CN112501166A

CN112501166A - Chemically modified high-stability RNA, kit and method

Info

Publication number: CN112501166A
Application number: CN202011331555.6A
Authority: CN
Inventors: 黄震; 罗光成; 张军
Original assignee: Sentinall Biotechnologies Inc; Sichuan University
Current assignee: Sentinall Biotechnologies Inc; Sichuan University
Priority date: 2020-11-24
Filing date: 2020-11-24
Publication date: 2021-03-16

Abstract

The invention discloses a chemically modified high-stability RNA, a kit and a method, wherein oxygen atoms in phosphate of the high-stability RNA are replaced by S or Se. The invention adopts high-stability RNA as positive or negative control of molecular detection and molecular research, the high-stability RNA is selenophospholipid RNA, phosphorothioate RNA or selenophosphonothioate RNA, Se-RNA, S-RNA or Se-S-RNA can be used as a good template of reverse transcription, and the RNA not only has good thermal stability, biological stability, stability of resisting nuclease hydrolysis and chemical stability, but also has molecular selection, exclusivity and specificity, which shows that the RNA has great potential and application prospect when being used as positive and negative control of a nucleic acid detection system and molecular research, and at least one of the RNA is the high-stability RNA in the positive and negative control of the molecular detection and molecular research.

Description

Chemically modified high-stability RNA, kit and method

Technical Field

The invention relates to a high-stability RNA, in particular to a chemically modified high-stability RNA, a kit and a method.

Background

Nucleic acid detection is an important means for diagnosing infectious diseases, genetic diseases, tumors and other diseases, such as the detection and diagnosis of new coronavirus. Early diagnosis of COVID-19 is critical to the prevention and control of this global epidemic.

Real-time reverse transcription polymerase chain reaction (RT-PCR) is generally considered the most effective strategy for diagnosing COVID-19. However, recent studies have found that the results provided by current RT-PCR kits are not satisfactory due to the large number of false negative results (approximately 40%). False negative results are extremely dangerous and may cause a number of problems in COVID-19 prevention and epidemic control. Since this pathogen is extremely contagious and fatal, people with false negative results easily infect other people around, resulting in widespread spread of the virus and serious influence on the human mouth. False negative results are typically caused by improper collection, transportation, storage, and/or handling of the sample, rather than the test kit itself. However, problematic RT-PCR kits, such as those with inadequate controls and failed reverse transcription, may also result in false negatives.

RT-PCR is one of the most widely used RNA detection methods in basic research and disease diagnosis, and is divided into two steps: (1) reverse transcription; and (2) quantitative real-time polymerase chain reaction. Although it can in fact detect RNA as rapidly and sensitively as DNA, RNA is susceptible to RNase degradation, resulting in its inherent instability (J.Houseley, D.Tollervey, The many pathways of RNA degradation, Cell 136(4) (2009) 763-76). Worse yet, rnases are almost ubiquitous in the surrounding environment and are difficult to eliminate, and they can rapidly degrade RNA, including RNA samples and RNA controls. Although in theory RNA should be a positive control, in commercial RT-PCR kits DNA is often used in practice as a positive control to avoid RNA biodegradation and to face the challenge of producing large quantities of inactivated or recombinant virus in a short time. However, the positive control DNA fails to check and report RT-PCR kits where the reverse transcription step fails, thereby creating a high risk of false negative results, e.g., false negatives of RNA, in disease diagnosis based on RNA detection. Therefore, for the detection of viral RNA using RT-PCR kits, appropriate controls are of crucial importance, and any problematic kit should be identified and reported from the positive control. Similarly, RT-LAMP isothermal nucleic acid amplification (Reverse transcription Loop-mediated isothermal amplification) for RNA detection is also at risk of false negatives.

If not strictly controlled, designed and maintained in RT-PCR detection, aerosol and/or surface cross contamination and signal misdetection can easily occur, increasing the risk of false positives. Negative controls are aimed at monitoring contamination and false detections, while negative controls often select high purity water, non-specific RNA is theoretically a better choice, especially to monitor false detections. However, when non-specific RNA is selected, exclusivity (or exclusive specificity) is critical for the negative control, in addition to stability requirements.

Disclosure of Invention

The invention aims to provide a chemically modified high-stability RNA, a kit and a method, which solve the problem that the conventional RT-PCR detection adopts DNA as a control to easily cause a false negative result, and avoid the false negative result in the RT-PCR detection by using the high-stability RNA as a positive or negative control.

In order to achieve the above objects, the present invention provides a chemically modified high stability RNA, wherein oxygen atoms in phosphate of the high stability RNA are replaced by S or/and Se, and the structural formula of the chemically modified high stability RNA is represented by formula (1):

wherein X represents an S atom or a Se atom;

represents structural repetition; base represents a Base including: adenine, guanine, cytosine and uracil.

Preferably, the high-stability RNA is obtained by transcription using DNA as a template.

Preferably, the high-stability RNA is obtained by taking pCOVID-19 plasmid DNA as a template, carrying out PCR reaction by primers with nucleotide sequences shown as SEQ ID NO.5 and SEQ ID NO.6, and then transcribing.

Preferably, the high stability RNA is chemically synthesized.

Another object of the present invention is to provide an RT-PCR kit for detecting COVID-19, wherein at least one of the negative and positive controls in the RT-PCR kit is the high stability RNA of any one of claims 1 to 4.

Another objective of the invention is to provide a method for preparing the high-stability RNA, which comprises the following steps: the high-stability RNA is obtained by using pCOVID-19 plasmid DNA as a template, using nucleotide sequences shown in SEQ ID.NO1 and SEQ ID.NO2 as primers and replacing oxygen atoms in phosphate of adopted ribonucleotides by S or Se through PCR reaction and transcription.

Preferably, the template is a DNA fragment of the pCOVID-19 plasmid with the T7 promoter.

Another objective of the invention is to provide a new method for detecting COVID-19 by RT-PCR or RT-LAMP, wherein at least one of the negative or positive control is the high-stability RNA.

Preferably, the RT-PCR amplification reaction system comprises: 10 Xbuffer, dNTPs, forward and reverse primers, molecular probe, Taq DNA polymerase, reverse transcriptase, RNA nucleic acid to be detected and ddH₂O; wherein, the nucleotide sequences of the forward primer and the reverse primer are respectively shown as SEQ ID NO.2 and SEQ ID NO. 3; the nucleotide sequence of the molecular probe is shown as SEQ ID NO. 4.

Preferably, the RT-LAMP isothermal amplification reaction system comprises: 10 Xbuffer, dNTPs, forward and reverse primers, inner and outer primers, BstDNA polymerase, reverse transcriptase, molecular probe, test RNA nucleic acid and ddH₂O; the nucleotide sequences of the forward primer and the reverse primer are respectively shown as SEQ ID NO.20 and SEQ ID NO. 21; the nucleotide sequences of the inner primer and the outer primer are respectively shown as SEQ ID NO.22 and SEQ ID NO. 23.

The chemically modified high-stability RNA, the kit and the method solve the problem that false negative results are easily caused by adopting DNA as a control in the conventional RT-PCR detection, and have the following advantages:

existing commercial RT-PCR kits typically employ DNA as a positive control, increasing the risk of false negatives. Furthermore, water is used as a negative control in RT-PCR assays, making it difficult to monitor contamination and false detections. The invention adopts high-stability RNA as positive or negative control, the high-stability RNA is selenium phosphate and phosphorothioate RNA (Se-RNA and S-RNA), the Se-RNA and the S-RNA can be used as good templates for reverse transcription, and the kit not only has good thermal stability, biological stability, anti-nuclease hydrolysis stability and chemical stability, but also has molecular selection, exclusivity and specificity, and shows that the kit has potential and application prospect when being used as the positive and negative control of an RT-PCR kit.

The high-stability RNA can also be used as a positive control in RT-LAMP nucleic acid detection, and the Se-RNA, the S-RNA and the Se-S-RNA are effective positive controls of RT-PCR and RT-LAMP kits, so that false negative results in RT-PCR and RT-LAMP detection can be reduced.

Drawings

FIG. 1 shows the result of the present invention using DNA from a commercial kit as a positive control for detecting COVID-19.

FIG. 2 shows the results of the detection of COVID-19 using the commercial Kit KitA of the present invention in different batches and the commercial Kit B.

FIG. 3 shows the results of the transcription, reverse transcription and RT-PCR assays of Se-RNA and S-RNA of the present invention.

FIG. 4 shows the comparison of thermal, biological and chemical stabilities of Se-RNA, S-RNA and Se-S-RNA and O-RNA of the present invention (the labeled and curved lines in the figure correspond to one from the top down).

Detailed Description

The technical solutions in the embodiments of the present invention will be clearly and completely described below, and it is obvious that the described embodiments are only a part of the embodiments of the present invention, and not all embodiments. All other embodiments, which can be obtained by a person skilled in the art without any inventive step based on the embodiments of the present invention, are within the scope of the present invention.

EXAMPLE 1 preparation of assay template and primers for COVID-19RNA

1. COVID-19RNA template to be detected

A DNA fragment carrying the T7 promoter and containing the COVID-19 target sequence was prepared by PCR from plasmid DNA containing the COVID-19 target sequence (pCOVID-19 plasmid; available from Sangon, Shanghai, China). COVID-19RNA (shown as SEQ ID NO. 1) is finally obtained through T7 transcription.

The COVID-19RNA is used as a template to be detected or RNA nucleic acid to be detected of RT-PCR. Clinical COVID-19RNA samples can also be used as a template to be tested for RT-PCR.

2. RT-PCR primers and probes

Designing a forward primer F, a reverse internal primer B and a Taqman probe, and finally obtaining the forward primer F, the reverse internal primer B and the Taqman probe through chemical synthesis, wherein the specific sequences are as follows:

a forward primer F: GGGGAACTTCCTGCTAGAAT (SEQ ID NO. 2);

reverse inner primer B: GAGACATTTTGCTCTCAAGCTG (SEQ ID NO. 3);

taqman probe: 5' FAM-TTGCTGCTGCTTGACAGATT (SEQ ID NO. 4).

EXAMPLE 2 detection of COVID-19 Using a commercial kit

1. Positive control for commercial RT-PCR kit

For the detection of COVID-19RNA, 6 commercial RT-PCR kits were used for real-time RT-PCR detection, and appropriate amounts of reaction mixtures (including buffers, enzymes, primers and probes, self-contained in the kit) were prepared according to the amounts of the sample (COVID-19RNA nucleic acid to be detected), positive control and negative control. Then, a pipette template (5. mu.L) and a reaction mixture (20. mu.L) were transferred to each reaction tube, and the reaction solution was mixed and centrifuged at low speed, and finally RT-PCR amplification was performed.

Specifically, the RT-PCR amplification reaction system is as follows: 10 Xbuffer Buffer, 0.2mM dNTP (including dATP, dTTP, dCTP and dGTP), forward and reverse primers each 0.2. mu.M, Taq DNA polymerase 2.5U, reverse transcriptase 1U, appropriate amount of RNA nucleic acid to be detected, and then ddH is supplemented₂O to 25. mu.L. When detecting a sample, a positive control and a negative control (carried in the kit) are arranged at the same time.

Specifically, the RT-PCR amplification reaction process comprises the following steps: (1) reverse transcription reaction: 5min at 42 ℃; 95 ℃ for 10 sec; (2) and (3) PCR reaction: 95 ℃ for 5 sec; 60 ℃, 20 sec; repeat 45 cycles. The fluorescence change of the reaction system was monitored in real time using a fluorescence PCR instrument (fluorescence signal was collected once per cycle).

2. Positive control for RNaseA digestion

The positive control DNAs of the 6 commercial RT-PCR kits were digested with RNaseA, respectively, and then subjected to RT-PCR analysis using the corresponding RT-PCR kits.

The digestion process is as follows: in a Reaction medium containing 20. mu.L of positive control, 17. mu.L of LRNase A and 2. mu.L of Reaction Buffer (Reaction Buffer:100mM Tris-HCl, 25mM MgCl)₂、5mM CaCl₂pH 7.6) and incubated at 37 ℃ for 30 minutes. Then inactivated at 80 ℃ for 5 minutes.

3. Positive control for DNase I digestion

The positive controls of the 6 commercial RT-PCR kits were digested with DNase I, respectively, and then analyzed by RT-PCR using the corresponding RT-PCR kits.

The digestion process is as follows: digestion was performed in a reaction mixture containing 20. mu.L of positive control, 1. mu.L of DNase I and 2. mu.L of reaction buffer and incubation at 37 ℃ for 30 min. Then inactivated at 80 ℃ for 5 minutes.

4. Comparison of RT-PCR detection results

As shown in fig. 1, which is a comparison of RT-PCR results of 6 commercial RT-PCR positive controls after no treatment and enzymatic digestion treatment, a-F are six commercial RT-PCR positive controls, and in each figure, the positive and negative controls are from the respective kits, wherein curve 1: RT-PCR of undigested positive controls; curve 2: RT-PCR of positive controls digested with RNaseA; curve 3: RT-PCR of positive controls digested with DNase I; curve 4: and (5) negative control. As can be seen from FIG. 1, the positive controls of all 6 commercial RT-PCR kits were digested by DNase I and resistant to RNase A, indicating that all the positive controls used in all 6 commercial RT-PCR kits were DNA.

EXAMPLE 3 commercial kit KitA detects COVID-19RNA

A sample of COVID-19 viral RNA (COVID-19RNA) was detected using Batch 1(KitA, Batch-1) of the commercial kit KitA, and its positive control DNA was used as a reference. As shown in fig. 2, the results of the measurements of the different batches of the commercial Kit KitA and the commercial Kit B are shown, in each of which, curve 1: COVID-19 positive RNA sample 1; curve 2: COVID-19 positive RNA sample 2; curve 3: positive control of the corresponding kit; curve 4: negative control of the corresponding kit. As can be seen from the figure, while the DNA control reported positive results as usual, batch 1 of the commercial kit KitA failed to report positive results for these positive viral RNA samples, indicating that the reverse transcription step in RT-PCR was not effective, but both DNA polymerization and PCR reactions were running normally. The integrity of these RNA samples was confirmed by commercial kit B (table 1 and fig. 2), and experimental results showed that the kit with a DNA positive control resulted in false negatives, with the problem of failure of reverse transcription, indicating that DNA as a positive control is not an ideal strategy for RT-PCR kits and the use of an RNA positive control may be a better choice.

Table 1 shows the results of false negative detection of COVID-19RNA using a commercial kit

Note: all were repeated five times, and the results were consistent; the Ct value represents the number of cycles that the fluorescence signal in each reaction tube has undergone to reach a set threshold value; COVID-19RNA sample 1 and COVID-19RNA sample 2 were prepared by the method described in Experimental example 1.

Experimental example 4 preparation of S-RNA and Se-RNA of the present invention

For transcription of Se-RNA and S-RNA, PCR amplification reaction was performed using pCOVID-19 plasmid as template, primer F: 5'-taatacgactcactatagCTCTTCTCGTGTCTCTCATC-3' (SEQ ID NO.5), primer B is: 5'-GCAGCAGATTTCTTAGTG-3' (SEQ ID NO.6), and the T7 promoter was introduced into the product DNA (210 bp in the N gene of COVID-19). Then, four NTP α Se (Se-modified NTPs), four NTP α S (S-modified NTPs), or a mixture of the two modified NTPs (purchased from SeNtInAill, YouOeve, China) were used, respectively, and T7 RNA transcriptase was used to prepare Se-RNA and S-RNA. All four selenium and sulfur modified NTPs (NTP α Se and NTP α S) can produce more stable RNA by T7 RNA polymerase, as follows:

after transcription, each product (1 μ L) was analyzed by denaturing polyacrylamide gel electrophoresis (12% PAGE) and visualized by gel imager with GelRed staining.

Experimental example 5 reverse transcription of S-RNA and Se-RNA of the present invention

Reverse transcription experiments were performed using the high stability RNA prepared in the present invention (Se-RNA or S-RNA prepared in Experimental example 4) and MLV reverse transcriptase, as follows:

Se-RNA or S-RNA (final concentration: 1. mu.M), 5 '-FAM-labeled primer (1. mu.M) (5' FAM-GCAGCAGATTTCTTAGTG, SEQ ID NO.6), dNTPs (100. mu.M), 10U MLV reverse transcriptase, 2U RNase inhibitor and 1 XT Buffer were incubated at 55 ℃ for 60 minutes. The reaction was then quenched with urea-saturated loading buffer and the product was analyzed by denaturing PAGE (12%).

Se-RNA and S-RNA transcripts were shown in FIG. 3 (lane 1: DNA template; lane 2: Se-RNA transcribed before DNase I digestion; lane 3: Se-RNA transcribed after DNase I digestion; lane 4: S-RNA transcribed before DNase I digestion; lane 5: S-RNA transcribed after DNase I digestion), indicating high stability of Se-RNA and S-RNA of the present invention.

As shown in B in FIG. 3 (lane 1: FAM-labeled primer; lane 2: S-RNA was used as a template for reverse transcription of cDNA; lane 3: Se-RNA was used as a template for reverse transcription of cDNA), Se-RNA and S-RNA of the present invention can be efficiently recognized by MLV reverse transcriptase, thereby producing cDNA. Furthermore, as shown in FIG. 3C, it was revealed that both Se-RNA and S-RNA of the present invention can be amplified and detected by RT-PCR. As shown in Table 2, it can be seen that the detection limits of Se-RNA and S-RNA of the present invention are similar to those of O-RNA (i.e., unmodified COVID-19RNA), which further indicates that Se-RNA, S-RNA and Se-S-RNA of the present invention can be used as positive controls.

TABLE 2 sensitivity of detection of Standard RNA and modified RNA

EXAMPLE 6 stability of S-RNA and Se-RNA of the present invention

Stability (biostability and thermostability) is the most important attribute of positive RNA control, and the Se-RNA, S-RNA and Se-S-RNA of the present invention were compared with standard RNA (O-RNA) to verify the stability of the S-RNA and Se-RNA of the present invention, and the primer set and probe used were as shown in Experimental example 1.

1. Thermal stability

After 1 hour of incubation at various temperatures (55-95 ℃), O-RNA was significantly decomposed at higher temperatures, while Se-RNA was hardly affected, S-RNA remained stable, and the RNA of the present invention showed no significant change in RT-PCR detection and Ct value, indicating that Se-RNA and S-RNA of the present invention have excellent thermal stability (see fig. 4 a-C, which are thermal stabilities of Se-RNA, S-RNA and O-RNA at room temperature, 55, 72 and 95 ℃ for 1 hour, respectively), in the order of thermal stability: Se-RNA > S-RNA > > O-RNA.

2. Biological stability

Referring to D-F of FIG. 4 (D-F is the biostability of Se-RNA, S-RNA and O-RNA after RNase-T1, serum and saliva treatment, respectively), RNase T1, serum and saliva hardly affect Se-RNA and S-RNA when RNase T1 (ribonuclease T1), serum and saliva treatment, respectively, and the biostability is in the order: Se-RNA > S-RNA > > O-RNA.

3. Chemical stability

Referring to FIG. 4, G-I, which depicts the chemical stability of Se-RNA, S-RNA and O-RNA, respectively, stored at 4 ℃ for 0-30 days, the Se-RNA and S-RNA and O-RNA of the present invention are stored at 4 ℃ for 0-30 days, indicating the order of chemical stability: Se-RNA > S-RNA > > O-RNA.

Experimental example 7S-RNA and Se-RNA of the present invention as negative controls

8 sets of non-specific primers are designed to verify the exclusivity of the Se-RNA, S-RNA and O-RNA as negative controls, and as shown in Table 3, the Se-RNA and S-RNA are more repulsive than standard RNA (O-RNA) and have Ct values higher than that of the O-RNA, which indicates that the Se-RNA and S-RNA as negative controls are better than that of the standard RNA. Therefore, the Se-RNA, the S-RNA and the Se-S-RNA are effective negative controls of the RT-PCR kit, and can reduce false positive results in RT-PCR detection.

Table 3 shows the results of Se-RNA and S-RNA as negative controls for RT-PCR

Note: the Ct value is more than or equal to 36, which indicates negative detection; primer pair 1 is F: ACTTGTGCTAATGACCCTG (SEQ ID NO.7), B: CGCAGACGGTACAGACT (SEQ ID NO. 8); the primer pair 2 is F: GCGGTATGTGGAAAGGTT (SEQ ID NO.9) and B: CTGACTGAAGCATGGGTT (SEQ ID NO. 10); the primer pair 3 is F: CAACTTGTGCTAATGACCCT (SEQ ID NO.11), B: CGCAGACGGTACAGACT (SEQ ID NO. 8); the primer pair 4 is F: AAGGTTATGGCTGTAGTTGT (SEQ ID NO.12), B: CTGACTGAAGCATGGGTT (SEQ ID NO. 10); the primer pair 5 is F: CGTGGTATTCTTGCTAGTTA (SEQ ID NO.13), B: AGTACGCACACAATCGAA (SEQ ID NO. 14); the primer pair 6 is F: TAGTTACACTAGCCATCCTT (SEQ ID NO.15), B: AATATTGCAGCAGTACGC (SEQ ID NO. 16); the primer pair 7 is F: GTTACACTAGCCATCCTTAC (SEQ ID NO.17), B: AATATTGCAGCAGTACGC (SEQ ID NO. 16); the primer pair 8 is F: TTCGTGGTATTCTTGCTAGT (SEQ ID NO.18) and B: GCAGTACGCACACAATCG (SEQ ID NO. 19).

Experimental example 8 detection of COVID-19 by RT-LAMP of the present invention

1. Primer set

F3 (forward inner primer):

GCCAAAAGGCTTCTACGCA(SEQ ID NO.20)；

b3 (reverse inner primer):

TTGCTCTCAAGCTGGTTCAA(SEQ ID NO.21)；

FIP (forward outer primer):

TCCCCTACTGCTGCCTGGAGCGGCAGTCAAGCCTCTTC(SEQ ID NO.22)；

BIP (reverse outer primer):

TTCTCCTGCTAGAATGGCTGGCTCTGTCAAGCAGCAGCAAAG(SEQ ID NO.23)。

2. RT-LAMP detection

(1) Synthesis and configuration of primer mix: firstly, designing a primer (the primer group) according to an LAMP amplification principle and aiming at a target molecule to be detected, synthesizing the primer according to the design of the primer and configuring the primer into a primer mixture with fixed concentration, wherein the primer mixture comprises a 16microM forward inner primer, a 16microM reverse inner primer, a 2microM forward outer primer and a 2microM reverse outer primer;

(2) preparing a mixture: mixing dATP, dCTP, dGTP and dTTP according to a specified ratio;

(3) configuring an RT-LAMP reaction system: configuring RT-LAMP amplification buffer solution, primer mixture, Bst 2.0DNA polymerase and sample RNA into an RT-LAMP reaction system, and supplementing dd H₂O to 20 mu L, and setting a positive control and a negative control at the same time; RT-LAMP amplification buffer was prepared from 40mM Tris-HCl, 20mM (NH)₄)₂SO₄100mM KCl, 16mM MgSO ₄1% Tween 20, 2.5mM dNTP mixture, 1.6M betaine and 2 XSSYBR Green I or molecular probe;

(4) reaction amplification analysis: the prepared RT-LAMP reaction system is placed in a fluorescence thermostat, then the RT-LAMP reaction system is incubated for 60-120 minutes in a constant temperature environment of 65 ℃, the fluorescence change of the reaction system is monitored in real time, then the RT-LAMP reaction system amplifies target molecules to be detected, and finally the detection result is obtained through analysis, which is shown in table 4.

Table 4 shows the sensitivity of RT-LAM for detecting COVID-19

In conclusion, the Se-RNA, the S-RNA and the Se-S-RNA can be used as positive control or negative control in RT-PCR and RT-LAM detection, and false negative and false positive results in RT-PCR and RT-LAM detection are avoided.

While the present invention has been described in detail with reference to the preferred embodiments thereof, it should be understood that the above description should not be taken as limiting the invention. Various modifications and alterations to this invention will become apparent to those skilled in the art upon reading the foregoing description. Accordingly, the scope of the invention should be determined from the following claims.

Sequence listing

<110> Sichuan university

Neovit (Chengdu) Biotechnology Co., Ltd.

<120> chemically modified high-stability RNA, kit and method

<160> 23

<170> SIPOSequenceListing 1.0

<210> 1

<211> 210

<212> DNA

<213> Artificial Sequence

<400> 1

ctcttctcgt tcctcatcac gtagtcgcaa cagttcaaga aattcaactc caggcagcag 60

taggggaact tctcctgcta gaatggctgg caatggcggt gatgctgctc ttgctttgct 120

gctgcttgac agattgaacc agcttgagag caaaatgtct ggtaaaggcc aacaacaaca 180

aggccaaact gtcactaaga aatctgctgc 210

<210> 2

<211> 20

<212> DNA

<213> Artificial Sequence

<400> 2

ggggaacttc ctgctagaat 20

<210> 3

<211> 22

<212> DNA

<213> Artificial Sequence

<400> 3

gagacatttt gctctcaagc tg 22

<210> 4

<211> 20

<212> DNA

<213> Artificial Sequence

<400> 4

ttgctgctgc ttgacagatt 20

<210> 5

<211> 38

<212> DNA

<213> Artificial Sequence

<400> 5

taatacgact cactatagct cttctcgtgt ctctcatc 38

<210> 6

<211> 18

<212> DNA

<213> Artificial Sequence

<400> 6

gcagcagatt tcttagtg 18

<210> 7

<211> 19

<212> DNA

<213> Artificial Sequence

<400> 7

acttgtgcta atgaccctg 19

<210> 8

<211> 17

<212> DNA

<213> Artificial Sequence

<400> 8

cgcagacggt acagact 17

<210> 9

<211> 18

<212> DNA

<213> Artificial Sequence

<400> 9

gcggtatgtg gaaaggtt 18

<210> 10

<211> 18

<212> DNA

<213> Artificial Sequence

<400> 10

ctgactgaag catgggtt 18

<210> 11

<211> 20

<212> DNA

<213> Artificial Sequence

<400> 11

caacttgtgc taatgaccct 20

<210> 12

<211> 20

<212> DNA

<213> Artificial Sequence

<400> 12

aaggttatgg ctgtagttgt 20

<210> 13

<211> 20

<212> DNA

<213> Artificial Sequence

<400> 13

cgtggtattc ttgctagtta 20

<210> 14

<211> 18

<212> DNA

<213> Artificial Sequence

<400> 14

agtacgcaca caatcgaa 18

<210> 15

<211> 20

<212> DNA

<213> Artificial Sequence

<400> 15

tagttacact agccatcctt 20

<210> 16

<211> 18

<212> DNA

<213> Artificial Sequence

<400> 16

aatattgcag cagtacgc 18

<210> 17

<211> 20

<212> DNA

<213> Artificial Sequence

<400> 17

gttacactag ccatccttac 20

<210> 18

<211> 20

<212> DNA

<213> Artificial Sequence

<400> 18

ttcgtggtat tcttgctagt 20

<210> 19

<211> 18

<212> DNA

<213> Artificial Sequence

<400> 19

gcagtacgca cacaatcg 18

<210> 20

<211> 19

<212> DNA

<213> Artificial Sequence

<400> 20

gccaaaaggc ttctacgca 19

<210> 21

<211> 20

<212> DNA

<213> Artificial Sequence

<400> 21

ttgctctcaa gctggttcaa 20

<210> 22

<211> 38

<212> DNA

<213> Artificial Sequence

<400> 22

tcccctactg ctgcctggag cggcagtcaa gcctcttc 38

<210> 23

<211> 42

<212> DNA

<213> Artificial Sequence

<400> 23

ttctcctgct agaatggctg gctctgtcaa gcagcagcaa ag 42

Claims

1. A chemically modified high-stability RNA, wherein oxygen atoms in phosphate esters of the high-stability RNA are replaced by S or/and Se, and the structural formula of the chemically modified high-stability RNA is shown as the formula (1):

wherein X represents an S atom or a Se atom;

represents structural repetition; base represents a Base comprising: adenine, guanine, cytosine and uracil.

2. The RNA of claim 1, wherein the RNA is obtained by transcription using DNA as a template.

3. The RNA of claim 2, wherein the RNA is obtained by performing PCR reaction with primers having nucleotide sequences shown in SEQ ID NO.5 and SEQ ID NO.6 using pCOVID-19 plasmid DNA as a template, and transcribing.

4. The RNA of claim 1, wherein the RNA is chemically synthesized.

5. An RT-PCR kit for detecting COVID-19, wherein at least one of the negative and positive controls in the RT-PCR kit is the high stability RNA of any one of claims 1 to 4.

6. A method for preparing RNA of claim 1, comprising: the high-stability RNA is obtained by using pCOVID-19 plasmid DNA as a template, using nucleotide sequences shown in SEQ ID.NO1 and SEQ ID.NO2 as primers and replacing oxygen atoms in phosphate of adopted ribonucleotides by S or Se through PCR reaction and transcription.

7. The method according to claim 6, wherein the template is a DNA fragment of pCOVID-19 plasmid having T7 promoter.

8. A novel method for detecting COVID-19 by RT-PCR or RT-LAMP, wherein at least one of the negative or positive controls in the method is the high-stability RNA of claim 1.

9. The method of claim 8, wherein the RT-PCR amplification reaction system comprises: 10 Xbuffer, dNTPs, forward and reverse primers, molecular probe, Taq DNA polymerase, reverse transcriptase, RNA nucleic acid to be detected and ddH₂O; wherein, the nucleotide sequences of the forward primer and the reverse primer are respectively shown as SEQ ID NO.2 and SEQ ID NO. 3; the nucleotide sequence of the molecular probe is shown as SEQ ID NO. 4.

10. The novel method according to claim 8, wherein the RT-LAMP isothermal amplification reaction system comprises: 10 Xbuffer Buffer, dNTPs, forward and reverse primers, inner and outer primers, Bst DNA polymerase, reverse transcriptase, molecular probe, RNA nucleic acid to be detected and ddH₂O; the forward direction and the reverse directionThe nucleotide sequences of the primers are respectively shown as SEQ ID NO.20 and SEQ ID NO. 21; the nucleotide sequences of the inner primer and the outer primer are respectively shown as SEQ ID NO.22 and SEQ ID NO. 23.