CN112708699B - Virus sample inactivation and cracking kit and application thereof - Google Patents

Abstract

The application provides a virus sample inactivation and lysis kit and application thereof, wherein the virus sample inactivation and lysis kit comprises: the kit comprises the following reagents for preparing an inactivated lysate: ammonium salt, guanidine isothiocyanate, lithium chloride, ethylenediamine tetraacetic acid, ethylene glycol bis (2-aminoethylether) tetraacetic acid, surfactant, ascorbic acid, dithiothreitol and buffer. The application also provides an inactivation and lysis kit for the virus sample, which is combined with a target nucleic acid magnetic capture reagent or a kit and/or a real-time fluorescent nucleic acid isothermal amplification detection kit to realize the inactivation, capture and real-time fluorescent isothermal amplification detection of the virus, can be quickly inactivated at room temperature and reduce the degradation of RNA, and has high sensitivity; the specificity of the target nucleic acid magnetic capture reagent is stronger, and the obtained templates have good quality and large quantity; the real-time fluorescent nucleic acid isothermal amplification technology carries out reverse transcription and amplification together, shortens the reaction time and provides the sensitivity of the detection reagent.

Description

Virus sample inactivation and cracking kit and application thereof

The application relates to a kit for detecting virus inactivation, capture and real-time fluorescence isothermal amplification and application thereof, which is a divisional application of an application patent application with the application number of 2020101751855.

Technical Field

The invention relates to the technical field of biological detection of viruses, in particular to a virus inactivation kit, a virus nucleic acid capture kit, a real-time fluorescent isothermal amplification detection kit and application thereof, and particularly relates to a virus, in particular to a 2019novel coronavirus (2019-nCoV) pretreatment and detection related kit and application thereof, wherein the virus is integrated with the acquisition, inactivation and cleavage, and the specific target magnetic capture and the real-time fluorescent nucleic acid isothermal amplification detection technology are combined together.

Background

The novel coronavirus (2019Novel Coronavirus,2019-nCoV) is an RNA virus whose genetic material is ribonucleic acid and whose specific nucleic acid sequence is a marker that distinguishes this virus from other pathogens. The novel coronavirus nucleic acid is detected in order to find the presence of the virus in the infected patient. The current common use of novel coronavirus detection is nucleic acid detection methods including viral RNA extraction and second generation real-time fluorescent quantitative PCR techniques. The viral RNA extraction process is a pretreatment process in which viral RNA in specimens (pharyngeal swabs, oropharyngeal swabs, sputum, alveolar lavages, etc.) is purified and isolated. The technical principle of fluorescent quantitative PCR nucleic acid detection is that firstly, novel coronavirus RNA is reversely transcribed into DNA, then specific nucleic acid sequences in a specimen are amplified, the amplification is theoretically carried out for about 30 times, the nucleic acid quantity can reach a certain detection standard, and then the detection is carried out by conventional modes such as fluorescence and the like.

Currently, there are a number of countries and regions in which methods for definitive detection of 2019-nCoV are published. The recommended gene targets of the Chinese disease prevention control center are ORF1ab and N genes; ORF1b-nsp14 and N genes are recommended by university of hong Kong in China; legend, germany, recommends the RdRP, E and N genes. The first evidence in China is that 6 enterprises provide detection methods including nucleic acid extraction, reverse transcription and PCR amplification; the required time is 2 to 4 hours; wherein nucleic acid extraction generally takes 1-2 hours, reverse transcription takes 1 hour, and PCR amplification takes 40-90 minutes; the minimum detection limit is 500-1000copies/mL.

The professor Wang Chen of the medical expert for critical illness, the university of chinese engineering institute, respiratory and the university of chinese engineering, month 2 and 5, 2020, mentions: the current detection mode is mainly used for detecting viral nucleic acid, but the novel coronavirus has a characteristic that not all infected patients can detect the nucleic acid positive. The nucleic acid detection has a positive rate of 30-50% at most for positive patients, that is, some patients have a negative nucleic acid detection result, but are clinically confirmed to be suspected of being a new coronatine pneumonia, and belong to the category of false negatives, and some people therefore question that the detection cannot play a role. The "missed test" condition has made the quality of test kits questionable to some clinicians and the public.

In response to the above doubt, the detection performance of different novel coronavirus (2019-nCoV) nucleic acid detection reagents was compared and analyzed by a three-hospital clinical laboratory in Chongqing people's hospital. Collecting throat swab specimens collected from 1 patient with weak positive at different time points, selecting the 6 domestic reagents (A-F) for parallel detection, extracting and amplifying RNA, and comparing the performances according to the detection results of the reagents. As a result, the results of 3 times of parallel detection of the C reagent and the F reagent (ORF 1ab and N gene) are positive, the N gene is not detected by the D reagent, and the ORF1ab is not detected by the A, B, E reagent; c, the repeated detection result in the reagent batch is optimal; CT values of the F reagent (N and ORF1 ab), the E reagent (ORF 1 ab) and the A reagent (ORF 1 ab) were changed in a trend in 3 times. These results indicate that the 6 2019-nCoV nucleic acid detection reagents have different detection capacities on weak positive samples, and that part of the reagents have poor accuracy, sensitivity and repeatability, so that further optimization and performance improvement are needed to better meet the large-scale screening requirements.

Thus, clinicians and related specialists call for inclusion of CT imaging exam results into the confirmed diagnostic criteria, but CT imaging tests are highly sensitive and potentially less specific, and CT-only tests may be less false negative but may cause a greater number of false positives, thereby potentially increasing unnecessary medical burden and the probability of cross-infection for false positive patients; meanwhile, CT imaging characteristics of early infected persons are not obvious, so that false negative is caused, and cross infection is caused to society. Needless to say, nucleic acid detection is ultimately necessarily the gold standard for noninvasive diagnosis of novel coronavirus pneumonia, and is the current new coronavirus detection method with highest sensitivity and specificity. In general, as three types of medical instruments, the detection kit needs to be clinically tested, and after a plurality of indexes such as specificity and sensitivity meet the requirements, the detection kit can be approved to enter clinic by the national food and drug administration, which usually takes months or even years. The epidemic situation is rapid, the kit is not easy to be obtained in the development, and the clinical application is urgent because enough clinical samples are not used for repeated verification in batches.

In summary, the reasons that the existing nucleic acid detection has false negative and low positive rate are various, the collection of different types of samples, the large floating of the virus content in different samples in different disease courses of different patients, the low-temperature preservation and transportation of special equipment and special vehicles are needed after the sampling, the integrity of RNA is reduced due to repeated freeze thawing, the degradation of RNA by the traditional heat inactivation method, the compatibility of sample preservation solution and extraction reagent is poor, the low yield of the extraction process and long pretreatment time period also lead to the degradation of RNA, the purity of target nucleic acid obtained in the extraction process is low, the genome containing a large amount of human genome or other pathogens leads to the non-specific or interference amplification of subsequent amplification products, and the proportion of the concentration of primers, probes and enzymes in the PCR detection is sensitive enough or not.

Disclosure of Invention

In order to solve the problems that the existing 2019-nCoV detection method is low in sensitivity, long in detection time (collection, preservation, transportation, inactivation, extraction and detection), and easy to cause the pollution of an amplified product to cause false positive or false negative of an experimental result, the invention provides a virus sample inactivation and lysis kit in a first aspect, wherein the kit comprises the following reagents for preparing an inactivation and lysis solution: ammonium salt, guanidine isothiocyanate, lithium chloride, ethylenediamine tetraacetic acid, ethylene glycol bis (2-aminoethylether) tetraacetic acid, surfactant, ascorbic acid, dithiothreitol and buffer.

Preferably, the ammonium salt is selected from the group consisting of ammonium sulfate, ammonium carbonate, ammonium chloride, ammonium bromide and ammonium iodide. Additionally or further preferably, the ammonium salt is ammonium chloride; additionally or further preferably, the surfactant is selected from the group consisting of Span-80, span-20, sodium dodecyl benzene sulfonate, lithium dodecyl sulfate, sodium Dodecyl Sulfate (SDS), tween 20, triton X-100, NP40, sodium dodecyl sarcosinate, and CTAB. Additionally or further preferably, the surfactant is a combination of triton x-100 and lithium dodecyl sulfate. Additionally or further preferably, the buffer is selected from the group consisting of Tris base, phosphate and HEPES.

Additionally or further preferably, the inactivated lysate is formulated with water and comprises 0.01-2M ammonium salt, 0.5-2M guanidine isothiocyanate, 0.1-0.5M lithium chloride, 5-50mM ethylenediamine tetraacetic acid, 1-20mM ethylene glycol bis (2-aminoethyl ether) tetraacetic acid, 0.1-5% surfactant, 10-500mM ascorbic acid, 0.5-5% dithiothreitol and 20-500mM buffer.

Additionally or further preferably, the concentration of ammonium ions in the inactivated lysate is between 0.05M and 0.5M, preferably between 0.1M and 0.4M, more preferably between 0.1M and 0.2M. Additionally or further preferably, the surfactant in the inactivated lysate is a combination of 0.2% triton x-100 and 0.5% lithium dodecyl sulfate. Additionally or further preferably, the buffer is HEPES, preferably the concentration of HEPES is 50-200mM. Additionally or further preferably, the pH of the inactivated lysate is between 5 and 6.5.

The present invention provides in a second aspect a method of viral inactivation lysis using a viral sample inactivation lysis kit according to the first aspect of the invention. Preferably, the viral sample is selected from the group consisting of a pharyngeal swab sample, an oropharyngeal swab sample, a sputum sample, an alveolar lavage sample, and a urine sample; the inactivated lysate is 2 to 4 times the volume of the virus sample; the inactivation is treatment at room temperature for 15 to 30 minutes; and/or the virus is 2019-nCoV.

The present invention provides in a third aspect a target nucleic acid magnetic capture reagent comprising:

(1) Magnetic polymer microsphere as solid phase carrier, the magnetic polymer microsphere comprises gamma Fe ₂ O ₃ And Fe (Fe) ₃ O ₄ Microspheres made of magnetic materials and one or more layers of polymeric materials coating the microspheres, wherein microsphere connecting groups are modified on the surfaces of the magnetic polymer microspheres;

(2) An intermediate probe comprising a 5' modified non-nucleotide unit, a 3' modified oligonucleotide unit, and an optional intermediate arm, and the intermediate probe being attached to the magnetic polymeric microsphere by the microsphere attachment group binding to the 5' modified non-nucleotide unit;

(3) A capture probe comprising a 5 'specific sequence and a 3' polya sequence that are specifically complementary to a target nucleic acid; preferably, the target nucleic acid is a specific sequence that characterizes the presence of a target microorganism, more preferably, the target microorganism is 2019-nCoV; more preferably, the 3' polyA sequence is 10 to 50 bases in length, and still more preferably 10 to 30 bases in length.

Additionally or further preferably, the polymeric material coats the microspheres by emulsion polymerization, soap-free polymerization, dispersion polymerization or seed swelling polymerization. Additionally or further preferably, the magnetic polymeric microspheres have a particle size of 0.1-10 μm, preferably 0.5-5 μm, more preferably selected from the group consisting of Dynabeads M270 strepitavidins, dynabeads MyOne Streptavidin T, merckCarboxyl magnetic beads M1-200/20, merck +.>Amino magnetic beads M2-070/40, agilent LodeStars 2.7.2.7 Carboxyl.

Additionally or further preferably, the microsphere attachment group is a reactive group or an affinity protein and/or the affinity protein is streptavidin. Additionally or further preferably, the reactive group is selected from the group consisting of carboxyl, amino, epoxy, NHS (N-hydroxysuccinimide) groups, azide groups, tosyl and chloromethyl groups, preferably carboxyl or tosyl.

Additionally or further preferably, the 5' modified non-nucleotide unit is selected from the group consisting of amino, carboxyl and biotin.

Additionally or further preferably, the 3' modified oligonucleotide units are selected from the group consisting of Oligo dT, oligo dU, oligo dT VN or Oligo dU VN, wherein V is selected from the group consisting of A, G and C, and N is selected from the group consisting of T, A, G and C; preferably, the number of oligonucleotides T or U in the 3' modified oligonucleotide is 5-100, more preferably 10-50.

Additionally or further preferably, the optional intermediate arm is PEG and/or Cn, wherein the molecular weight of PEG is 100-600, preferably 100-200; cn represents a linear alkylene group having n carbon atoms, more preferably n is 2 to 12; the length of the intermediate arm is 5-50A, more preferably 10-30A.

Additionally or further preferably, the capture probe is a capture probe for 2019-nCoV and the 5' specific sequence is a specific sequence on the orf1ab gene and/or a specific sequence on the N protein gene position; preferably, the 5' specific sequence is shown as SEQ ID NO.1 and/or SEQ ID NO. 2; it is further preferred that the capture probes are shown as SEQ ID NO.3 and/or SEQ ID NO. 4.

Preferably, the microsphere connecting group is streptavidin, and the 5' modified non-nucleotide unit is biotin; the intermediate probe is selected from the group consisting of 5' biotin Oligo (dT) ₁₅ 3’、5’biotin-PEG-Oligo(dT) ₁₈ 3’、5’biotin-Cn-Oligo(dT) ₂₅ VN 3 'and 5' biotin-Cn-Oligo (dU) ₃₀ VN 3', wherein the molecular weight of PEG is 100-600, preferably 100-200; cn represents a linear alkylene group having n carbon atoms, n preferably being 2 to 12;

it is further preferred that the microsphere attachment group is a carboxyl group and the 5' modified non-nucleotide unit is an amino group; preferably, the microsphere connecting group is formed by covalently bonding the magnetic polymer microsphere with carboxyl with the aminated intermediate probe through an EDC one-step method, an EDC/NHS two-step method or an EDC/SNHS two-step method with the 5' -modified non-nucleotide unit; more preferably, the intermediate probe is selected from the group consisting of 5' NH ₂ -Cn-Oligo(dT) ₁₈ 3’、5’NH ₂ -PEG-Oligo(dT) ₂₅ 3 'and 5' NH ₂ -PEG-Oligo(dT) ₂₃ VN 3', wherein the molecular weight of PEG is 100-600, preferably 100-200; cn represents a linear alkylene group having n carbon atoms, n being preferably 2 to 12.

It is further preferred that the microsphere attachment group is an amino group and the 5' modified non-nucleotide unit is a carboxyl group.

It is also preferred that the magnetic polymeric microspheres have a binding capacity of at least 100pmol/mg, at least 200pmol/mg, at least 300pmol/mg, at least 400pmol/mg, at least 500pmol/mg, more preferably at least 750pmol/mg, and most preferably at least 1200pmol/mg.

It is further preferred that the molar ratio of the intermediate probe to the capture probe is 50:1 to 2:1, more preferably 25:1 to 3:1, most preferably 20:1 to 4:1.

It is also preferred that the amount of intermediate probe not bound to the capture probe is greater than 100pmol/mg, more preferably greater than 200pmol/mg.

In a fourth aspect, the invention provides a target nucleic acid capture kit comprising a binding buffer, a preservation solution, a wash solution W1, a wash solution W2, an eluent, and a target nucleic acid magnetic capture reagent.

Preferably, the binding buffer consists of lithium chloride, lithium dodecyl sulfate, triton X-100, ethylenediamine tetraacetic acid, citric acid and water, and the pH range is 6.0-8.0, and the contents of the components are preferably as follows: 0.02-5M lithium chloride, 0.02-5% lithium dodecyl sulfate, 0.05-5% Triton X-1000,1-100mM ethylenediamine tetraacetic acid, 0.02-0.2M citric acid, and the balance being water.

It is also preferable that the preservation solution is composed of BSA and NaN ₃ And the binding buffer.

It is further preferred that the washing solution W1 comprises 100mM succinate, 0.5% lithium dodecyl sulfate, 100mM LiOH, 15mM 2,2' -dithiodipyridine, 0.2M LiCl, 5mM EDTA, 5mM EGTA, 3% (v/v) absolute ethanol, pH6.5.

It is further preferable that the washing solution W2 contains 20mM HEPES, 7.5mM NaOH, 1mM EDTA, 0.3% (v/v) absolute ethanol, 0.02% (W/v) methylparaben, 0.01% (W/v) propylparaben, 50mM lithium chloride, 0.1% sodium dodecyl sulfate, pH7.5.

The eluate contained 1mM EDTA and 2mM sodium acetate, pH6.5.

Preferably, the target nucleic acid magnetic capture reagent is the target nucleic acid magnetic capture reagent according to the third aspect of the present invention.

In a fifth aspect, the invention provides a primer pair for amplifying and detecting a target nucleic acid, the primer pair comprising a forward primer based on an RNA polymerase promoter sequence and a reverse primer based on a non-RNA polymerase promoter sequence, the forward primer comprising an RNA polymerase promoter sequence at the 5 'end and a forward target nucleic acid binding sequence at the 3' end, the reverse primer comprising a reverse target nucleic acid binding sequence.

Preferably, the RNA polymerase promoter sequence is selected from the group consisting of sp6 RNA polymerase promoter sequence, T3 RNA polymerase promoter sequence and T7 RNA polymerase promoter sequence.

It is further preferred that the forward primer comprises a T7 RNA polymerase promoter sequence at the 5 'end and a forward target nucleic acid binding sequence at the 3' end.

More preferably, the T7 RNA polymerase promoter sequence at the 5' end is the sequence shown in SEQ ID NO. 5.

It is further preferred that the forward primer of the primer pair is shown as SEQ ID NO.6, the reverse primer is shown as SEQ ID NO.7, or the forward primer of the primer pair is shown as SEQ ID NO.8, and the reverse primer is shown as SEQ ID NO.9. In a sixth aspect, the present invention provides a kit for real-time fluorescent nucleic acid isothermal amplification detection, wherein the kit comprises: (i) an amplification reaction reagent; (ii) mixing the enzyme reagents; and (iii) an amplification detection reagent;

wherein the amplification reaction buffer comprises Tris-HCl and MgCl ₂ PVP 40, KCl, glycerol, zinc acetate dihydrate, dNTP, NTP, and pH7.0;

the mixed enzyme reagent comprises T7 RNA polymerase, reverse transcriptase, HEPES, N-acetyl-L-cysteine, EDTA, sodium azide, tritonX-100, KCl, glycerol, trehalose dihydrate, pH7.0;

the detection reagent comprises Tris, EDTA, a primer pair for amplifying the target nucleic acid and a probe target nucleic acid probe, wherein the primer pair for amplifying the target nucleic acid is the primer pair in the fifth aspect.

It is also preferable that the probe for detecting a target nucleic acid is shown as SEQ ID NO.10 when the primers are SEQ ID NO.6 and 7, or as SEQ ID NO.11 when the primers are SEQ ID NO.8 and 9.

The invention provides in a seventh aspect a kit for virus inactivation, capture and real-time fluorescent isothermal amplification detection, characterized in that the kit comprises;

(1) The virus sample inactivation lysis kit according to the first aspect of the present invention;

(2) The target nucleic acid magnetic capture reagent according to the third aspect of the present invention or the target nucleic acid capture kit according to the fourth aspect of the present invention;

(3) The primer set according to the fifth aspect of the present invention or the target nucleic acid capturing kit according to the sixth aspect of the present invention.

The invention also provides methods for inactivating, capturing and detecting viruses, particularly novel coronaviruses, using the above reagents, primer pairs, probes and kits, and their use in inactivating, capturing and detecting viruses, particularly novel coronaviruses.

In general, the invention provides a technology and a method for combining 2019-nCoV acquisition, inactivation and cleavage integration, specific target magnetic capture technology and real-time fluorescent nucleic acid isothermal amplification detection, which have short detection time, high sensitivity and high specificity and stable reaction.

More specifically, the invention provides a sample lysis inactivating reagent and an application method thereof, a specific target magnetic capture pretreatment process and a real-time fluorescent nucleic acid isothermal amplification detection kit, which comprise a special primer, a probe, a kit and use thereof.

The sample inactivating and cracking reagent provided by the invention is specially used for RNA viruses, can be specially used for SARS or 2019-nCoV, especially 2019-nCoV, and has the functions of inactivating 2019-nCoV, short-term inhibiting RNase activity, protecting RNA from degradation and realizing short-term normal-temperature transportation and preservation. The currently recommended inactivation method is to treat for 30-45 minutes at 56 ℃, and common sample treatment solutions are generally isotonic solution, physiological saline or PBS solution, so that RNA is easy to degrade in the process, and amplification cannot be performed in the subsequent PCR detection process, so that false negative is caused.

The invention provides an inactivation and cracking reagent for 2019-nCoV samples and an application method thereof, wherein the specific target magnetic capture pretreatment process and the real-time fluorescent nucleic acid isothermal amplification detection kit have the following advantages compared with the existing flow of heating inactivation, cold chain transportation, conventional extraction and RT-PCR detection:

1) The sample is immediately inactivated and cracked after being collected, so that normal-temperature transportation is realized, the integrity of RNA is ensured, and the transportation cost and risk are reduced;

2) High specificity, high purity: preferred magnetic beads, intermediate probes, and capture probes designed for 2019-nCoV target nucleic acids can capture RNA of 2019-nCoV with high efficiency and specificity.

3) Because a closed constant-temperature amplification detection system is adopted, a reaction system is not required to be opened in the whole process, and an amplification product is RNA, so that aerosol pollution caused by an amplicon is avoided.

4) And (3) rapid detection: the method comprises the steps of sample splitting and inactivating, pretreatment and targeted magnetic capturing, and synchronously carrying out amplification and detection of nucleic acid in the same closed system, wherein the whole detection process has no temperature rise and circulation, so that the required time is greatly shortened, the inactivation only needs 15 minutes, the pretreatment only needs 10-30 minutes, the amplification detection only needs 45 minutes, and the whole process is within 1.5 hours.

5) The degree of automation is high, manual operation is reduced, and possible pollution and human error are avoided;

6) Is suitable for large-scale high-throughput screening.

Drawings

FIG. 1 is a sensitivity analysis chart of example 8 of the present invention, the concentration is 2000copies/mL, the blue is ORF1ab gene (upper panel), and the green is N gene (lower panel);

FIG. 2 is a sensitivity analysis chart of example 8 of the present invention, the concentration is 500copies/mL, the blue is ORF1ab gene (upper panel), and the green is N gene (lower panel);

FIG. 3 is a sensitivity analysis chart of example 8 of the present invention, the concentration is 100copies/mL, the blue is ORF1ab gene (upper line), and the green is N gene (lower line).

Detailed Description

Definition of the definition

Before the present teachings are described in detail, it is to be understood that this disclosure is not limited to particular compositions or process steps as such

These may vary. It should be noted that, as used in this specification and the appended claims, the singular forms "a," "an," and "the" include plural referents unless the context clearly dictates otherwise. Thus, for example, reference to "an oligomer" includes a plurality of oligomers, and the like.

It should be understood that there is a implied "about" prior to the temperatures, masses, weights, volume ratios, concentrations, times, etc. discussed in this disclosure such that slight and insubstantial deviations are within the scope of the teachings herein. Generally, the term "about" means an insubstantial change in the amount of a component of a composition that does not have any significant effect on the effect or stability of the composition. Moreover, the use of "including," "comprising," and "including" is not intended to be limiting. It is to be understood that both the foregoing general description and the detailed description are exemplary and explanatory only and are not restrictive of the present teachings. To the extent that any material incorporated by reference is inconsistent with the teachings of this disclosure, the teachings will control.

Embodiments in the specification that are described as "comprising" various components are also considered to be "consisting of" or "consisting essentially of" the components unless specifically indicated; embodiments described in the specification as "consisting of" various components are also considered to be "comprising" or "consisting essentially of" the components.

In the present application, "sample" or "specimen" includes any sample, such as a nucleic acid or a fragment of a nucleic acid, that contains or may contain a virus, such as a novel coronavirus (2019-nCoV) or SARS virus, or a component thereof. Samples include "biological samples" which include any tissue or material derived from a living or dead animal, such as a mammal (e.g., a human), which may contain or may contain target nucleic acids such as 2019-nCoV or SARS virus or target nucleic acids derived therefrom. The sample or specimen may include, for example, a pharyngeal swab sample, an oropharyngeal swab sample, a sputum sample, and alveolar lavage sample, a peripheral blood sample, a plasma sample, a serum sample, a lymph node sample, a gastrointestinal tissue sample, a fecal sample, a urine sample, or other bodily fluid sample or material.

"nucleic acid" refers to a polymeric compound comprising two or more covalently bonded nucleosides or nucleoside analogs having nitrogen-containing heterocyclic bases or base analogs, wherein the nucleosides are linked together by phosphodiester bonds or other bonds to form a polynucleotide. Nucleic acids include RNA, DNA or chimeric DNA-RNA polymers or oligonucleotides and analogs thereof. The nucleic acid "backbone" may be comprised of a variety of linkages, including one or more of sugar-phosphodiester linkages, peptide-nucleic acid linkages. The nucleic acid may include modified bases to alter the function or behavior of the nucleic acid, such as adding 3' -terminal dideoxynucleotides to prevent additional nucleotides from being added to the nucleic acid. Synthetic methods for preparing nucleic acids in vitro are well known in the art, although nucleic acids can be purified from natural sources using conventional techniques.

As used herein, a "nucleotide" is a subunit of a nucleic acid consisting of a phosphate group, a 5-carbon sugar, and a nitrogen-containing base (which may also be referred to as a "nucleobase"). The 5-carbon sugar found in RNA is ribose. In DNA, the 5-carbon sugar is 2' -deoxyribose. The term also includes analogs of these subunits.

As used herein, a "non-nucleotide unit" is a unit that does not significantly participate in polymer hybridization. For example, these units do not participate in any significant hydrogen bonding with the nucleotide, and units having one of the five nucleotide bases or analogs thereof as a component are excluded.

As used herein, a "target nucleic acid" is a nucleic acid comprising a target sequence to be amplified. The target nucleic acid may be DNA or RNA as described herein, and may be single-stranded or double-stranded. The target nucleic acid may include other sequences in addition to the target sequence, which may not be amplified.

The terms "oligomer" and "oligo" as used interchangeably herein refer to nucleic acids having generally less than 500 nucleotide (nt) residues, including polymers having a lower limit of about 5nt residues and an upper limit of about 300 to 500nt residues. In some embodiments, the size range of the oligonucleotide has a lower limit of about 8 to 15nt and an upper limit of about 100 to 200nt, and other embodiments are within a range of about 10 to 20nt and an upper limit of about 50 to 100 nt. Oligonucleotides may be purified from naturally occurring sources or may be synthesized using any of a variety of well known enzymatic or chemical methods and may be purified by magnetic beads or HPLC or the like. The term oligonucleotide does not denote any particular function to the reagent; rather, it is intended to generally cover all such agents described herein. Oligonucleotides may provide a variety of different functions. For example, if it is specific for and capable of hybridizing to a complementary strand and can be further extended in the presence of a nucleic acid polymerase, it can act as a primer; if it contains a sequence recognized by RNA polymerase and allows transcription (e.g., a T7 primer), it can act as a primer and provide a promoter; if it is capable of hybridizing to a target nucleic acid or amplicon thereof and also provides a detectable moiety (e.g., a fluorophore), it can be used to detect the target nucleic acid.

As used herein, the term "complementary" or "complementarity," when used in reference to a polynucleotide (i.e., a nucleotide sequence), refers to a polynucleotide that is related by the base pairing rules. For example, the sequence "5'-A-G-T-3'" is complementary to the sequence "3 '-T-C-A-5'". Complementarity may be "partial". Wherein only some of the nucleobases match according to the base pairing rules. Alternatively, there may be "complete" or "global" complementarity between the nucleic acids. The degree of complementarity between nucleic acid strands has a significant effect on the efficiency and strength of hybridization between nucleic acid strands. This is particularly important in amplification reactions and detection methods that rely on binding between nucleic acids.

In the present application, "extracting", "separating" or "purifying" refers to the removal of one or more components of a sample or the separation of other sample components. The sample component comprises the target nucleic acid, which is often in a generally aqueous solution phase, which may also comprise cellular fragments, proteins, carbohydrates, lipids, salt ions, metal ions, and other nucleic acids. "extract", "isolate" or "purify" does not mean any degree of purification. Typically, the separation or purification removes at least 70% or at least 80% or at least 90% of the target nucleic acid from the other sample components.

The term "polymerase chain reaction" ("PCR") refers herein to the methods of k.b. mullis U.S. patent nos. 4683195 and 4683202, which describe methods of increasing the concentration of a target sequence segment in a genome or other mixture of DNA or RNA without cloning or purification. This process for amplifying a target sequence consists of: a large excess of two oligonucleotide primers is introduced into a DNA mixture containing the desired target sequence, followed by thermal cycling of the exact sequence in the presence of a DNA polymerase. The two primers are complementary to their respective strands in the double stranded target sequence. To effect amplification, the mixture is denatured and the primers then anneal to their complementary sequences in the target molecule. After annealing, the primers are extended with a polymerase to form a pair of new complementary strands. The steps of denaturation, primer annealing, and polymerase extension can be repeated multiple times (i.e., denaturation, annealing, and extension constitute one "cycle; there can be multiple" cycles ") to obtain high concentrations of amplified segments of the desired target sequence. The length of the amplified segment of the desired target sequence is determined by the relative position of the primers with respect to each other, and thus this length is a controllable parameter. Due to the repeated aspects of the process, the method is referred to as "polymer chain reaction" ("PCR"). Because the desired amplified segments of target sequences become the primary sequences (in terms of concentration) in the mixture, they are referred to as "PCR amplified" and are "PCR products" or "amplicons. Those skilled in the art will appreciate that the term "PCR" encompasses many variations of the methods described initially using, for example, real-time PCR, nested PCR, reverse transcription PCR (RT-PCR), single primer and arbitrary primer PCR, and the like.

The sequence may be a "2019-nCoV sequence" if it or its complement present is at least about 90% or at least about 95% identical relative to any genotype or isolate of 2019-nCoV, or contains no more than one mismatch, such that, for example, 15 consecutive nucleotides of the "2019-nCoV sequence" refers to a 15 mer that matches at least 14 of the 15 positions of the genotype or isolate of 2019-nCoV or its complement. For example, to determine whether a sequence corresponds to a 2019-nCoV sequence, the presence of U is considered equivalent to T and vice versa. Taking 2019-nCoV as an example, the target hybridization region of the exemplary oligomers disclosed herein, the 2019-nCoV derived in vitro transcript sequences disclosed herein, and subsequences thereof are also considered 2019-nCoV sequences.

Herein a "magnet" is a material or object that generates a magnetic field. The magnet may be a permanent magnet or an electromagnet.

Specificity herein reflects the false positive rate at the time of detection (probability of misdiagnosing a non-patient as having the disease), the higher the specificity, the lower the misdiagnosis rate; sensitivity reflects the false negative rate of detection (the probability of missed diagnosis of the patient as not suffering from the disease), and the higher the sensitivity is, the lower the missed diagnosis rate is. At present, the specific false negative rate and false positive rate of the new coronavirus nucleic acid detection are not reported in article statistics. The term "sensitivity" is used herein to refer to the accuracy with which a nucleic acid amplification reaction can be detected or quantified, as another meaning in a PCR assay. The sensitivity of an amplification reaction is generally a measure of the minimum number of copies of a target nucleic acid that can be reliably detected in an amplification system and will depend, for example, on the detection assay used and the specificity of the amplification reaction, e.g., the ratio of specific amplicon to byproduct.

In the invention, the 2019-nCoV sequence is submitted to NCBI GenBank database by the public health clinical center of Shanghai city of double denier university by means of high throughput sequencing technology for about 1 month and 10 days, and the current version is the 1 month and 17 days updated genome version with the number MN 908947.3. The novel coronavirus 2019-nCoV is a linear single stranded RNA (ssRNA) virus, with a genome of about 29903 nucleotides in length (see NCBI GenBank database, accession No. MN908947.3 genome version for 1 month 17 upgrades), comprising a total of 10 genes, wherein:

the first 265 nucleotides are the 5' UTR region; 21555 is a gene named "ORF1 ab"; 21563 25384 is the "S" gene, which produces viral surface glycoproteins; 26220 is the "ORF3a" gene; 2645. 26472 the "E" gene produces viral envelope proteins; 27191 the "M" gene produces viral membrane glycoproteins; 27202. 27387 is the "ORF6" gene; 27394. 27759 is the "ORF7a" gene; 27894, 28259 is the "ORF8" gene; 28274 29533 the "N" gene produces viral nucleocapsid phosphoproteins; 29674 is the "ORF10" gene; 29675 29903 is the 3' utr region. Specific sequences please log into the Genbank database (accession number: MN908947; version number: MN 908947.3).

The invention relates to a virus sample inactivation and lysis kit which comprises ammonium salt, guanidine isothiocyanate, lithium chloride, ethylenediamine tetraacetic acid, ethylene glycol bis (2-aminoethyl ether) tetraacetic acid, a surfactant, ascorbic acid, dithiothreitol, a buffer solution and deionized water. The content of each component is preferably as follows: 0.01-2M ammonium salt, 0.5-2M guanidine isothiocyanate, 0.1-0.5M lithium chloride, 5-50mM ethylenediamine tetraacetic acid, 1-20mM ethylene glycol bis (2-aminoethylether) tetraacetic acid, 0.1-5% surfactant, 10-500mM ascorbic acid, 0.5-5% dithiothreitol, 20-500mM buffer.

Ammonium ions (NH 4) required for inactivating viruses according to the method of the present invention ⁺ ) May exist in many different ways, such as by adding ammonium salts. In a preferred embodiment, the ammonium salt is ammonium sulfate, ammonium carbonate, ammonium chloride, ammonium bromide, or ammonium iodide or mixtures thereof, preferably the ammonium salt is ammonium chloride.

The concentration of ammonium ions is generally in the range of 0.01M to 2M, preferably in the range of 0.05M to 0.5M, more preferably in the range of 0.1M to 0.4M, most preferably in the range of 0.1M to 0.2M.

The surfactant is any one or combination of 2-3 of Span-80, span-20, sodium dodecyl benzene sulfonate, lithium dodecyl sulfate, sodium Dodecyl Sulfate (SDS), tween 20, triton X-100, NP40, sodium dodecyl sarcosinate and CTAB, and the concentration is 0.1-5%. Preferred surfactants are Triton X-100 and lithium lauryl sulfate, with a preferred combination of 0.2% Triton X-100 and 0.5% lithium lauryl sulfate.

The buffer solution can be Tris buffer solution, phosphate buffer system or HEPES buffer system, and the preferred buffer solution is HEPES buffer, the preferred pH value is 5-6.5, and the concentration is 50-200mM.

The sample inactivating and splitting reagent prepared by the virus sample inactivating and splitting kit can store RNA for a short period of time and realize short-period normal temperature storage and transportation, wherein the short period in the invention refers to 25 ℃ for 5 days and 37 ℃ for 1-2 days, ammonium salt and guanidine isothiocyanate are used as protein denaturants for denaturing and splitting virus RNA, guanidine isothiocyanate can inhibit RNase activity function, ensure that RNA is not degraded by enzyme, buffer solution maintains the buffer environment of RNA, maintains the stability of nucleic acid, ethylenediamine tetraacetic acid and ethylene glycol bis (2-aminoethyl ether) tetraacetic acid can be coupled with divalent metal ions, inhibit RNase activity, ascorbic acid can keep the nucleic acid stable and not degraded under UV, dithiothreitol is used for reducing disulfide bonds in proteins, promotes the breaking of virus RNA shell proteins, and surfactant can dissolve lipid in the virus RNA shell proteins so as to increase the permeability of antibodies to cell membranes and promote the breaking of the virus RNA shell proteins, thereby inactivating pathogenic microorganisms.

The sample inactivating and cracking reagent prepared by the invention can be used in throat swabs, oropharynx swabs, sputum and alveolar lavage fluid, urine or other body fluids, and for the sputum and alveolar lavage fluid, urine or other body fluids, the sample inactivating and cracking reagent with the volume of 2 times is preferably used for treating the sample inactivating and cracking reagent for 15-30 minutes at room temperature, and 1-2mL of sample inactivating and cracking reagent can be added into the throat swabs and oropharynx swabs. The reagent has low guanidine isothiocyanate concentration, and surfactant, dithiothreitol and ethylenediamine tetraacetic acid are common chemical components for nucleic acid extraction, so that subsequent nucleic acid extraction is not affected, and the reagent can be compatible with common silicon membrane centrifugation column nucleic acid extraction and nucleic acid extraction based on silicon magnetic beads in the market, such as Applied Biosystems ^TM Provided MagMAX ^TM Viral RNA Isolation Kit(CAT#AM1939),Thermo Scientific ^TM GeneJET Viral DNA/RNA Purification Kit (CAT#K0821) provided, invitrogen ^TM Dynabeads provided ^TM SILANE Viral NA Kit (CAT#37011D) supplied by QiagenViral RNA Mini (CAT#52904), and the like. Surprisingly, the sample inactivation and cleavage reagent prepared by the invention is not only suitable for conventional nucleic acid extraction and purification, but also suitable for the special target magnetic capture pretreatment technology for replacing conventional nucleic acid extraction and purification, is directly used as capture hybridization solution of the technology, is carried out in a tube from inactivation and cleavage to subsequent combination, does not need to additionally add other reagents, and greatly saves pretreatment time.

In the invention, "nucleic acid extraction" refers to a process of separating nucleic acid from a sample, 2019-nCoV is RNA virus, the degradation condition of RNA needs to be paid attention to in the nucleic acid extraction process, a main stream virus RNA extraction kit on the market is generally based on a column method or a magnetic bead method of a silicon film, the extraction process of a single sample is not equal to 30-60 minutes, and the extraction process of 90 samples is about 60 minutes to 120 minutes. The above method for purifying nucleic acid may not be all target nucleic acid of interest, may contain other DNA and RNA, such as genome DNA, tRNA, rRNA, mRNA in exfoliated cells in respiratory tract and oral cavity of patients, and may be nucleic acid of other microorganisms, because the above extraction kit is generally aimed at total RNA, total nucleic acid, total DNA, or total viral RNA and DNA, i.e. contains non-target nucleic acid with high abundance.

The invention provides a pretreatment process for magnetic capture of a specific target to replace the traditional nucleic acid extraction and purification process, and aims to provide a method which has short pretreatment time, no proteinase K and specific capture such as 2019-nCoV.

The method of the present invention for capturing purified 2019-nCoV from a "sample" that has been treated with a sample inactivating lysis reagent comprises the steps of:

1) Providing a solid phase carrier connected with a specific capture probe, wherein the solid phase carrier is formed by gamma Fe ₂ O ₃ And Fe (Fe) ₃ O ₄ The magnetic material is synthesized into uniform, superparamagnetic and monodisperse polymeric microspheres. Preferably, each microsphere is coatedOne or more layers of polymeric materials can be prepared by emulsion polymerization, soap-free polymerization, dispersion polymerization or seed swelling polymerization, and finally the magnetic polymer microsphere is formed, and the surface of the magnetic polymer microsphere is modified with active groups such as carboxyl, amino, epoxy, tosyl, chloromethyl and the like or streptavidin. Preferably, the magnetic polymer microsphere has a particle size of 0.1-10 μm, more preferably 0.5-5 μm, such as Dynabeads M270 strepitavidins, dynabeads MyOne Streptavidin T, merckCarboxyl magnetic beads M1-200/20, merck +.>Amino magnetic beads M2-070/40, agilent LodeStars 2.7Carboxyl, etc. can be used in the present invention.

The magnetic polymer microsphere (sometimes called a magnetic bead) can be connected with an intermediate probe through a surface active group or streptavidin, the 5 'modified non-nucleotide unit of the intermediate probe can be in affinity binding or covalent binding with the magnetic bead, the 5' non-nucleotide unit can be aminated if a carboxyl magnetic bead is used, the covalent coupling can be performed through a carbodiimide method, the 5 'modified non-nucleotide unit can be biotin if the streptavidin modified magnetic bead is used, and the 3' modified oligonucleotide of the intermediate probe can be Oligo dT or Oligo dU. The choice of Oligo dT or dU used depends on the downstream use of the isolated target nucleic acid of interest, and Oligo dU bound to a vector can be used for applications containing dA-terminated probes or target nucleic acids, similar to Oligo dT, but with the further advantage that Us provide a glycosylation site. In a preferred embodiment, the Oligo dT/dU construct further comprises another nucleotide sequence (designated "VN", wherein "V" is any nucleotide other than T (e.g., A, G, or C), "N may be any nucleotide within T"). This additional "VN" sequence aids in targeting or localization of Oligo dT/dU probe sequences to nucleic acid binding. It is advantageous that probe binding is localized at the boundary between the PolyA tail and the target nucleic acid target sequence.

The number of Oligo T or Oligo U of Oligo dT, oligo dU, oligo dT VN or Oligo dU VN of the intermediate probe of the present invention is preferably 5-100, more preferably, the number of Oligo T or Oligo U is 10-50, such as Oligo dT25, oligo dT30VN, oligo dT15VN, which are all within the scope of the present invention.

In the invention, if streptavidin magnetic beads are adopted, the intermediate probe can be 5' biotin Oligo (dT) ₁₅ 3’，5’biotin-PEG-Oligo(dT) ₁₈ 3’，5’biotin-Cn-Oligo(dT) ₂₅ VN 3', or 5' biotin-Cn-Oligo (dU) ₃₀ VN 3'. The molecular weight of the PEG may be 100-600, preferably 100-200.Cn refers to an alkylene group having n carbon atoms, n may generally be 2 to 12. For example, C ₆ Refers to an indirect arm of 6 carbons. PEG and Cn are both used to increase the length of their indirect arms, preferably between 5 and 50 a, such as between 10 and 30 a being preferred.

The invention uses carboxyl magnetic beads, the intermediate probe can be 5' NH ₂ -Cn-Oligo(dT) ₁₈ 3’，5’NH ₂ -PEG-Oligo (dT) ₂₅ 3 'or 5' NH ₂ -PEG-Oligo(dT) ₂₃ VN 3' and the like, the carboxyl magnetic beads and the aminated intermediate probes can be covalently bound by an EDC one-step method, an EDC/NHS two-step method or an EDC/SNHS two-step method, and the technology is easy to grasp for a person skilled in the art. The invention can also be covalently coupled to an intermediate probe by other activated or reactive functional groups such as tosyl, NHS, chloromethyl, azido, amino, epoxy, etc., where different types of functional groups are used, the 5' of the corresponding intermediate probe requires a covalent reaction pairing, such as selecting a carboxyl bead, the 5' of the intermediate probe is preferably amino, such as selecting an amino bead, the 5' of the intermediate probe is preferably carboxyl, preferably the invention selects a carboxyl bead or tosyl bead.

The group density of the intermediate probe on the magnetic beads is preferably controlled, regardless of which magnetic beads are used for covalent reaction or affinity ligation, e.g., the binding capacity of the magnetic beads is at least 100pmol/mg,200pmol/mg,300 pmol/mg,400pmol/mg,500pmol/mg, more preferably the binding capacity of the magnetic beads is at least 750pmol/mg, most preferably the binding capacity of the magnetic beads is at least 1200pmol/mg.

If more than one different type of binding ligand (referred to herein as an intermediate probe) is used, they may be attached to the same or different solid supports. Such a system using different solid supports is particularly suitable in the case of magnetic particles. Thus, different binding ligands may be attached to different magnetic beads. In embodiments where more than one different type of binding ligand is used, one skilled in the art will readily be able to determine the amount or ratio of use of the different types of binding ligands.

2) The magnetic bead is firstly connected with a section of intermediate probe and is combined with the capture probe through the intermediate probe, the combination mode of the intermediate probe and the capture probe is complementary combination, namely, 3' of the capture probe contains a section of A sequence and can be combined with Oligo T or Oligo U of Oligo dT, oligo dU, oligo dT VN or Oligo dUVN 5', the length of the Oligo A sequence of the capture probe is 10-50, the length of the more preferred Oligo A sequence is 10-30, the 5' sequence of the capture probe can be complementary with the specific sequence of 2019-nCoV target nucleic acid, the capture probe can be combined with the specific sequence of 2019-nCoV target nucleic acid, when the capture probe contains an internal standard, the capture probe can be combined with the internal standard sequence, a magnetic bead-intermediate probe-capture probe complex is formed, the complex has high specificity, the capture probe can capture 2019-nV from a sample, the magnetic bead can be directly eluted from the magnetic bead can be used for detecting other impurities, such as 2019-nCoV can be directly eluted from the magnetic bead, and the magnetic bead can be used for detecting other impurities, and the magnetic bead can be directly eluted from 2019-nCoV.

The capture probes for 2019-nCoV are respectively SEQ ID NO.3 as a specific sequence (5 'uacgaagucacuguaaaaaaaaaaaaaaaaaaaaaaaaaaa3') on the orf1ab gene, and SEQ ID NO.1 is uacgaagucagucgacuacguguu; SEQ ID NO.4 is a specific sequence (5'ccguuaccgccacuacgacgagaacg aaaaaaaaaaaaaaaaaaaaaaaaa3') at the position of the gene encoding the N protein, and SEQ ID NO.2 is ccguuaccgccacuacgacgagaacg. The number of 3' A-tails in SEQ ID No.3 and SEQ ID No.4 mentioned above is 10-30, and should not be strictly limited in the present invention, the capture probes are purified by PAGE or HPLC purification.

The capture probes of the present invention are bound to the intermediate probes in a ratio, the molar ratio of the intermediate probes to the capture probes should be 50:1 to 2:1, more preferably 25:1 to 3:1, most preferably 20:1 to 4:1. The intermediate probe of the present invention cannot be saturated with the capture probe, and the capture probe does not exceed 50% of the saturated binding capacity at most, i.e., if the binding capacity of the intermediate probe on the magnetic beads is 1000pmol/mg, in the experimental test, the addition amount of the capture probe cannot exceed 200pmol/mg at most if the highest binding capacity of the capture probe is 400 pmol/mg.

It is necessary in the present invention to have a certain amount of intermediate probe exposed to the outside, preferably, the amount of intermediate probe not bound to the capture probe needs to be more than 100pmol/mg, more preferably, more than 200pmol/mg, and these exposed intermediate probes can be effectively bound to 33A tails of the 3' -end of 2019-nCoV.

Thus, with knowledge of the presence of molecules or other entities on the surface of the target nucleic acid of interest, a combination or mixture of capture probes can be selected to effect separation or isolation of the target nucleic acid of interest from the sample. Advantageously, all or substantially all (i.e., nearly all) of the target nucleic acid of interest present in the sample can be isolated. The separation that can be achieved depends not only on the capture probes selected but also on the content of capture probes bound by the magnetic beads themselves, the nature of the magnetic beads (particle size, surface groups and hydrophilicity, etc.), and also on the nature of the sample, the binding conditions, etc. In addition, the nature of biological systems is variable, not always enabling 100% separation, in fact not necessary according to the invention; in any biological system, a certain tolerance must be allowed. In preferred embodiments of the invention, at least 40%, 50%, 60%, 75%, 80%, 90% or 95% of the target nucleic acids of interest present in the sample can then be isolated.

3) A kit for magnetic specific capture 2019-nCoV is provided to replace the traditional pretreatment step of nucleic acid extraction, and specific components comprise prepared magnetic bead-intermediate probe-capture probe complex (hereinafter referred to as capture magnetic bead), capture magnetic bead preserving solution, binding buffer solution, washing solution W1, washing solution W2 and eluent.

In the present invention, 20-1000. Mu.g of capture magnetic beads are used for 200-2000. Mu.L of inactivated lysis sample, which is required to contain the capture probe in an amount of 0.01-1. Mu.mol. The preservation solution for capturing the magnetic beads contains BSA and NaN with certain concentration ₃ And binding buffers, BSA and NaN ₃ The concentration of the magnetic beads in the stock solution is the same as that of the conventional magnetic beads, for example, the stock solution of magnetic beads produced by Invitrogen, promega, roche, etc. The binding buffer solution is favorable for capturing hybridization between the capture probe and the target nucleic acid, and consists of lithium chloride, lithium dodecyl sulfate, triton X-100, ethylenediamine tetraacetic acid, citric acid and deionized water, wherein the pH range is 6.0-8.0, and the content of each component is as follows: 0.02-5M lithium chloride, 0.02-5% lithium dodecyl sulfate, 0.05-5% Triton X-1000,1-100mM ethylenediamine tetraacetic acid, 0.02-0.2M citric acid. The components of the washing liquid W1 in the invention are as follows: 100mM succinate, 0.5% lithium dodecyl sulfate, 100mM LiOH, 15mM 2,2' -dithiodipyridine, 0.2M LiCl, 5mM EDTA, 5mM EGTA, 3% (v/v) absolute ethanol, pH6.5. The components of the washing liquid W2 are as follows: 20mM HEPES, 7.5mM NaOH, 1mM EDTA, 0.3% (v/v) absolute ethanol, 0.02% (w/v) methylparaben, 0.01% (w/v) propylparaben, 50mM lithium chloride, 0.1% sodium dodecyl sulfate, pH7.5. The complex of the captured magnetic beads and the target nucleic acid is washed and captured by the washing solutions W1 and W2, and finally the complex is eluted in an eluent, wherein the eluent can be 1mM EDTA,2mM sodium acetate mixed solution with pH of 6.5, or a conventional TE buffer or a Low TE buffer.

The use of reagents such as alcohols, chaotropic salts, organic solvents (e.g., phenol, isoamyl alcohol, and chloroform), and high salts in the separation process is sometimes disadvantageous. The invention has the characteristic that the use of these reagents can be avoided, or very small amounts of the above reagents can be used, and in traditional nucleic acid extraction, chaotropic salts at high concentrations are used in combination with an alcohol, often isopropanol, and washing is performed with 70% ethanol, 75% ethanol or 80% ethanol. Although these agents described above may also be used in the present invention, in an advantageous embodiment of the present invention, these agents are not substantially used.

The invention is not a traditional nucleic acid extraction step, so that no extra lysate is needed, another advantage is additionally added on the basis of saving time, the sample loading amount is increased, the traditional method generally takes 200-400 mu L of swab preservation solution, then the equivalent volume of lysate and a certain amount of binding solution are added, the whole system is nearly 1mL, and more than 1mL is not suitable for a 96-bit automatic workstation (using 96-well plate operation), and the invention can greatly increase the template amount in the PCR process by increasing the sample loading amount of the swab preservation solution by about 2 times because the small amount of capture magnetic beads and binding buffer solution are selected and added without adding the lysate in the capture stage.

The method for specifically enriching the target nucleic acid by utilizing the capture magnetic beads is favorable for automation, and particularly when magnetic particles are used as solid-phase carriers. In a particularly advantageous embodiment of the invention, a method for magnetic capture separation of nucleic acids is achieved using an automated system for targeted capture with nucleic acids after viral lysis and handling of solid phase carriers during washing and elution steps. For example, the target nucleic acid separated from the carrier may be transferred to an automated system in which magnets are present to transfer magnetic particles, binding, washing, elution may be performed, the target nucleic acid may be bound to the carrier, and unbound nucleic acids or proteins may be easily washed using such an automated device, depending on the specific steps of the method and the specific carrier and conditions used. In addition, the device can also be used for treating the cracking and inactivating treatment process of the sample. Thus, it can be seen that all steps of the method can be optionally selected to be automated.

The invention also provides a real-time fluorescent nucleic acid isothermal amplification detection kit, which comprises a special primer, a probe, a kit and use thereof.

After pretreatment, amplification of 2019-nCoV target nucleic acids is achieved by using primers that define the 5 'and 3' ends of the region amplified by in vitro enzyme-mediated nucleic acid synthesis to produce amplicons (sometimes referred to as amplification products). The present invention preferably uses a real-time fluorescent isothermal amplification detection technique (Simultaneous Amplification and Testing, SAT) method that can produce large amounts of detectable amplification products (RNA transcripts), a technique of isothermal amplification. The primer combination comprises a promoter primer (forward primer) based on a promoter sequence and a reverse primer based on a non-promoter sequence. Preferably, the forward primer based on the promoter sequence is a promoter primer comprising a 5'rna polymerase promoter sequence and a 3' target binding sequence, i.e., a forward primer. RNA polymerase promoter sequences are known in the art to include, but are not limited to, sp6 RNA polymerase promoter sequences, T3 RNA polymerase promoter sequences, and T7 RNA polymerase promoter sequences. In preferred embodiments, the promoter primer comprises a 5't7 RNA polymerase promoter sequence and a 3' target binding sequence. Most preferably, the 5' T7 RNA polymerase promoter sequence is TAATACGACTCACTATAGGGAGA (as shown in SEQ ID NO. 5).

Further, the detection kit also comprises an amplification reaction reagent and/or a mixed enzyme reagent. For example, a typical 25. Mu.L amplification reaction system can use 12.5. Mu.L amplification reaction reagent, 2.5. Mu.L primer probe mixture, and 5.0. Mu.L mixed enzyme reagent, with a target nucleic acid addition of 5. Mu.L and a total reaction system of 25. Mu.L.

The 2 x amplification reaction buffer composition of the present invention is: 10.5mM Tris-HCl, 15.2mM MgCl ₂ 0.2% PVP 40, 13.5mM KCl, 2.5% glycerol, 0.05mM zinc acetate dihydrate, 0.725mM dNTPs each, 5.56mM NTP each, pH7.0.

The detection liquid comprises the following components: the 2019-nCoV amplification primer and the 2019-nCoV detection probe are dissolved in TE solution (10mM Tris,1mM EDTA,pH7.5) to prepare the primer and the probe, and the concentration of each primer and probe can be 5-10 pmol/reaction; wherein the concentration of the T7 promoter primer is preferably 6.5 pmol/reaction, and the concentration of the detection probe is preferably 5.5 pmol/reaction.

The mixed enzyme reagent of the present invention comprises 500-1000U of T7 RNA polymerase, 1000-2000U of reverse transcriptase, 15mM HEPES, 50mM N-acetyl-L-cysteine, 1mM EDTA, 0.05% (w/v) sodium azide, 1% Triton X-100, 50mM KCl, 20% (v/v) glycerol, 200mM trehalose dihydrate, pH7.0. The present invention is preferably mixed with target nucleic acids retained on the capture magnetic beads. The primers and probes used for amplification detection can be as follows:

SEQ ID NO.6 ORF1ab reverse primer sequence: TGTGACTTAAAAGGTAAGTATGTA;

SEQ ID NO.7 ORF1abT7 promoter primer: TAATACGACTCACTATAGGGAGAACGATTGTGCATCAGCTGA;

SEQ ID NO.10 ORF1ab probe sequence: 5'-acacagucuguaccgucugcggugugu-3' the ORF1ab probe is 5'FAM-acacagucuguaccgucugcggugugu-3' DABCYL.

SEQ ID NO. 8. N reverse primer sequence: TTCCTCATCACGTAGTCGCAACAG

SEQ ID NO. 9N promoter primer: TAATACGACTCACTATAGGGAGACAGACATTTTGCTCTCAAGCTG

SEQ ID NO. 11N probe sequence: 5'-aauggcggugaugcugcucuugcuuugccauu-3' the N probe is 5'VIC-aauggcggugaugcugcucuugcuuugccauu-3' DABCYL.

Examples

For a further understanding of the present invention, preferred embodiments of the invention are described below in conjunction with the examples, but it should be understood that these descriptions are merely intended to illustrate further features and advantages of the invention, and are not limiting of the claims of the invention. The experimental methods described in the following examples are all conventional methods unless otherwise specified; such materials, unless otherwise specified, are commercially available.

Example 1:

preparing an inactivated lysate:

the inactivated lysate is prepared by deionized water according to the following components and concentrations: 0.2M ammonium salt, 2M guanidine isothiocyanate, 0.5M lithium chloride, 20mM ethylenediamine tetraacetic acid, 50mM ethylene glycol bis (2-aminoethylether) tetraacetic acid, 0.2% Triton X-100, 0.5% lithium dodecyl sulfate, 50mM ascorbic acid, 0.5% dithiothreitol, 100mM HEPES buffer, pH5.5.

Pseudoviruses of known concentration were added to 200. Mu.L of the inactivated lysate and PBS solution, respectively, and after shaking at room temperature for 20 minutes, invitrogen was used ^TM Dynabeads provided ^TM SILANE Viral NA Kit verification that Invitrogen was no longer added to the inactivated lysate already used ^TM The lysis reagent in the kit, without using the lysis solution and the lysis step of the kit, directly extracts and detects by conventional RT-PCR, and the results show that the two are not significantly different, which proves that the inactivated lysis reagent of the embodiment 1 can fully lyse pseudoviruses and release target RNA. Meanwhile, the inventor and the conventional VTM virus preservation solution are subjected to 25-DEG C stability test verification. The verification result shows that the sample inactivating and cracking reagent has better protection effect on the viral RNA (table 1).

TABLE 1 stability test of inactivated lysate against RNA

Sample of	Immediate detection	For 1 day	For 2 days	For 3 days
					The invention inactivates the lysate	26.7	26.8	27.1	27.4
Invitrogen kit lysate	27.1	27.8	28.9	34.0
					VTM virus preservation solution	26.6	28.9	31.5	35.2

Example 2: synthesis of intermediate probe sequences

The principal bioengineering (Shanghai) limited synthesized SEQ ID nos. 3 to 11 and the following intermediate probe sequences:

5’biotin Oligo(dT) ₁₅ 3’

5’biotin-C6-Oligo(dT) ₂₅ VN 3’

5’NH ₂ -C6-Oligo(dT) ₃₀ 3’

example 3: preparation of Capture MB-1

10mg Dynabeads MyOne Streptavidin T1 (from Invitrogen) was washed twice with PBS, resuspended in 500. Mu.L of 5 XSSC buffer, and 10. Mu. Mol of 5' biotin Oligo (dT) was added ₁₅ 3', after 30 minutes of reaction at room temperature, magnetically separating, and detecting the residual probe content in the supernatant. The bead-intermediate probe was washed 5 times with 2 XSSC buffer, mostFinally, the mixture is stored in PBS buffer containing 0.1% preservative and 0.05% Tween20 for temporary storage, the probe content on the magnetic beads is detected to be 935pmol/mg, 800pmol SEQ ID NO.3 and 800pmol SEQ ID NO.4 are added into the buffer of the 10mg magnetic bead-intermediate probe, after 30 minutes of reaction at room temperature, magnetic separation is carried out, the residual probe content in supernatant detection is zero, namely all Capture probes are bound to the surfaces of the magnetic beads, and the Capture magnetic bead Capture MB-1 is prepared.

Example 4: preparation of Capture MB-2

Using a procedure consistent with example 3, 10mg Dynabeads MyOne Streptavidin T1 was also used, but the intermediate probe was replaced with 5' biotin-C ₆ -Oligo(dT) ₂₅ VN 3' was saturated and the binding capacity was calculated to be 712pmol/mg, 600pmol SEQ ID NO.3 and 600pmol SEQ ID NO.4 were added to the above-mentioned 10mg bead-intermediate probe buffer, and the Capture probe content in the supernatant was detected to be zero, thus preparing Capture bead Capture MB-1.

Example 5: preparation of Capture MB-3

Using 10mg MerckThe carboxyl magnetic beads M1-200/20 were washed twice with deionized water and twice with PBS, resuspended in 1mL 50mM MES pH6.0 buffer, and 10. Mu. Mol of 5' NH was added ₂ -C ₆ -Oligo(dT) ₃₀ After 3' mixing for 30 minutes at room temperature, adding 100. Mu.L of 100mg/mL EDC solution (dissolved in MES solution in advance) which is freshly prepared, continuing to react for 1 hour, magnetically separating and removing supernatant (the supernatant is required to be tested for nucleic acid concentration), adding 1mL of 1M Tris-HCl pH7.2 to seal for 2 hours, finally washing 5 times by using 2 XSSC to obtain a magnetic bead-intermediate probe complex, calculating the binding capacity of the intermediate probe to be 1650pmol/mg, adding 1200pmol SEQ ID NO.3 and 1200pmol SEQ ID NO.4 into the buffer of 10mg of the magnetic bead-intermediate probe, and detecting the content of the Capture probe in the supernatant to be zero, thus preparing the Capture magnetic bead Capture MB-3.

Example 6: kit pretreatment reagent for magnetic specificity capturing 2019-nCoV

Magnetic bead suspension: 2mg/mL Capture beads (Capture MB-1, capture MB-2 or Capture MB-3) dissolved in 0.05% NaN ₃ In 0.5% BSA in 2 XSsX buffer.

Binding buffer: 1M lithium chloride, 1% lithium dodecyl sulfate, 0.5% Triton X-1000, 50mM ethylenediamine tetraacetic acid, 0.2M citric acid, pH6.5.

Washing solution W1:100mM succinate, 0.5% lithium dodecyl sulfate, 100mM LiOH, 15mM 2,2' -dithiodipyridine, 0.2M LiCl, 5mM EDTA, 5mM EGTA, 3% (v/v) absolute ethanol, pH6.5

Washing solution W2:20mM HEPES, 7.5mM NaOH, 1mM EDTA, 0.3% (v/v) absolute ethanol, 0.02% (w/v) methylparaben, 0.01% (w/v) propylparaben, 50mM lithium chloride, 0.1% sodium lauryl sulfate, pH7.5

For 1mL of the inactivated lysed sample, 100. Mu.L of 2mg/mL of capture magnetic beads, 200. Mu.L of binding buffer, and 500. Mu.L of wash solution W1 and wash solution W2 were used, and the volumes could be linearly increased or decreased with the loading volume of the inactivated lysed sample. The capture bead-target nucleic acid complex was finally dispersed in 50. Mu.L of 10mM Tris, pH7.2 for detection.

Example 7: SAT amplification

The 2 x amplification reaction buffer composition of the present invention is: 10.5mM Tris-HCl, 15.2mM MgCl ₂ 0.2% PVP 40, 13.5mM KCl, 2.5% glycerol, 0.05mM zinc acetate dihydrate, 0.725mM dNTPs each, 5.56mM NTP each, pH7.0.

The detection liquid comprises the following components: the primer concentration was 6.5 pmol/reaction, and the detection probe concentration was 5.5 pmol/reaction.

The mixed enzyme reagent of the present invention comprises 1000U of T7 RNA polymerase, 1500U of reverse transcriptase, 15mM HEPES, 50mM N-acetyl-L-cysteine, 1mM EDTA, 0.05% (w/v) sodium azide, 1% Triton X-100, 50mM KCl, 20% (v/v) glycerol, 200mM trehalose dihydrate, pH7.0.

A typical 25. Mu.L amplification reaction solution used was 12.5. Mu.L amplification reaction buffer, 2.5. Mu.L primer probe mixture and 5.0. Mu.L mixed enzyme reagent, and the target nucleic acid addition amount was 5. Mu.L, and the total reaction system was 25. Mu.L.

Taking 5 mu L of complex suspension of the capture magnetic bead-target nucleic acid into a new micro-reaction tube, and preserving heat at 60 ℃ for 10 minutes and at 42 ℃ for 5 minutes; meanwhile, the mixed enzyme reagent is preheated to 42 ℃,5 mu L of the magnetic bead-target nucleic acid capturing compound, 5.0 mu L of the mixed enzyme reagent, 5 mu L of primer probe mixed liquid and 12.5 mu L of amplification reaction buffer are added, a micro-reaction tube is quickly transferred to a proper constant temperature fluorescence detection instrument for reacting for 42 minutes at 42 ℃, and fluorescence is detected every 1 minute and 60 times.

Threshold setting: the highest point of the normal negative control amplification curve is just exceeded with the threshold line. The dt value is read, and dt represents the abscissa reading (similar to the ct value of the general real-time fluorescent PCR experiment result) of the intersection of the sample curve and the threshold line.

The results were determined as follows: the N gene and the OFR1ab gene are positive at the same time, and the sample is proved to be positive; the N gene and the OFR1ab gene are negative at the same time or negative and positive at the same time, and the sample is proved to be negative.

Positive judgment of N gene and OFR1ab tube, positive sample with dt less than or equal to 35, and detection of 35-42 sample is recommended, and negative sample with dt no value or 42.

Example 8: sensitivity detection of detection kit

Using a pseudovirus sample containing the N gene and the ORF1ab gene (1X 10 ⁶ Mu L) was diluted according to a 10-fold gradient, 1mL was added to the inactivated lysate, capture magnetic beads were treated according to example 6 using Capture MB-3 prepared in example 5, SAT amplification was performed according to example 7, and the results showed that the whole reagent could reach 25 copies/reaction to ORF1ab gene and 50 copies/reaction to N gene as shown in FIGS. 1, 2 and 3, indicating that the kit had very good sensitivity.

The above description of the embodiments is only for aiding in the understanding of the method of the present invention and its core ideas. It should be noted that it will be apparent to those skilled in the art that various modifications and adaptations of the invention can be made without departing from the principles of the invention and these modifications and adaptations are intended to be within the scope of the invention as defined in the following claims. The previous description of the disclosed embodiments is provided to enable any person skilled in the art to make or use the present invention. Various modifications to these embodiments will be readily apparent to those skilled in the art, and the generic principles defined herein may be applied to other embodiments without departing from the spirit or scope of the invention. Thus, the present invention is not intended to be limited to the embodiments shown herein but is to be accorded the widest scope consistent with the principles and novel features disclosed herein.

Although embodiments of the present invention have been disclosed above, it is not limited to the use of the description and embodiments, it is well suited to various fields of use for the invention, and further modifications may be readily apparent to those skilled in the art, and accordingly, the invention is not limited to the particular details without departing from the general concepts defined in the claims and the equivalents thereof.

SEQUENCE LISTING

<110> Suzhou Chalk Biotech Co., ltd

<120> virus sample inactivation and lysis kit and application thereof

<130> GY20100860F

<160> 11

<170> PatentIn version 3.5

<210> 1

<211> 24

<212> RNA

<213> Synthesis

<400> 1

uacgaaguca gucgacuacg uguu 24

<210> 2

<211> 26

<212> RNA

<213> Synthesis

<400> 2

ccguuaccgc cacuacgacg agaacg 26

<210> 3

<211> 50

<212> RNA

<213> Synthesis

<400> 3

uacgaaguca gucgacuacg uguuaaaaaa aaaaaaaaaa aaaaaaaaaa 50

<210> 4

<211> 51

<212> RNA

<213> Synthesis

<400> 4

ccguuaccgc cacuacgacg agaacgaaaa aaaaaaaaaa aaaaaaaaaa a 51

<210> 5

<211> 23

<212> DNA

<213> Synthesis

<400> 5

taatacgact cactataggg aga 23

<210> 6

<211> 24

<212> DNA

<213> Synthesis

<400> 6

tgtgacttaa aaggtaagta tgta 24

<210> 7

<211> 42

<212> DNA

<213> Synthesis

<400> 7

taatacgact cactataggg agaacgattg tgcatcagct ga 42

<210> 8

<211> 24

<212> DNA

<213> Synthesis

<400> 8

ttcctcatca cgtagtcgca acag 24

<210> 9

<211> 45

<212> DNA

<213> Synthesis

<400> 9

taatacgact cactataggg agacagacat tttgctctca agctg 45

<210> 10

<211> 27

<212> RNA

<213> Synthesis

<400> 10

acacagucug uaccgucugc ggugugu 27

<210> 11

<211> 32

<212> RNA

<213> Synthesis

<400> 11

aauggcggug augcugcucu ugcuuugcca uu 32

Claims (4)

1. A kit for inactivating and lysing a virus sample, comprising the following reagents for preparing an inactivating lysate: ammonium salt, guanidine isothiocyanate, lithium chloride, ethylenediamine tetraacetic acid, ethylene glycol bis (2-aminoethyl ether) tetraacetic acid, surfactant, ascorbic acid, dithiothreitol and buffer; wherein:

the ammonium salt is selected from the group consisting of ammonium sulfate, ammonium carbonate, ammonium chloride, ammonium bromide, and ammonium iodide;

The surfactant is a combination of lithium dodecyl sulfate and Triton X-100;

the inactivated lysate is formulated with water and comprises 0.1-0.2M of the ammonium salt, 2M guanidine isothiocyanate, 0.1-0.5M lithium chloride, 20-50mM ethylenediamine tetraacetic acid, 50mM ethylene glycol bis (2-aminoethylether) tetraacetic acid, 0.2% triton x-100,0.5% lithium dodecyl sulfate, 10-50mM ascorbic acid, 0.5% dithiothreitol, 20-100mM HEPES and the balance water;

the pH value of the inactivated lysate is 5-6.5.

2. The inactivated lysis kit according to claim 1, wherein:

the ammonium salt is ammonium chloride.

3. The inactivated lysis kit according to claim 1, wherein:

HEPES concentration is 50-100mM.

4. A kit for virus inactivation, capture and real-time fluorescent isothermal amplification detection, characterized in that the kit comprises;

(1) The viral sample inactivation lysis kit of any one of claims 1 to 3;

(2) A target nucleic acid magnetic capture reagent or target nucleic acid capture kit;

(3) Real-time fluorescent nucleic acid isothermal amplification detection kit.