacgtcg ggagcagcag cggctcgtca gacgacgcgt cggtgggcag ccttggtctt 2220

ctgcaggctg atggtgctcc acaggatggg gcgagcgccg gggatatctg gagcctcgac 2280

gagctgctca tgctggcagc agctggtgct tattgagaac cgcaagaaaa aaaaatgtaa 2340

ggcatccata tataattgct atatcttgtt atcccctaca ggctacaccg ctacacacgt 2400

ctgccggccg tgaatggaga attggagatg gagtgtctgt ctcatccatg ctcgtttttt 2460

ttttgttttc gtgccaggtg ttggcgctgc tagctggaga cgagacgagg gcgagaggca 2520

gttgcatcat ccgccatccg ctatcgtttt gtctctccta tatctagtag tatacatgct 2580

tctggcagtc gaactctatg gcaatgtgtg tatagtgtgt tgctgccgtc tatgattgga 2640

agcgagctcg agactggttc aataattcac ctttgcctac cgtcgtaccg ccggcctgct 2700

ggactgtagt gtgcgtactg catatatatg ccatagttat gtatgcactc ctcctatata 2760

tactatatat tattatgatg tgcttatact agtactgt 2798

<210> 2

<211> 442

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 2

Met Cys Gly Gly Ala Ile Leu Ser Gly Phe Ile Pro Pro Ser Gly Val

1 5 10 15

Ala Ala Ala Ala Ala Ala Ala Ala Lys Lys Lys Gln Gln Gln Arg Cys

20 25 30

Arg Val Thr Ala Asp Leu Leu Trp Pro Gly Pro Gly Ser Lys Gly Ala

35 40 45

Pro Gln Asp Lys Glu Glu Asp Phe Glu Ala Asp Phe Arg Glu Phe Glu

50 55 60

Arg Gly Leu Gly Glu Asp Asp Val Asp Ser Ala Gly Glu Gly Gly Asp

65 70 75 80

Pro Glu Val Gln Glu Leu Pro Pro Pro Glu Pro Thr Arg Phe Ala Phe

85 90 95

Ala Thr Ala Ala Lys Ala Ala Val Asp Gly Val Met Thr Thr Thr Pro

100 105 110

Lys Asp Val Gln Gly Asp Arg Ala Val Lys Lys Arg Gly Arg Lys Asn

115 120 125

Gln Tyr Arg Gly Ile Arg Gln Arg Pro Trp Gly Lys Trp Ala Ala Glu

130 135 140

Ile Arg Asp Pro Asn Lys Gly Val Arg Val Trp Leu Gly Thr Tyr Asn

145 150 155 160

Thr Ala Glu Glu Ala Ala Arg Ala Tyr Asp Ala Glu Ala Arg Lys Ile

165 170 175

Arg Gly Lys Lys Ala Lys Val Asn Phe Pro Asp Asp Asp Ala Thr Gly

180 185 190

Thr Arg His Arg Pro Thr Asn Ala Ala Asn Ala Ala Arg Leu Val Ala

195 200 205

Pro Pro Pro Pro Pro Lys Ala Cys Ala Asp Glu Met Phe Asn Asn Leu

210 215 220

Lys Asn Asp Asp Gly Asp Asn Asn Asn Asn Asp Asp Leu Phe Ala Met

225 230 235 240

Phe Ala Phe Gly Asp Asn Lys Lys Lys Val Pro Ala Ala Lys Pro Ala

245 250 255

Ala Asp Glu Val Gly Ser Gly Ser Gly Ser Phe Leu Val Pro Ala Pro

260 265 270

Ala Val Ala Ala Val Pro Gly Asn Lys Arg Arg Ser Ser Ala Thr Asn

275 280 285

Ile Met Leu Ser Val Ser Asp Asp Gln Ser Ser Asn Ser Tyr Gly Ser

290 295 300

Gly Ser Ser Ala Asp Leu Val Gly Ser Trp Ser Trp Asp Asp Asp Asp

305 310 315 320

Ala Ala Ala Ala Ala Ala Ala Ala Ala Met Thr Ser Asp Tyr Thr Ser

325 330 335

Ser Val Leu Ala Pro Ala Ser Tyr Ser Tyr Met Gln Gly Gly Ala Pro

340 345 350

Lys Arg Met Arg Arg Ser Tyr Gly Gly Ala Pro Pro Ser Leu Ala His

355 360 365

Asp Ala Ala Met Pro Gly Phe Gly Leu Asp Lys Val Ser Tyr His Tyr

370 375 380

Gln Pro Leu Pro Leu Pro Pro Tyr Tyr Val Gly Ser Ser Ser Gly Ser

385 390 395 400

Ser Asp Asp Ala Ser Val Gly Ser Leu Gly Leu Leu Gln Ala Asp Gly

405 410 415

Ala Pro Gln Asp Gly Ala Ser Ala Gly Asp Ile Trp Ser Leu Asp Glu

420 425 430

Leu Leu Met Leu Ala Ala Ala Gly Ala Tyr

435 440

<210> 3

<211> 500

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

gctgtttttg ttagccccat cgaatccttg acataatgat cccgcttaaa taagcaacct 60

cgcttgtata gttccttgtg ctctaacaca cgatgatgat aagtcgtaaa atagtggtgt 120

ccaaagaatt tccaggccca gttgtaaaag ctaaaatgct attcgaattt ctactagcag 180

taagtcgtgt ttagaaatta tttttttata tacctttttt ccttctatgt acagtaggac 240

acagtgtcag cgccgcgttg acggagaata tttgcaaaaa agtaaaagag aaagtcatag 300

cggcgtatgt gccaaaaact tcgtcacaga gagggccata agaaacatgg cccacggccc 360

aatacgaagc accgcgacga agcccaaaca gcagtccgta ggtggagcaa agcgctgggt 420

aatacgcaaa cgttttgtcc caccttgact aatcacaaga gtggagcgta ccttataaac 480

cgagccgcaa gcaccgaatt 500

<210> 4

<211> 88

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

gttttagagc tagaaatagc aagttaaaat aaggctagtc cgttatcaac ttgaaaaagt 60

ggcaccgagt cggtgctttt tttaagct 88

<210> 5

<211> 19

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

tcccaagtcc cacccccac 19

<210> 6

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 6

acagtactag tataagcaca 20

<210> 7

<211> 37

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 7

tgcactgcac aagctgctgt ttttgttagc cccatcg 37

<210> 8

<211> 37

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 8

tgcttttttt aagctgctgt ttttgttagc cccatcg 37

<210> 9

<211> 64

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 9

gagccgcaag caccgaattg caaccgcgaa gatcttgcgg ttttagagct agaaatagca 60

agtt 64

<210> 10

<211> 64

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 10

gagccgcaag caccgaattg caaacctcgt cggctccggg ttttagagct agaaatagca 60

agtt 64

<210> 11

<211> 35

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 11

gctaacaaaa acagcagctt aaaaaaagca ccgac 35

<210> 12

<211> 34

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 12

ggccagtgcc aagcttaaaa aaagcaccga ctcg 34

<210> 13

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 13

aagctagcgg attgcataca 20

<210> 14

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 14

ctacacctcc tcggtcttcg 20

<210> 15

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 15

cttgcggttc tcaataagca 20

<210> 16

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 16

ggtgaatttt cccgatgacg 20

<210> 17

<211> 40

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 17

taatacgact cactataggg tcaataagca ccagctgctg 40

<210> 18

<211> 23

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 18

gcaaccgcga agatcttgcg tgg 23

<210> 19

<211> 23

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 19

gcaaacctcg tcggctccgg cgg 23

Claims

1. The application of reducing the expression of a corn gene ZmEREB102 in improving the corn yield is disclosed, and the amino acid sequence of the gene code is shown in SEQ ID NO. 2.

2. The use of claim 1, wherein said increased yield is achieved by increasing ear length, increasing row size and/or number of grains per ear.