CN112708699A

CN112708699A - Virus sample inactivation and lysis kit and application thereof

Info

Publication number: CN112708699A
Application number: CN202011581395.0A
Authority: CN
Inventors: 何宗顺; 曲峰
Original assignee: Suzhou Cretaceous Biotechnology Co ltd
Current assignee: Suzhou Cretaceous Biotechnology Co ltd
Priority date: 2020-03-13
Filing date: 2020-03-13
Publication date: 2021-04-27
Anticipated expiration: 2040-03-13
Also published as: CN112680547B; CN111235314A; CN111235314B; CN112680547A; CN112708699B

Abstract

The invention provides a virus sample inactivation and lysis kit and application thereof, wherein the virus sample inactivation and lysis kit comprises: the kit comprises the following reagents for preparing an inactivation lysate: ammonium salts, guanidinium isothiocyanate, lithium chloride, ethylenediaminetetraacetic acid, ethylene glycol bis (2-aminoethyl ether) tetraacetic acid, surfactants, ascorbic acid, dithiothreitol, and buffers. The invention also provides a virus sample inactivation and lysis kit which is combined with a target nucleic acid magnetic capture reagent or kit and/or a real-time fluorescent nucleic acid isothermal amplification detection kit to realize the application of the virus inactivation and capture kit in the real-time fluorescent nucleic acid isothermal amplification detection, the inactivation and lysis kit can be quickly inactivated at room temperature, the degradation of RNA is reduced, and the sensitivity is high; the specificity of the target nucleic acid magnetic capture reagent is stronger, and the obtained template has good quality and a large quantity; the real-time fluorescent isothermal nucleic acid amplification technology carries out reverse transcription and amplification together, shortens the reaction time and provides the sensitivity of a detection reagent.

Description

Virus sample inactivation and lysis kit and application thereof

The application is a divisional application of an invention patent application with the application number of '2020101751855' and the invention name of 'a virus inactivation, capture and real-time fluorescence isothermal amplification detection kit and application thereof'.

Technical Field

The invention relates to the technical field of biological detection of viruses, in particular to a virus inactivation kit, a virus nucleic acid capture kit, a real-time fluorescent isothermal amplification detection kit and application thereof, and especially relates to a virus, especially a 2019novel coronavirus (2019-nCoV) pretreatment and detection related kit combining the collection, inactivation and lysis integration, specific target magnetic capture and real-time fluorescent nucleic acid isothermal amplification detection technologies and application thereof.

Background

A Novel Coronavirus (2019Novel Coronavirus,2019-nCoV) is an RNA virus whose genetic material is ribonucleic acid, and whose specific nucleic acid sequence is a marker that distinguishes this virus from other pathogens. The object of the novel coronavirus nucleic acid test is to find the presence of the virus in infected patients. The detection of novel coronavirus currently and generally adopts a nucleic acid detection method comprising virus RNA extraction and a second-generation real-time fluorescent quantitative PCR technology. The process of extracting viral RNA is a pretreatment process, wherein the viral RNA in a specimen (such as a throat swab, an oropharyngeal swab, sputum and alveolar lavage fluid) is purified and separated. The technical principle of the fluorescence quantitative PCR nucleic acid detection is that the novel coronavirus RNA is firstly reversely transcribed into DNA, then a specific nucleic acid sequence in a specimen is amplified for about 30 times theoretically, the quantity of the nucleic acid can reach a certain detection standard, and then the detection is carried out by conventional modes such as fluorescence and the like.

Currently, the diagnostic test method of 2019-nCoV is published in a plurality of countries and regions. The gene targets recommended and detected by the Chinese disease prevention and control center are ORF1ab and N genes; ORF1b-nsp14 and the N gene are recommended by hong Kong university in China; german Charter recommends the RdRP, E and N genes. The first detection method provided by 6 enterprises in China is proved to comprise nucleic acid extraction, reverse transcription and PCR amplification; the required time is 2 to 4 hours; wherein, nucleic acid extraction generally needs 1-2 hours, reverse transcription process needs 1 hour, and PCR amplification needs 40-90 minutes; the minimum detection limit is 500-.

2, 5 days in 2020, professor of subsidiary academy length, respiratory and critical medical experts wang Chen of China institute mentions: "the current detection mode is mainly used for detecting the nucleic acid of the virus, but the new coronavirus has a characteristic that all infected patients can not detect the nucleic acid positively. The nucleic acid detection has a positive rate of 30-50% to positive patients, namely, the nucleic acid detection result of some patients is negative, but the nucleic acid detection result is clinically confirmed to be suspected new coronary pneumonia and belongs to 'false negative', and some people therefore question that the detection cannot play a role. The "missed-examination" situation puts some clinicians and people into question the quality of the test kit.

In response to the above questions, the clinical laboratory of three hospitals in Chongqing people's Hospital compares and analyzes the detection performances of different novel coronavirus (2019-nCoV) nucleic acid detection reagents. Collecting throat swab samples collected by 1 weak positive patient in the hospital at different time points, selecting the 6 domestic reagents (A-F) for parallel detection, carrying out RNA extraction and amplification, and comparing the performances according to the detection results of the reagents. As a result, the results of 3 parallel tests (ORF1ab and N gene) with the C and F reagents are positive, the N gene is not detected with the D reagent, and the ORF1ab is not detected with the A, B, E reagent; c, the repeated detection result in the reagent batch is optimal; the CT values of the 3 detection results of the F reagent (N and ORF1ab), the E reagent (ORF1ab) and the A reagent (ORF1ab) were in a trend. These results show that 6 2019-nCoV nucleic acid detection reagents have different detection capabilities on weak positive samples, and the accuracy, sensitivity and repeatability of part of the reagents are poor, so that further optimization is urgently needed, and the performance of the reagents is improved so as to better meet the requirement of large-scale screening.

Therefore, there are clinical doctors and related experts who call to bring the CT imaging examination result into the diagnostic standard for confirmation, but the sensitivity of CT imaging detection is high, the specificity may be low, and the false negative detection using only CT may be small but may cause a large number of false positives, thereby possibly increasing unnecessary medical burden and the probability of cross infection of false positive patients; meanwhile, the CT imaging characteristics of early infected people are not obvious, so that false negative can be caused, and cross infection can be caused to the society. Needless to say, the nucleic acid detection must be the gold standard for noninvasive diagnosis of the novel coronavirus pneumonia, and is also the new coronavirus detection method with highest sensitivity and specificity at present. Generally, the detection kit as three types of medical instruments needs to be approved by the national food and drug administration to be marketed into the clinic after multiple indexes such as specificity, sensitivity and the like meet requirements through clinical tests, and the time of months or even years is usually required. The epidemic outbreak is rapid, and it is not time to use enough clinical samples for multi-batch repeated verification in the development of the kit, and the requirement of clinical application is urgent.

In summary, the reasons that false negative and low positive rate occur in the existing nucleic acid detection are manifold, the collection of different types of samples, the virus content of different patients in different disease courses has larger floating, special equipment and special vehicles are needed for low-temperature storage and transportation after sampling, the integrity of RNA is reduced due to repeated freeze thawing, the traditional heat inactivation method degrades RNA, the compatibility of sample preservation solution and extraction reagent is poor, the extraction process has low yield, the pretreatment takes long time to degrade RNA, the purity of target nucleic acid obtained in the extraction process is low, the genome containing a large number of human genomes or other pathogens causes non-specificity or interference amplification of subsequent amplification products, and whether the concentration ratio of primers, probes and enzymes in PCR detection is sensitive enough or not.

Disclosure of Invention

In order to solve the problems that the existing 2019-nCoV detection method is low in sensitivity, long in detection time (collection, storage, transportation, inactivation, extraction and detection), and easy to cause pollution of amplification products to cause false positive or false negative of an experimental result, the invention provides a virus sample inactivation lysis kit in a first aspect, wherein the kit comprises the following reagents for preparing an inactivation lysis solution: ammonium salts, guanidinium isothiocyanate, lithium chloride, ethylenediaminetetraacetic acid, ethylene glycol bis (2-aminoethyl ether) tetraacetic acid, surfactants, ascorbic acid, dithiothreitol, and buffers.

Preferably, the ammonium salt is selected from the group consisting of ammonium sulfate, ammonium carbonate, ammonium chloride, ammonium bromide and ammonium iodide. Additionally or further preferably, the ammonium salt is ammonium chloride; additionally or further preferably, the surfactant is selected from the group consisting of Span-80, Span-20, sodium dodecylbenzenesulfonate, lithium dodecylsulfate, Sodium Dodecylsulfate (SDS), Tween20, Triton X-100, NP40, sodium dodecylsarcosinate, and CTAB. Additionally or further preferably, the surfactant is a combination of TritonX-100 and lithium dodecyl sulfate. Additionally or further preferably, the buffer is selected from the group consisting of Tris base, phosphate and HEPES.

Alternatively or further preferably, the inactivated lysate is formulated with water and comprises 0.01-2M ammonium salt, 0.5-2M guanidinium isothiocyanate, 0.1-0.5M lithium chloride, 5-50mM ethylenediaminetetraacetic acid, 1-20mM ethylene glycol bis (2-aminoethyl ether) tetraacetic acid, 0.1-5% surfactant, 10-500mM ascorbic acid, 0.5-5% dithiothreitol, and 20-500mM buffer.

Additionally or further preferably, the concentration of ammonium ions in the inactivated lysate is between 0.05M and 0.5M, preferably between 0.1M and 0.4M, more preferably between 0.1M and 0.2M. Additionally or further preferably, the surfactant in the inactivated lysate is a combination of 0.2% TritonX-100 and 0.5% lithium dodecyl sulfate. Additionally or further preferably, the buffer is HEPES, preferably, the concentration of HEPES is 50-200 mM. Additionally or further preferably, the inactivated lysate has a pH value of 5-6.5.

In a second aspect, the present invention provides a method for inactivating and lysing a virus, the method being performed using the virus sample inactivation and lysis kit according to the first aspect of the present invention. Preferably, the viral sample is selected from the group consisting of a pharyngeal swab sample, an oropharyngeal swab sample, a sputum sample, an alveolar lavage sample, and a urine sample; the inactivated lysate is 2 to 4 times the volume of the virus sample; the inactivation is carried out for 15 to 30 minutes at room temperature; and/or the virus is 2019-nCoV.

The present invention provides in a third aspect a target nucleic acid magnetic capture reagent, the reagent comprising:

(1) magnetic polymer microspheres as solid phase carriers, wherein the magnetic polymer microspheres comprise gamma Fe₂O₃And Fe₃O₄The microsphere comprises a microsphere made of a magnetic material and one or more layers of polymeric materials coating the microsphere, wherein the surface of the magnetic polymer microsphere is modified with a microsphere connecting group;

(2) an intermediate probe comprising a 5' modified non-nucleotidic unit, a 3' modified oligonucleotide unit and optionally an intermediate arm, and said intermediate probe being attached to said magnetic polymeric microsphere via said microsphere linking group attached to said 5' modified non-nucleotidic unit;

(3) a capture probe comprising a 5 'specific sequence and a 3' polyA sequence that are specifically complementary to a target nucleic acid; preferably, the target nucleic acid is a specific sequence that characterizes the presence of a target microorganism, more preferably, the target microorganism is 2019-nCoV; more preferably, the 3' polyA sequence is 10 to 50 bases in length, more preferably 10 to 30 bases in length.

Additionally or further preferably, the polymeric material coats the microspheres by emulsion polymerization, soap-free polymerization, dispersion polymerization, or seed swell polymerization. Additionally or further preferably, the magnetic polymer microspheres have a particle size of 0.1-10 μ M, preferably 0.5-5 μ M, more preferably selected from the group consisting of Dynabeads M270 Streptavidin, Dynabeads MyOne Streptavidin T1, Merck

Magnetic carboxyl beads M1-200/20, Merck

Aminomagnetic beads M2-070/40, Agilent Lodesars 2.7 Carboxyl.

Additionally or further preferably, the microsphere attachment group is a reactive group or an avidin, and/or the avidin is streptavidin. Additionally or further preferred, the reactive group is selected from the group consisting of carboxyl, amino, epoxy, NHS group (N-hydroxysuccinimide), azide group, tosyl and chloromethyl, preferably carboxyl or tosyl.

Additionally or further preferably, the 5' modified non-nucleotidic unit is selected from the group consisting of amino, carboxy and biotin.

Additionally or further preferred, the 3' modified oligonucleotide unit is selected from the group consisting of Oligo dT, Oligo dU, Oligo dT VN or Oligo dU VN, wherein V is selected from the group consisting of A, G and C and N is selected from the group consisting of T, A, G and C; preferably, the number of nucleotides in oligo T or oligo U in the 3' modified oligonucleotide is 5 to 100, more preferably 10 to 50.

Additionally or further preferred, the optional intermediate arm is PEG and/or Cn, wherein the molecular weight of PEG is 100-; cn represents a linear alkylene group having n carbon atoms, more preferably n is 2 to 12; the length of the intermediate arm is 5-50A deg., more preferably 10-30A deg..

Additionally or further preferably, the capture probe is a capture probe against 2019-nCoV and the 5' specific sequence is a specific sequence on the orf1ab gene and/or a specific sequence at the N protein gene position; preferably, the 5' specific sequence is shown as SEQ ID NO.1 and/or SEQ ID NO. 2; it is further preferred that the capture probe is as shown in SEQ ID NO.3 and/or SEQ ID NO. 4.

Preferably, the microsphere connecting group is streptavidin, and the 5' modified non-nucleotide unit is biotin; the intermediate probe is selected from the group consisting of 5' biotin Oligo (dT)₁₅ 3’、5’biotin-PEG-Oligo(dT)₁₈ 3’、5’biotin-Cn-Oligo(dT)₂₅VN 3 'and 5' biotin-Cn-oligo (dU)₃₀VN 3' wherein the molecular weight of PEG is 100-600, preferably100-; cn represents a linear alkylene group having n carbon atoms, n is preferably 2 to 12;

it is further preferred that the microsphere linking group is a carboxyl group and the 5' modified non-nucleotidic unit is an amino group; preferably, the microsphere connecting group is used for covalently combining the magnetic polymer microsphere with carboxyl and the aminated intermediate probe with the 5' modified non-nucleotide unit through an EDC one-step method, an EDC/NHS two-step method or an EDC/SNHS two-step method; more preferably, the intermediate probe is selected from the group consisting of 5' NH₂-Cn-Oligo(dT)₁₈ 3’、5’NH₂-PEG-Oligo(dT)₂₅3 'and 5' NH₂-PEG-Oligo(dT)₂₃VN 3', wherein the molecular weight of PEG is 100-600, preferably 100-200; cn represents a linear alkylene group having n carbon atoms, n is preferably 2 to 12.

It is also preferred that the microsphere linking group is an amino group and the 5' modified non-nucleotidic unit is a carboxyl group.

It is also preferred that the binding capacity of the magnetic polymeric microspheres is at least 100pmol/mg, at least 200pmol/mg, at least 300pmol/mg, at least 400pmol/mg, at least 500pmol/mg, more preferably at least 750pmol/mg, and most preferably at least 1200 pmol/mg.

Preferably, the molar ratio of the intermediate probe to the capture probe is 50:1 to 2:1, more preferably 25:1 to 3:1, and most preferably 20:1 to 4: 1.

It is also preferred that the amount of intermediate probe not bound to the capture probe is greater than 100pmol/mg, more preferably greater than 200 pmol/mg.

In a fourth aspect, the invention provides a target nucleic acid capture kit comprising a binding buffer, a preservation solution, a wash solution W1, a wash solution W2, an eluent, and a target nucleic acid magnetic capture reagent.

Preferably, the binding buffer comprises lithium chloride, lithium dodecyl sulfate, Triton X-100, ethylene diamine tetraacetic acid, citric acid and water, the pH range is 6.0-8.0, and the contents of the components are preferably as follows: 0.02-5M lithium chloride, 0.02-5% lithium dodecyl sulfate, 0.05-5% Triton X-1000, 1-100mM EDTA, 0.02-0.2M citric acid, and the balance water.

Preferably, the storage solution is composed of BSA or NaN₃And the binding buffer.

It is also preferred that the wash W1 comprises 100mM succinate, 0.5% lithium dodecyl sulphate, 100mM LiOH, 15mM 2,2' -dithiodipyridine, 0.2M LiCl, 5mM EDTA, 5mM EGTA, 3% (v/v) absolute ethanol, pH 6.5.

It is also preferred that the washing solution W2 contains 20mM HEPES, 7.5mM NaOH, 1mM EDTA, 0.3% (v/v) absolute ethanol, 0.02% (W/v) methylparaben, 0.01% (W/v) propylparaben, 50mM lithium chloride, 0.1% sodium lauryl sulfate, pH 7.5.

The eluent contained 1mM EDTA and 2mM sodium acetate, pH 6.5.

Preferably, the target nucleic acid magnetic capture reagent is the target nucleic acid magnetic capture reagent according to the third aspect of the invention.

In a fifth aspect, the invention provides a primer pair for amplifying and detecting a target nucleic acid, the primer pair comprising a forward primer based on an RNA polymerase promoter sequence, the forward primer comprising an RNA polymerase promoter sequence at the 5 'end and a forward target nucleic acid binding sequence at the 3' end, and a reverse primer based on a non-RNA polymerase promoter sequence, the reverse primer comprising a reverse target nucleic acid binding sequence.

Preferably, the RNA polymerase promoter sequence is selected from the group consisting of an sp6 RNA polymerase promoter sequence, a T3 RNA polymerase promoter sequence and a T7 RNA polymerase promoter sequence.

It is also preferred that the forward primer comprises a T7 RNA polymerase promoter sequence at the 5 'end and a forward target nucleic acid binding sequence at the 3' end.

More preferably, the promoter sequence of T7 RNA polymerase at the 5' end is the sequence shown in SEQ ID NO. 5.

Further preferably, the forward primer of the primer pair is shown as SEQ ID NO.6, and the reverse primer is shown as SEQ ID NO.7, or the forward primer of the primer pair is shown as SEQ ID NO.8, and the reverse primer is shown as SEQ ID NO. 9. The invention provides a real-time fluorescent nucleic acid isothermal amplification detection kit in a sixth aspect, which is characterized by comprising: (i) amplification reaction reagents; (ii) mixing enzyme reagents; and (iii) amplification detection reagents;

wherein the amplification reaction buffer comprises Tris-HCl and MgCl₂PVP 40, KCl, glycerol, zinc acetate dihydrate, dNTP and NTP, and the pH value is 7.0;

the mixed enzyme reagent comprises T7 RNA polymerase, reverse transcriptase, HEPES, N-acetyl-L-cysteine, EDTA, sodium azide, TritonX-100, KCl, glycerol and trehalose dihydrate, and the pH value is 7.0;

the detection reagent comprises Tris, EDTA, a primer pair for amplifying the target nucleic acid and a probe for detecting the target nucleic acid, wherein the primer pair for amplifying the target nucleic acid is the primer pair of the fifth aspect.

It is also preferred that the probe for detecting the target nucleic acid is represented by SEQ ID NO.10 when the primers are SEQ ID NO.6 and 7, or by SEQ ID NO.11 when the primers are SEQ ID NO.8 and 9.

The invention provides in a seventh aspect a kit for virus inactivation, capture and real-time fluorescent isothermal amplification detection, characterized in that the kit comprises;

(1) the virus sample inactivation lysis kit of the first aspect of the invention;

(2) a target nucleic acid magnetic capture reagent according to the third aspect of the invention or a target nucleic acid capture kit according to the fourth aspect of the invention;

(3) a primer pair according to the fifth aspect of the invention or a target nucleic acid capture kit according to the sixth aspect of the invention.

The invention also provides a method for inactivating, capturing and detecting viruses, particularly new coronavirus by using the reagent, the primer pair, the probe and the kit, and application of the reagent, the primer pair, the probe and the kit in the inactivation, capturing and detecting of the viruses, particularly the new coronavirus.

In general, the invention provides a technology and a method for integrating 2019-nCoV acquisition, inactivation and lysis, a specific target magnetic capture technology and real-time fluorescent nucleic acid isothermal amplification detection, which have the advantages of short detection time, high sensitivity, high specificity and stable reaction.

More specifically, the invention provides a sample lysis inactivation reagent and an application method thereof, a specific target magnetic capture pretreatment process and a real-time fluorescent nucleic acid isothermal amplification detection kit, and the kit comprises a special primer, a probe, a kit and application thereof.

The sample inactivation lysis reagent provided by the invention is specially used for RNA viruses, can be specially used for SARS or 2019-nCoV, particularly 2019-nCoV, and has the functions of inactivating 2019-nCoV, inhibiting RNase activity in a short term, protecting RNA from short-term degradation and realizing short-term normal-temperature transportation and storage. The currently recommended inactivation method is to treat for 30-45 minutes at 56 degrees, while common sample treatment solution is usually isotonic solution, physiological saline or PBS solution, and RNA is easily degraded in the process, so that amplification cannot be performed in the subsequent PCR detection process, and false negative is caused.

The invention provides a 2019-nCoV sample inactivation and lysis reagent and an application method thereof, a specific target magnetic capture pretreatment process and a real-time fluorescent nucleic acid isothermal amplification detection kit, and compared with the existing processes of heating inactivation, cold chain transportation, conventional extraction and RT-PCR detection, the reagent has the following advantages:

1) the sample is immediately inactivated and cracked after being collected, normal-temperature transportation is realized, the integrity of RNA is ensured, and the transportation cost and risk are reduced;

2) high specificity, high purity: the optimized magnetic beads, intermediate probes and capture probes designed for the 2019-nCoV target nucleic acid can efficiently and specifically capture the 2019-nCoV RNA.

3) Because a closed constant-temperature amplification detection system is adopted, a reaction system does not need to be opened in the whole process, and an amplification product is RNA, so that aerosol pollution caused by an amplicon is avoided.

4) And (3) rapid detection: the method comprises the steps of sample lysis inactivation, pretreatment targeted magnetic capture, nucleic acid amplification and detection which are synchronously carried out in the same closed system, and temperature rise, fall and circulation are not required in the whole detection process, so that the required time is greatly shortened, the inactivation only needs 15 minutes, the pretreatment only needs 10-30 minutes, the amplification detection only needs 45 minutes, and the whole process is within 1.5 hours.

5) The automation degree is high, the manual operation is reduced, and possible pollution and human errors are avoided;

6) is suitable for large-scale high-throughput screening.

Drawings

FIG. 1 is a graph showing the sensitivity analysis of example 8 of the present invention, wherein the concentration is 2000copies/mL, blue is ORF1ab gene (upper line), and green is N gene (lower line);

FIG. 2 is a graph showing the sensitivity analysis of example 8 of the present invention, the concentration being 500copies/mL, blue being the ORF1ab gene (upper line), green being the N gene (lower line);

FIG. 3 is a graph showing the sensitivity analysis of example 8 of the present invention, wherein the concentration is 100copies/mL, the blue color is ORF1ab gene (upper line), and the green color is N gene (lower line).

Detailed Description

Definition of

Before the present teachings are described in detail, it is to be understood that this disclosure is not limited to particular compositions or process steps, as such

These may vary. It should be noted that, as used in this specification and the appended claims, the singular forms "a," "an," and "the" include plural referents unless the context clearly dictates otherwise. Thus, for example, reference to "an oligomer" includes a variety of oligomers and the like.

It is understood that there is an implied "about" before the temperatures, masses, weights, volume ratios, concentrations, times, etc. discussed in this disclosure such that slight and insubstantial deviations are within the scope of the teachings herein. Generally, the term "about" refers to insubstantial changes in the amounts of the components of the composition, which do not have any significant effect on the effectiveness or stability of the composition. Also, the use of "including," "containing," and "including" is not intended to be limiting. It is to be understood that both the foregoing general description and the detailed description are exemplary and explanatory only and are not restrictive of the present teachings. To the extent that any material incorporated by reference does not conform to the teachings of the present disclosure, that description controls.

Unless specifically stated otherwise, embodiments in the specification that are described as "comprising" various components are also considered to "consist of" or "consist essentially of" the components; embodiments in the specification that are described as "consisting of" various components are also considered to be "comprising" or "consisting essentially of" the components.

In the present application, a "sample" or "specimen" includes any sample, such as a nucleic acid or a fragment of a nucleic acid, that contains or may contain a virus, e.g., a novel coronavirus (2019-nCoV) or a SARS virus, or a component thereof. Samples include "biological samples," which include any tissue or material derived from a living or dead animal, such as a mammal (e.g., a human), that may contain or may contain, for example, a target nucleic acid of 2019-nCoV or SARS virus or a target nucleic acid derived therefrom. The sample or specimen may include, for example, a pharyngeal swab sample, an oropharyngeal swab sample, a sputum sample, and an alveolar lavage sample, a peripheral blood sample, a plasma sample, a serum sample, a lymph node sample, a gastrointestinal tissue sample, a stool sample, a urine sample, or other bodily fluid sample or material.

"nucleic acid" refers to a polymeric compound comprising two or more covalently bonded nucleosides or nucleoside analogs having a nitrogen-containing heterocyclic base or base analog, wherein the nucleosides are linked together by phosphodiester or other linkages to form a polynucleotide. Nucleic acids include RNA, DNA, or chimeric DNA-RNA polymers or oligonucleotides and analogs thereof. The nucleic acid "backbone" may be composed of a variety of linkages, including one or more of sugar-phosphodiester linkages, peptide-nucleic acid linkages. Nucleic acids may include modified bases to alter the function or behavior of the nucleic acid, such as the addition of 3' -terminal dideoxynucleotides to prevent additional nucleotides from being added to the nucleic acid. Synthetic methods for preparing nucleic acids in vitro are well known in the art, although nucleic acids can be purified from natural sources using conventional techniques.

As used herein, a "nucleotide" is a subunit of a nucleic acid consisting of a phosphate group, a 5-carbon sugar, and a nitrogenous base (also referred to as a "nucleobase"). The 5-carbon sugar found in RNA is ribose. In DNA, the 5-carbon sugar is 2' -deoxyribose. The term also includes analogs of these subunits.

As used herein, a "non-nucleotide unit" is a unit that does not significantly participate in polymer hybridization. For example, these units do not participate in any significant hydrogen bonding with the nucleotide, and units having as a component one of five nucleotide bases or analogs thereof are excluded.

As used herein, a "target nucleic acid" is a nucleic acid that comprises the target sequence to be amplified. The target nucleic acid can be DNA or RNA as described herein, and can be single-stranded or double-stranded. The target nucleic acid may include other sequences than the target sequence, which may not be amplified.

The terms "oligomer", "oligo" and "oligonucleotide" as used interchangeably herein refer to a nucleic acid having typically fewer than 500 nucleotide (nt) residues, including polymers having a lower limit of about 5nt residues and an upper limit of about 300 to 500nt residues. In some embodiments, the size range of the oligonucleotides has a lower limit of about 8 to 15nt and an upper limit of about 100 to 200nt, and other embodiments range from a lower limit of about 10 to 20nt and an upper limit of about 50 to 100 nt. Oligonucleotides may be purified from naturally occurring sources, or may be synthesized using any of a variety of well-known enzymatic or chemical methods, and may be purified by magnetic beads or HPLC, among others. The term oligonucleotide does not imply any specific function to the agent; rather, it is used generically to encompass all such agents described herein. Oligonucleotides may serve a variety of different functions. For example, it may act as a primer if it is specific for and capable of hybridizing to a complementary strand and can be further extended in the presence of a nucleic acid polymerase; if it contains a sequence recognized by an RNA polymerase and allows transcription (e.g., the T7 primer), it can act as a primer and provide a promoter; it can be used to detect a target nucleic acid if it is capable of hybridizing to the target nucleic acid or an amplicon thereof and also provides a detectable moiety (e.g., a fluorophore).

As used herein, the term "complementary" or "complementarity," when used in reference to polynucleotides (i.e., nucleotide sequences), refers to polynucleotides related by the base pairing rules. For example, the sequence "5 '-A-G-T-3'" is complementary to the sequence "3 '-T-C-A-5'". Complementarity may be "partial". Wherein only some of the nucleic acid bases are matched according to the base pairing rules. Alternatively, "complete" or "overall" complementarity between nucleic acids may be present. The degree of complementarity between nucleic acid strands has a significant effect on the efficiency and strength of hybridization between nucleic acid strands. This is particularly important in amplification reactions and detection methods that rely on binding between nucleic acids.

In this application, "extraction," "isolation," or "purification" refers to the removal of one or more components of a sample or the separation from other sample components. The sample components comprise target nucleic acids, often in a generally aqueous solution phase, which may also comprise cell fragments, proteins, carbohydrates, lipids, salt ions, metal ions, and other nucleic acids. "extraction", "isolation" or "purification" does not imply any degree of purification. Typically, the isolation or purification removes at least 70% or at least 80% or at least 90% of the target nucleic acid from other sample components.

The term "polymerase chain reaction" ("PCR") herein refers to the method of k.b. mullis U.S. patent nos. 4683195 and 4683202, which describe methods of increasing the concentration of a segment of a target sequence in a mixture of genomic or other DNA or RNA without cloning or purification. This process for amplifying a target sequence consists of: a large excess of two oligonucleotide primers is introduced into a DNA mixture containing the desired target sequence, followed by thermal cycling of the precise sequence in the presence of a DNA polymerase. The two primers are complementary to their respective strands of the double-stranded target sequence. To effect amplification, the mixture is denatured and the primers then anneal to their complementary sequences in the target molecule. After annealing, the primers are extended with a polymerase to form a new pair of complementary strands. The steps of denaturation, primer annealing and polymerase extension can be repeated multiple times (i.e., denaturation, annealing and extension constitute one "cycle"; there can be multiple "cycles") to obtain a high concentration of amplified segments of the desired target sequence. The length of the amplified segment of the desired target sequence is determined by the relative positions of the primers with respect to each other, and thus this length is a controllable parameter. Due to the repetitive aspects of the process, the method is referred to as "polymer chain reaction" ("PCR"). Because the desired amplified segments of the target sequence become the predominant sequence in the mixture (in terms of concentration), they are referred to as "PCR amplified" and are "PCR products" or "amplicons". It will be understood by those skilled in the art that the term "PCR" encompasses many variations of the initially described methods using, for example, real-time PCR, nested PCR, reverse transcription PCR (RT-PCR), single primer and arbitrary primer PCR, and the like.

The sequence may be a "2019-nCoV sequence" if it or its complement present is at least about 90% or at least about 95% identical, or contains no more than one mismatch, relative to any genotype or isolate of 2019-nCoV, such that, for example, "15 contiguous nucleotides of the 2019-nCoV sequence" refers to a 15-mer that matches at least 14 of the 15 positions of the genotype or isolate of 2019-nCoV or its complement. For example, to determine whether a sequence conforms to a 2019-nCoV sequence, the presence of U is considered equivalent to T, and vice versa. Taking 2019-nCoV as an example, the target-hybridizing region of an exemplary oligomer disclosed herein, the 2019-nCoV-derived in vitro transcript sequences disclosed herein, and subsequences thereof, are also considered to be 2019-nCoV sequences.

A "magnet" herein is a material or object that generates a magnetic field. The magnet may be a permanent magnet or an electromagnet.

The specificity in this context reflects the false positive rate (probability of misdiagnosing a patient who is not the disease as the disease) at the time of detection, the higher the specificity, the lower the misdiagnosis rate; the sensitivity reflects the false negative rate of detection (the probability of failing to diagnose the patient as not having the disease), and the higher the sensitivity, the lower the failure rate. At present, the specific false negative rate and false positive rate of the new corolla pneumonia virus nucleic acid detection are not reported in statistics of the article. The term "sensitivity" has another layer of meaning in PCR detection and is used herein to refer to the degree of accuracy with which a nucleic acid amplification reaction can be detected or quantified. The sensitivity of an amplification reaction is generally a measure of the minimum number of copies of a target nucleic acid that can be reliably detected in an amplification system and will depend on, for example, the detection assay used and the specificity of the amplification reaction, e.g., the ratio of specific amplicons to byproducts.

In the invention, the 2019-nCoV sequence is subjected to a high-throughput sequencing technology, about 1 month and 10 days, a novel coronavirus genome complete sequence is submitted to an NCBI GenBank database by a public health clinical center of Shanghai city of the Compound Dane university, and the current version is an MN908947.3 genome version upgraded at 1 month and 17 days. The novel coronavirus 2019-nCoV was a linear single stranded rna (ssrna) virus with a genome of about 29903 nucleotides in total length (see NCBI GenBank database, accession number MN908947.3 genome version 1 month 17 th), which comprised a total of 10 genes, of which:

the first 265 nucleotides are the 5' UTR region; 21555 is the gene named "ORF1 ab"; 25384, the "S" gene, produces viral surface glycoproteins; 25393..26220 is the "ORF3a" gene; 26245..26472 shows that the "E" gene can produce virus envelope protein; 26523..27191 shows that the "M" gene can produce virus membrane glycoprotein; 27202..27387 is the "ORF6" gene; 27394..27759 is "ORF7a" gene; 27894..28259 is "ORF8" gene; 28274..29533 shows that the "N" gene can generate virus nucleocapsid phosphoprotein; 29558..29674 is the "ORF10" gene; 29675. 29903 is the 3' UTR region. The specific sequence should be registered in Genbank database (accession number: MN 908947; version number: MN 908947.3).

The virus sample inactivation and lysis kit comprises ammonium salt, guanidinium isothiocyanate, lithium chloride, ethylene diamine tetraacetic acid, ethylene glycol bis (2-aminoethyl ether) tetraacetic acid, a surfactant, ascorbic acid, dithiothreitol, a buffer solution and deionized water. The content of each component is preferably as follows: 0.01-2M ammonium salt, 0.5-2M guanidinium isothiocyanate, 0.1-0.5M lithium chloride, 5-50mM ethylenediaminetetraacetic acid, 1-20mM ethylene glycol bis (2-aminoethyl ether) tetraacetic acid, 0.1-5% surfactant, 10-500mM ascorbic acid, 0.5-5% dithiothreitol, 20-500mM buffer.

Ammonium ion (NH 4) required for virus inactivation according to the method of the invention⁺) Can be present in many different ways, such as provided by the addition of an ammonium salt. In a preferred embodiment, the ammonium salt is ammonium sulfate, ammonium carbonate, ammonium chloride, ammonium bromide, or ammonium iodide or a mixture thereof, preferably the ammonium salt is ammonium chloride.

The concentration of ammonium ions is generally in the range of 0.01M to 2M, preferably in the range of 0.05M to 0.5M, more preferably in the range of 0.1M to 0.4M, most preferably in the range of 0.1M to 0.2M.

The surfactant is any one of Span-80, Span-20, sodium dodecyl benzene sulfonate, lithium dodecyl sulfate, Sodium Dodecyl Sulfate (SDS), Tween20, Triton X-100, NP40, sodium dodecyl sarcosinate and CTAB or the combination of 2 to 3 of the above, and the concentration is 0.1 to 5 percent. Preferred surfactants are Triton X-100 and lithium dodecyl sulfate, with a preferred combination of 0.2% Triton X-100 and 0.5% lithium dodecyl sulfate.

The buffer solution can be Tris buffer solution, phosphate buffer system or HEPES buffer system, the preferable buffer solution is HEPES buffer solution, the preferable pH value is 5-6.5, and the concentration is 50-200 mM.

The sample inactivating and cracking reagent prepared by the virus sample inactivating and cracking kit can store RNA in a short term and realize the short-term normal temperature storage and transportation, the short term in the invention refers to 25 ℃ for 5 days and 37 ℃ for 1-2 days, ammonium salt and guanidine isothiocyanate in the invention are used as protein denaturants for denaturing and cracking virus RNA, the guanidine isothiocyanate can inhibit the activity function of RNase and ensure that the RNA is not degraded by enzyme, a buffer solution maintains the buffer environment of the RNA and maintains the stability of nucleic acid, ethylene diamine tetraacetic acid and ethylene glycol bis (2-aminoethyl ether) tetraacetic acid can be coupled with divalent metal ions to inhibit the activity of the RNase, ascorbic acid can ensure that the nucleic acid is kept stable and not degraded under UV, dithiothreitol is used for reducing disulfide bonds in protein to promote the breakage of virus RNA coat protein, and a surfactant can dissolve lipid in the virus RNA coat protein, so as to increase the permeability of the antibody to cell membranes and promote the breakage of viral RNA coat protein, thereby inactivating pathogenic microorganisms.

The sample inactivation and lysis reagent prepared by the invention can be used in throat swabs, oropharyngeal swabs, sputum and alveolar lavage fluid, urine or other body fluids, and for the sputum and alveolar lavage fluid, the urine or other body fluids, the sample inactivation and lysis reagent with 2 times volume is preferably used, the sample inactivation and lysis reagent is treated for 15-30 minutes at room temperature, and 1-2mL of the sample inactivation and lysis reagent can be added into the throat swabs and oropharyngeal swabs. The reagent has low guanidinium isothiocyanate concentration, and surfactant, dithiothreitol and ethylene diamine tetraacetic acid are common chemical components for nucleic acid extraction, so that subsequent nucleic acid extraction is not influenced, and the reagent can be compatible with common silicon membrane centrifugal column nucleic acid extraction and silicon magnetic bead-based nucleic acid extraction in the market, such as Applied Biosystems^TMSupplied MagMAX^TMViral RNA Isolation Kit(CAT#AM1939),Thermo Scientific^TMThe GeneJET Viral DNA/RNA Purification Kit (CAT # K0821), Invitrogen^TMDynabeads are provided^TMSILANE Viral NA Kit (CAT #37011D) and Qiagen

Viral RNA Mini (CAT #52904), and the like. Surprisingly, the sample inactivation and lysis reagent prepared by the invention is not only suitable for conventional nucleic acid extraction and purification, but also suitable for the specific target magnetic capture pretreatment technology specially replacing conventional nucleic acid extraction and purification, and can be directly used as a capture hybridization solution of the technology to be combined in one tube from inactivation and lysis to subsequent treatment without adding other reagents, so that the pretreatment time is greatly saved.

The invention relates to a method for extracting nucleic acid, which is characterized in that the nucleic acid is separated from a sample, 2019-nCoV is RNA virus, the nucleic acid extraction process needs to pay attention to the degradation condition of RNA, a column type method based on a silicon membrane or a magnetic bead method is generally adopted by a mainstream virus RNA extraction kit in the market, the extraction process of a single sample is different from 30 to 60 minutes, and the extraction process of 90 samples is about 60 to 120 minutes. The nucleic acids purified by the above method will not all be target nucleic acids of interest, and may contain other DNA and RNA, such as genomic DNA, tRNA, rRNA, mRNA, etc. in exfoliated cells in respiratory tract and oral cavity of a patient, and may also be nucleic acids of other microorganisms, because the above extraction kit is generally directed to total RNA, total nucleic acids, total DNA, or total viral RNA and DNA, i.e., will contain non-target nucleic acids in high abundance.

The invention provides a pretreatment process for magnetic capture of a specific target to replace the traditional nucleic acid extraction and purification process, and aims to provide a method for specific capture such as 2019-nCoV, which has short pretreatment time and no proteinase K.

The method for capturing and purifying 2019-nCoV from a sample treated by a sample inactivation and lysis reagent comprises the following steps:

1) providing a solid phase carrier connected with a specific capture probe, wherein the solid phase carrier is composed of gamma Fe₂O₃And Fe₃O₄The magnetic material is synthesized into uniform, super-paramagnetic and monodisperse polymeric microspheres. Preferably, each microsphere is coated with one or more layers of polymeric materials, and can be prepared by emulsion polymerization, soap-free polymerization, dispersion polymerization or seed swelling polymerization to finally form the magnetic polymer microsphere, and the surface of the magnetic polymer microsphere is modified to contain active groups such as carboxyl, amino, epoxy, tosyl, chloromethyl and the like or streptavidin. Preferably, the particle size of the magnetic polymer microspheres is 0.1-10 μ M, more preferably 0.5-5 μ M, such as Dynabeads M270 Streptadin, Dynabeads MyOne Streptavidin T1, Merck

Magnetic carboxyl beads M1-200/20, Merck

Aminomagnetic beads M2-070/40, Agilent Lodesars 2.7Carboxyl, and the like can be used in the present invention.

The magnetic polymer microsphere (sometimes referred to as magnetic bead) of the invention can be connected with an intermediate probe through a surface active group or streptavidin, the intermediate probe 5 'modifies a non-nucleotide unit, the non-nucleotide unit can be combined with the magnetic bead in an affinity way or a covalent way, if a carboxyl magnetic bead is used, the 5' non-nucleotide unit can be aminated and can be coupled covalently by a carbodiimide method, if the streptavidin modified magnetic bead is used, the 5 'modified non-nucleotide unit can be biotin, and the intermediate probe 3' modified oligonucleotide can be Oligo dT or Oligo dU. The choice of Oligo dT or dU used depends on the downstream use of the isolated target nucleic acid of interest, and Oligo dU bound to a vector can be used for probes containing dA-terminated ends or for target nucleic acids, similar to the use of Oligo dT, but with the further advantage that Us provides a glycosylase cleavage site. In a preferred embodiment, the Oligo dT/dU construct further comprises another nucleotide sequence (designated "VN", wherein "V" is any nucleotide other than T (e.g., A, G, or C), "N may be any nucleotide within T included"). This additional "VN" sequence assists in targeting or localization of Oligo dT/dU probe sequence to nucleic acid binding. It is advantageous that probe binding is localized at the boundary between the PolyA tail and the target nucleic acid target sequence.

The number of Oligo T or Oligo U of Oligo dT, Oligo dU, Oligo dT VN or Oligo dU VN of the intermediate probe of the invention is preferably 5-100, more preferably, the number of Oligo T or Oligo U is 10-50, such as Oligo dT25, Oligo dT30VN, Oligo dT15VN are all within the protection scope of the invention.

If streptavidin magnetic beads are adopted in the invention, the intermediate probe can be 5' biotin Oligo (dT)₁₅ 3’，5’biotin-PEG-Oligo(dT)₁₈ 3’，5’biotin-Cn-Oligo(dT)₂₅VN 3', or 5' biotin-Cn-oligo (dU)₃₀VN 3'. The molecular weight of the PEG can be 100-600, preferably 100-200. Cn refers to an alkylene group having n carbon atoms, and n may be generally 2 to 12. E.g. C₆Refers to an indirect arm of 6 carbons. Both PEG and Cn are used to increase the length of their intervening arms, preferably between 5 and 50A degrees in length, such as between 10 and 30A degrees in length is preferred.

In the invention, if carboxyl magnetic beads are adopted, the intermediate probe can be 5' NH₂-Cn-Oligo(dT)₁₈ 3’，5’NH₂-PEG-Oligo (dT)₂₅3' or5’NH₂-PEG-Oligo(dT)₂₃VN 3' and the like, the present invention can covalently bond the carboxyl magnetic beads to the aminated intermediate probe by an EDC one-step method, an EDC/NHS two-step method or an EDC/SNHS two-step method, which is easily understood by those skilled in the art. The present invention can also be coupled covalently with intermediate probes through other activated or active functional group-containing magnetic beads, such as tosyl, NHS group, chloromethyl, azide group, amino group, epoxy group, etc., when different types of functional group-containing magnetic beads are used, the 5' of the corresponding intermediate probe needs to be paired for covalent reaction, if carboxyl magnetic beads are selected, the 5' of the intermediate probe is preferably amino, if amino magnetic beads are selected, the 5' of the intermediate probe is preferably carboxyl, and preferably, the present invention selects carboxyl magnetic beads or tosyl magnetic beads.

Regardless of which magnetic bead is used to covalently react with or affinity link to the intermediate probe, the group density of the intermediate probe on the magnetic bead is preferably controlled, such as the binding capacity of the magnetic bead is at least 100pmol/mg, 200pmol/mg, 300pmol/mg, 400pmol/mg, 500pmol/mg, more preferably the binding capacity of the magnetic bead is at least 750pmol/mg, and most preferably the binding capacity of the magnetic bead is at least 1200 pmol/mg.

If more than one different type of binding partner (referred to herein as an intermediate probe) is used, they may be attached to the same or different solid supports. Such systems using different solid supports are particularly suitable in the case of magnetic particles. Thus, different binding ligands may be attached to different magnetic beads. In embodiments where more than one different type of binding ligand is used, the amount or ratio of use of the different types of binding ligands can be readily determined by one skilled in the art.

2) The magnetic bead of the invention is firstly connected with a section of intermediate probe, and is combined with a capture probe through the intermediate probe, the combination mode of the intermediate probe and the capture probe is complementary combination, namely 3' of the capture probe contains a section of A sequence, and can be complementarily combined with Oligo T or Oligo U of Oligo dT, Oligo dU, Oligo dT VN or 5' of Oligo dUVN, the length of the Oligo A sequence of the capture probe is 10-50, more preferably 10-30, while the sequence of 5' of the capture probe can be complemented with the specific sequence of 2019-nCoV, the capture probe can be specifically combined with 2019-nCoV target nucleic acid, when the internal standard contains the internal standard, the capture probe can also be preferably specifically combined with the internal standard sequence, the capture probe is combined through the magnetic bead-intermediate probe to form a magnetic bead-intermediate probe-capture probe compound, the complex has high specificity, 2019-nCoV can be picked out from a sample, other nucleic acid fragments are not basically adsorbed, other impurities such as protein, lipid, sugar and salt ions can be washed clean after washing, and then pure 2019-nCoV can be obtained through elution.

The capture probes aiming at 2019-nCoV are respectively SEQ ID NO.3 which is a section of specific sequence (5 'uacgaagucagucgacuacguguuaaaaaaaaaaaaaaaaaaaaaaaaaa 3') on orf1ab gene, and SEQ ID NO.1 which is uacgaagucagucgacuacguguu; SEQ ID NO.4 is a specific sequence (5 'ccguuaccgccacuacgacgagaacg aaaaaaaaaaaaaaaaaaaaaaaaa 3') at the position of the gene encoding the N protein, and SEQ ID NO.2 is ccguuaccgccacuacgacgagaacg. The number of A-strands of 3' in SEQ ID NO.3 and SEQ ID NO.4 is 10 to 30, and should not be strictly limited in the present invention, and the capture probe is purified by PAGE or HPLC.

The capture probe and the intermediate probe are combined in a certain ratio, and the molar ratio of the intermediate probe to the capture probe is 50: 1-2: 1, more preferably 25: 1-3: 1, and most preferably 20: 1-4: 1. The intermediate probe of the present invention can not be saturated with the capture probe, and the capture probe can not exceed 50% of the saturation binding capacity at most, that is, if the binding capacity of the intermediate probe on the magnetic bead is 1000pmol/mg, in the experimental test, if the maximum binding capacity of the capture probe is 400pmol/mg, the addition amount of the capture probe can not exceed 200pmol/mg at most.

In the present invention, it is necessary to have a certain amount of intermediate probes exposed, and preferably, the amount of intermediate probes not bound to the capture probes is required to be more than 100pmol/mg, more preferably, more than 200pmol/mg, and these exposed intermediate probes can effectively and specifically bind to the 33A tails at the 3' end of 2019-nCoV.

Thus, using knowledge of the molecules or other entities present on the surface of the target nucleic acid of interest, a combination or mixture of capture probes can be selected to effect separation or isolation of the target nucleic acid of interest from the sample. Advantageously, all or substantially all (i.e., nearly all) of the target nucleic acid present in the sample can be isolated. The separation that can be achieved depends not only on the capture probe chosen, but also on the content of capture probes bound to the magnetic beads themselves, the nature of the magnetic beads (particle size, surface groups, hydrophilicity, etc.), the nature of the sample, the binding conditions, etc. In addition, the nature of biological systems is variable, not always enabling 100% separation, which is not actually necessary according to the invention; in any biological system, it is necessary to allow a certain tolerance. Then, in a preferred embodiment of the invention, at least 40%, 50%, 60%, 75%, 80%, 90% or 95% of the target nucleic acids of interest present in the sample can be isolated.

3) The kit for capturing 2019-nCoV with magnetic specificity is provided to replace the traditional pretreatment step of nucleic acid extraction, and comprises prepared magnetic bead-intermediate probe-capture probe complexes (hereinafter referred to as capture magnetic beads), capture magnetic bead preservation solution, binding buffer solution, washing solution W1, washing solution W2 and eluent.

In the present invention, 20-1000. mu.g of capture magnetic beads are used for 200-2000. mu.L of inactivated lysed sample, which should contain 0.01-1. mu. moL of capture probe. The preservation solution for capturing magnetic beads contains BSA and NaN with certain concentration₃And binding buffer, BSA and NaN₃The concentration of the magnetic beads may be the same as that of a conventional magnetic bead storage solution, for example, a magnetic bead storage solution manufactured by Invitrogen corporation, Promega corporation, Roche corporation, or the like. The binding buffer solution is helpful for the capture hybridization between the capture probe and the target nucleic acid, the binding buffer solution is composed of lithium chloride, lithium dodecyl sulfate, Triton X-100, ethylene diamine tetraacetic acid, citric acid and deionized water,the pH range is 6.0-8.0, and the content of each component is as follows: 0.02-5M lithium chloride, 0.02-5% lithium dodecyl sulfate, 0.05-5% Triton X-1000, 1-100mM EDTA, 0.02-0.2M citric acid. The washing solution W1 comprises the following components: 100mM succinate, 0.5% lithium dodecyl sulfate, 100mM LiOH, 15mM 2,2' -dithiodipyridine, 0.2M LiCl, 5mM EDTA, 5mM EGTA, 3% (v/v) absolute ethanol, pH 6.5. The washing solution W2 had the following composition: 20mM HEPES, 7.5mM NaOH, 1mM EDTA, 0.3% (v/v) absolute ethanol, 0.02% (w/v) methylparaben, 0.01% (w/v) propylparaben, 50mM lithium chloride, 0.1% sodium lauryl sulfate, pH 7.5. The complex of the captured magnetic beads and the target nucleic acid is washed by the washing solutions W1 and W2, and finally eluted in an eluent, which may be a mixed solution of 1mM EDTA and 2mM sodium acetate pH6.5, or a conventional TE buffer or a Low TE buffer.

The use of reagents such as alcohols, chaotropic salts, organic solvents (e.g., phenol, isoamyl alcohol, and chloroform), and high salts, etc., in the use of separation methods is sometimes disadvantageous. The present invention has the feature that it is possible to avoid the use of these reagents, or to use very small amounts of the above reagents, in conventional nucleic acid extraction using a combination of chaotropic salts at high concentrations and an alcohol, often isopropanol, and washing with 70% ethanol, 75% ethanol or 80% ethanol. Although these agents may also be used in the present invention, in an advantageous embodiment of the invention, these agents are not substantially used.

The invention is not the traditional nucleic acid extraction step, so lysis solution is not needed to be added additionally, another advantage is additionally added on the basis of time saving, the sample adding amount is increased, the traditional method generally takes 200-400 mu L of the swab preservation solution, then equal volume of lysis solution and a certain amount of binding solution are added, the whole system is nearly 1mL, and if the volume exceeds 1mL, the whole system is not suitable for a 96-bit automatic workstation (using a 96-well plate for operation), but the invention can increase the sample adding amount of the swab preservation solution by about 2 times by selecting to add a small amount of capture magnetic beads and binding buffer solution without adding lysis solution in the capture stage, so that the template amount in the PCR process can be greatly increased.

The method for specifically enriching the target nucleic acid by using the capture magnetic beads is suitable for automation, particularly when magnetic particles are used as solid phase carriers. In a particularly advantageous embodiment of the invention, the magnetic capture separation of nucleic acids is achieved using an automated system for handling solid phase carriers during targeted capture with nucleic acids after viral lysis and washing and elution steps. For example, a target nucleic acid separated from a carrier can be transferred to an automated system in which a magnet can transfer magnetic particles, binding, washing, elution can be performed, the target nucleic acid can be bound to the carrier, as appropriate depending on the particular steps of the method and the particular carrier and conditions used, and unbound nucleic acids or proteins can be easily washed away using such an automated apparatus. In addition, the device can also be used for processing the lysis and inactivation treatment process of the sample. Thus, it can be seen that one can choose to automate all of the steps of the method as desired.

The invention also provides a real-time fluorescent nucleic acid isothermal amplification detection kit, which comprises the special primer, the probe, the kit and the application thereof.

Following pretreatment, amplification of the 2019-nCoV target nucleic acid is achieved by using primers that define the 5 'and 3' ends of the region amplified by in vitro enzyme-mediated nucleic acid synthesis to produce amplicons (sometimes referred to as amplification products). The present invention preferably uses the real-time fluorescent isothermal Amplification and Testing (SAT) method, which produces a large amount of detectable Amplification products (RNA transcripts), a technique of isothermal Amplification. The primer combination comprises a promoter primer based on the promoter sequence (forward primer) and a reverse primer based on the non-promoter sequence. Preferably, the promoter sequence-based forward primer is a promoter primer, i.e. a forward primer, comprising a 5'RNA polymerase promoter sequence and a 3' target binding sequence. RNA polymerase promoter sequences are known in the art and include, but are not limited to, sp6 RNA polymerase promoter sequences, T3 RNA polymerase promoter sequences, and T7 RNA polymerase promoter sequences. In preferred embodiments, the promoter primer comprises a 5'T7 RNA polymerase promoter sequence and a 3' target binding sequence. Most preferably, the 5' T7 RNA polymerase promoter sequence is TAATACGACTCACTATAGGGAGA (shown as SEQ ID NO. 5).

Further, the detection kit also comprises an amplification reaction reagent and/or a mixed enzyme reagent. For example, a typical 25. mu.L amplification reaction system may use 12.5. mu.L of amplification reaction reagent, 2.5. mu.L of primer probe mixture, and 5.0. mu.L of mix enzyme reagent, with 5. mu.L of target nucleic acid added and 25. mu.L of total reaction system.

The 2 × amplification reaction buffer of the present invention consists of: 10.5mM Tris-HCl, 15.2mM MgCl₂0.2% PVP 40, 13.5mM KCl, 2.5% glycerol, 0.05mM zinc acetate dihydrate, 0.725mM dNTP each, 5.56mM NTP each, pH 7.0.

The detection solution of the invention comprises the following components: dissolving the 2019-nCoV amplification primer and the 2019-nCoV detection probe in a TE solution (10mM Tris,1mM EDTA, pH7.5) to prepare the probe, wherein the concentration of each primer and each probe can be 5-10 pmol/reaction; the concentration of the T7 promoter primer is preferably 6.5 pmol/reaction, and the concentration of the detection probe is preferably 5.5 pmol/reaction.

The mixed enzyme reagent of the present invention comprises 500-1000U of T7 RNA polymerase, 1000-2000U of reverse transcriptase, 15mM HEPES, 50mM N-acetyl-L-cysteine, 1mM EDTA, 0.05% (w/v) sodium azide, 1% TritonX-100, 50mM KCl, 20% (v/v) glycerol, 200mM trehalose dihydrate, pH 7.0. The present invention is preferably mixed with the target nucleic acid retained on the capture magnetic beads. The primers and probes used for the amplification detection can be as follows:

ORF1ab reverse primer sequence: TGTGACTTAAAAGGTAAGTATGTA, respectively;

ORF1abT7 promoter primer SEQ ID NO.7: TAATACGACTCACTATAGGGAGAACGATTGTGCATCAGCTGA, respectively;

probe sequence of SEQ ID NO.10 ORF1 ab: 5'-acacagucuguaccgucugcggugugu-3', ORF1ab probe is 5 'FAM-acacagucuguaccgucugcggugugu-3' DABCYL.

N reverse primer sequence of SEQ ID NO.8: TTCCTCATCACGTAGTCGCAACAG

N promoter primer SEQ ID No.9: TAATACGACTCACTATAGGGAGACAGACATTTTGCTCTCAAGCTG

Probe sequence of SEQ ID NO.11: N: 5'-aauggcggugaugcugcucuugcuuugccauu-3', the N probe is 5 'VIC-aauggcggugaugcugcucuugcuuugccauu-3' DABCYL.

Examples

For a further understanding of the invention, reference will now be made to the preferred embodiments of the invention by way of example, and it is to be understood that the description is intended to further illustrate features and advantages of the invention, and not to limit the scope of the claims. The experimental methods described in the following examples are all conventional methods unless otherwise specified; the materials are commercially available, unless otherwise specified.

Example 1:

preparing an inactivated lysate:

preparing an inactivation lysate by adopting deionized water according to the following components and concentrations: 0.2M ammonium salt, 2M guanidinium isothiocyanate, 0.5M lithium chloride, 20mM ethylenediaminetetraacetic acid, 50mM ethyleneglycol bis (2-aminoethyl ether) tetraacetic acid, 0.2% TritonX-100, 0.5% lithium dodecyl sulfate, 50mM ascorbic acid, 0.5% dithiothreitol, 100mM HEPES buffer, pH 5.5.

Adding pseudovirus with known concentration into 200 μ L of the inactivated lysate and PBS solution, shaking at room temperature for 20 min, and then using Invitrogen^TMDynabeads are provided^TMSILANE Viral NA Kit was used to verify that no Invitrogen was added to the lysates that had been inactivated as described above^TMThe lysis reagent in the kit does not use the lysate and lysis step of the kit, is directly extracted and is detected by using the conventional RT-PCR, and the result shows that the two have no obvious difference, so that the inactivation lysis reagent in the embodiment 1 can fully lyse the pseudovirus and release the target RNA. Meanwhile, the inventor carries out 25-degree normal temperature stability test verification with the conventional VTM virus preservation solution. The verification result shows that the sample inactivation and lysis reagent has better protective effect on the virus RNA (Table 1).

TABLE 1 stability of inactivated lysates to RNA

Sample (I)	Immediate detection	1 day	2 days	3 days
					The inactivated lysate of the present invention	26.7	26.8	27.1	27.4
Invitrogen kit lysate	27.1	27.8	28.9	34.0
					VTM virus preservation solution	26.6	28.9	31.5	35.2

Example 2: synthesis of intermediate Probe sequences

The synthetic SEQ ID NO.3 to 11 and the following intermediate probe sequences were synthesized by the firm Token Biotechnology engineering (Shanghai) Ltd:

5’biotin Oligo(dT)₁₅ 3’

5’biotin-C6-Oligo(dT)₂₅VN 3’

5’NH₂-C6-Oligo(dT)₃₀ 3’

example 3: preparation of Capture magnetic bead MB-1

10mg of Dynabeads MyOne Streptavidin T1 (from Invitrogen) was washed twice with PBS, resuspended in 500. mu.L of 5 XSSC buffer, and 10. mu. mol of 5' biotin Oligo (dT) was added₁₅The 3' middle probe reacts for 30 minutes at room temperature, then the magnetic separation is carried out, and the supernatant fluid detects the residual probe content. Washing the magnetic bead-intermediate probe for 5 times by using 2 XSSC buffer, and finally storing in PBS buffer containing 0.1% preservative and 0.05% Tween20 for temporary storage, detecting the probe content on the magnetic bead to be 935pmol/mg, adding 800pmol SEQ ID NO.3 and 800pmol SEQ ID NO.4 into the 10mg magnetic bead-intermediate probe buffer, reacting for 30 minutes at room temperature, carrying out magnetic separation, detecting the residual probe content of the supernatant to be zero, namely all the Capture probes are bonded to the surface of the magnetic bead, so as to prepare the Capture magnetic bead Capture MB-1.

Example 4: preparation of Capture magnetic bead MB-2

Using a method consistent with example 3, again using 10mg of Dynabeads MyOne Streptavidin T1, but replacing the middle probe with 5' biotin-C₆-Oligo(dT)₂₅VN 3' was subjected to saturation binding and calculated as the binding load of 712pmol/mg, 600pmol of SEQ ID NO.3 and 600pmol of SEQ ID NO.4 were added to the above 10mg of magnetic bead-intermediate probe buffer, and the content of the Capture probe in the supernatant was detected to be zero, and the Capture magnetic bead Capture MB-1 was prepared.

Example 5: preparation of Capture magnetic bead MB-3

10mg of Merck were used

The carboxyl magnetic beads M1-200/20 were washed twice with deionized water and twice with PBS, and then resuspended in 1mL of 50mM MES pH6.0 buffer, 10. mu. mol of 5' NH was added₂-C₆-Oligo(dT)₃₀And 3' mixing the mixture at room temperature for 30 minutes, adding 100 mu L of 100mg/mL EDC solution (dissolved in MES solution in advance) prepared freshly, continuing to react for 1 hour, magnetically separating and removing supernatant (the supernatant needs to be tested for the concentration of nucleic acid), adding 1mL of 1M Tris-HCl (Tris-HCl) with pH7.2, sealing for 2 hours, finally washing for 5 times by using 2X SSC to obtain a magnetic bead-intermediate probe compound, calculating the binding capacity of the intermediate probe to be 1650pmol/mg, adding 1200pmol of SEQ ID NO.3 and 1200pmol of SEQ ID NO.4 into the 10mg of magnetic bead-intermediate probe buffer solution, detecting the content of the Capture probe in the supernatant to be zero, and preparing the Capture magnetic bead Capture MB-3.

Example 6: kit pretreatment reagent for capturing 2019-nCoV with magnetic specificity

Magnetic bead suspension: 2mg/mL Capture beads (Capture MB-1, Capture MB-2 or Capture MB-3) dissolved in 0.05% NaN₃0.5% BSA in 2 XSSX buffer.

Binding buffer: 1M lithium chloride, 1% lithium dodecyl sulfate, 0.5% Triton X-1000, 50mM EDTA, 0.2M citric acid, pH 6.5.

Washing solution W1: 100mM succinate, 0.5% lithium dodecyl sulfate, 100mM LiOH, 15mM 2,2' -dithiodipyridine, 0.2M LiCl, 5mM EDTA, 5mM EGTA, 3% (v/v) absolute ethanol, pH6.5

Washing solution W2: 20mM HEPES, 7.5mM NaOH, 1mM EDTA, 0.3% (v/v) absolute ethanol, 0.02% (w/v) methylparaben, 0.01% (w/v) propylparaben, 50mM lithium chloride, 0.1% sodium lauryl sulfate, pH7.5

For 1mL of inactivated lysed sample, 100. mu.L of 2mg/mL capture magnetic beads, 200. mu.L of binding buffer, 500. mu.L of wash W1 and wash W2 were used, and the volumes were either increased or decreased linearly with the loading volume of the inactivated lysed sample. The capture bead-target nucleic acid complexes were finally dispersed in 50. mu.L of 10mM Tris, pH7.2 for detection.

Example 7: SAT amplification

The 2 × amplification reaction buffer of the present invention comprises: 10.5mM Tris-HCl, 15.2mM MgCl₂0.2% PVP 40, 13.5mM KCl, 2.5% glycerol, 0.05mM zinc acetate dihydrate, 0.725mM dNTP each, 5.56mM NTP each, pH 7.0.

The detection solution of the invention comprises the following components: the primer concentration was 6.5 pmol/reaction and the detection probe concentration was 5.5 pmol/reaction.

The mixed enzyme reagent of the present invention comprises 1000U of T7 RNA polymerase, 1500U of reverse transcriptase, 15mM HEPES, 50mM N-acetyl-L-cysteine, 1mM EDTA, 0.05% (w/v) sodium azide, 1% TritonX-100, 50mM KCl, 20% (v/v) glycerol, 200mM trehalose dihydrate, pH 7.0.

A typical 25. mu.L amplification reaction solution used 12.5. mu.L of amplification reaction buffer, 2.5. mu.L of primer-probe mixture, and 5.0. mu.L of mix enzyme reagent, with 5. mu.L of target nucleic acid added and 25. mu.L of total reaction system.

Taking 5 mu L of captured magnetic bead-target nucleic acid compound suspension to a new micro reaction tube, and preserving heat at 60 ℃ for 10 minutes and 42 ℃ for 5 minutes; simultaneously, the mixed enzyme reagent is preheated to 42 ℃, 5 mu L of the captured magnetic bead-target nucleic acid compound, 5.0 mu L of the mixed enzyme reagent, 5 mu L of the primer probe mixed solution are added into 12.5 mu L of the amplification reaction buffer, the micro reaction tube is quickly transferred to a proper constant temperature fluorescence detection instrument, the reaction is carried out at 42 ℃ for 42 minutes, the fluorescence is detected every 1 minute, and the detection is carried out for 60 times.

Setting a threshold value: the threshold line is just above the highest point of the normal negative control amplification curve. Dt values were taken, which represent the abscissa readings of the intersection of the sample curve with the threshold line (similar to ct values for typical real-time fluorescent PCR experimental results).

The results were judged as follows: if the N gene and the OFR1ab gene are positive at the same time, the sample is proved to be positive; the sample is proved to be negative if the N gene and the OFR1ab gene are negative simultaneously or negative and positive simultaneously.

And (3) judging the positivity of the N gene and the OFR1ab tube, wherein the sample with dt less than or equal to 35 is positive, the sample with dt less than or equal to 35 is recommended to be detected again, and the sample with dt less than or equal to 42 is negative.

Example 8: sensitivity detection of detection kit

Using a pseudovirus sample (1X 10) containing N gene and ORF1ab gene⁶/. mu.L) was diluted in 10-fold gradient, and 1mL was added to the inactivation lysate, and the Capture magnetic beads were captured using Capture MB-3 prepared in example 5, the magnetic target Capture protocol was performed according to example 6, and SAT amplification was performed according to example 7, and the results showed that the sensitivity of the whole reagent to ORF1ab gene could reach 25 copies/reaction, and the sensitivity to N gene could reach 50 copies/reaction, as shown in FIGS. 1, 2 and 3, indicating that the kit had very good sensitivity.

The above description of the embodiments is only intended to facilitate the understanding of the method of the invention and its core idea. It should be noted that, for those skilled in the art, it is possible to make various improvements and modifications to the present invention without departing from the principle of the present invention, and those improvements and modifications also fall within the scope of the claims of the present invention. The previous description of the disclosed embodiments is provided to enable any person skilled in the art to make or use the present invention. Various modifications to these embodiments will be readily apparent to those skilled in the art, and the generic principles defined herein may be applied to other embodiments without departing from the spirit or scope of the invention. Thus, the present invention is not intended to be limited to the embodiments shown herein but is to be accorded the widest scope consistent with the principles and novel features disclosed herein.

While embodiments of the invention have been disclosed above, it is not limited to the applications listed in the description and the embodiments, which are fully applicable in all kinds of fields of application of the invention, and further modifications may readily be effected by those skilled in the art, so that the invention is not limited to the specific details without departing from the general concept defined by the claims and the scope of equivalents.

SEQUENCE LISTING

<110> Suzhou Chalkbrook science and technology Co., Ltd

<120> virus sample inactivation and lysis kit and application thereof

<130> GY20100860F

<160> 11

<170> PatentIn version 3.5

<210> 1

<211> 24

<212> RNA

<213> Artificial Synthesis

<400> 1

uacgaaguca gucgacuacg uguu 24

<210> 2

<211> 26

<212> RNA

<213> Artificial Synthesis

<400> 2

ccguuaccgc cacuacgacg agaacg 26

<210> 3

<211> 50

<212> RNA

<213> Artificial Synthesis

<400> 3

uacgaaguca gucgacuacg uguuaaaaaa aaaaaaaaaa aaaaaaaaaa 50

<210> 4

<211> 51

<212> RNA

<213> Artificial Synthesis

<400> 4

ccguuaccgc cacuacgacg agaacgaaaa aaaaaaaaaa aaaaaaaaaa a 51

<210> 5

<211> 23

<212> DNA

<213> Artificial Synthesis

<400> 5

taatacgact cactataggg aga 23

<210> 6

<211> 24

<212> DNA

<213> Artificial Synthesis

<400> 6

tgtgacttaa aaggtaagta tgta 24

<210> 7

<211> 42

<212> DNA

<213> Artificial Synthesis

<400> 7

taatacgact cactataggg agaacgattg tgcatcagct ga 42

<210> 8

<211> 24

<212> DNA

<213> Artificial Synthesis

<400> 8

ttcctcatca cgtagtcgca acag 24

<210> 9

<211> 45

<212> DNA

<213> Artificial Synthesis

<400> 9

taatacgact cactataggg agacagacat tttgctctca agctg 45

<210> 10

<211> 27

<212> RNA

<213> Artificial Synthesis

<400> 10

acacagucug uaccgucugc ggugugu 27

<210> 11

<211> 32

<212> RNA

<213> Artificial Synthesis

<400> 11

aauggcggug augcugcucu ugcuuugcca uu 32

Claims

1. A virus sample inactivation lysis kit is characterized by comprising the following reagents for preparing an inactivation lysis solution: ammonium salts, guanidinium isothiocyanate, lithium chloride, ethylenediaminetetraacetic acid, ethylene glycol bis (2-aminoethyl ether) tetraacetic acid, surfactants, ascorbic acid, dithiothreitol, and buffers.

2. The inactivation lysis kit of claim 1, wherein:

the ammonium salt is selected from the group consisting of ammonium sulfate, ammonium carbonate, ammonium chloride, ammonium bromide and ammonium iodide, preferably, the ammonium salt is ammonium chloride; the surfactant is selected from the group consisting of Span-80, Span-20, sodium dodecylbenzenesulfonate, lithium dodecylsulfate, sodium dodecylsulfate, Tween20, Triton X-100, NP40, sodium dodecylsarcosinate and CTAB, preferably a combination of Triton X-100 and lithium dodecylsulfate; and/or the buffer is selected from the group consisting of Tris base, phosphate and HEPES;

preferably, the inactivated lysate is formulated with water and comprises 0.01-2M ammonium salt, 0.5-2M guanidinium isothiocyanate, 0.1-0.5M lithium chloride, 5-50mM ethylenediaminetetraacetic acid, 1-20mM ethylene glycol bis (2-aminoethyl ether) tetraacetic acid, 0.1-5% surfactant, 10-500mM ascorbic acid, 0.5-5% dithiothreitol, and 20-500mM buffer;

more preferably, the concentration of ammonium ions in the inactivated lysate is between 0.05M and 0.5M, preferably between 0.1M and 0.4M, more preferably between 0.1M and 0.2M; the surfactant in the inactivated lysate is a combination of 0.2% TritonX-100 and 0.5% lithium dodecyl sulfate; and/or the buffer is HEPES, preferably at a concentration of 50-200mM, more preferably the inactivation lysate has a pH of 5-6.5.

3. A virus inactivation, capture and real-time fluorescence isothermal amplification detection kit is characterized by comprising;

(1) the viral sample inactivation lysis kit of claim 1 or 2;

(2) a target nucleic acid magnetic capture reagent or a target nucleic acid capture kit;

(3) a real-time fluorescent nucleic acid isothermal amplification detection kit.

4. The virus inactivation, capture and real-time fluorescent isothermal amplification detection kit of claim 3, wherein: the target nucleic acid magnetic capture reagent comprises:

5. The virus inactivation, capture and real-time fluorescent isothermal amplification detection kit of claim 4, wherein:

the polymeric material coats the microspheres by emulsion polymerization, soap-free polymerization, dispersion polymerization, or seed swelling polymerization;

the particle size of the magnetic polymer microsphere is 0.1-10 μ M, preferably 0.5-5 μ M, more preferably selected from Dynabeads M270 Streptavidin, Dynabeads MyOne Streptavidin T1, Merck

Magnetic carboxyl beads M1-200/20, Merck

A group consisting of amino magnetic beads M2-070/40 and Agilent Lodesars 2.7 Carboxyl;

the microsphere connecting group is an active group or an affinity protein, preferably, the affinity protein is streptavidin; the active group is selected from the group consisting of carboxyl, amino, epoxy, NHS group, azide group, tosyl and chloromethyl, preferably carboxyl or tosyl;

the 5' modified non-nucleotide unit is selected from the group consisting of amino, carboxyl, and biotin;

the 3' modified oligonucleotide unit is selected from the group consisting of Oligo dT, Oligo dU, Oligo dT VN or Oligo dU VN, wherein V is selected from the group consisting of A, G and C, and N is selected from the group consisting of T, A, G and C; preferably, the number of nucleotides in oligo T or oligo U in the 3' modified oligonucleotide is 5 to 100, more preferably 10 to 50;

the optional middle arm is PEG and/or Cn, wherein the molecular weight of PEG is 100-; cn represents a linear alkylene group having n carbon atoms, more preferably n is 2 to 12; the length of the middle arm is 5-50A degrees, more preferably 10-30A degrees; and/or

The capture probe is a capture probe aiming at 2019-nCoV, and the 5' specific sequence is a specific sequence on the orf1ab gene and/or a specific sequence on the position of the N protein gene; preferably, the 5' specific sequence is shown as SEQ ID NO.1 and/or SEQ ID NO. 2; it is further preferred that the capture probe is as shown in SEQ ID NO.3 and/or SEQ ID NO. 4.

6. The virus inactivation, capture and real-time fluorescent isothermal amplification detection kit of claim 4 or 5, wherein:

the microsphere connecting group is streptavidin, and the 5' modified non-nucleotide unit is biotin; the intermediate probe is selected from the group consisting of 5' biotin Oligo (dT)₁₅3’、5’biotin-PEG-Oligo(dT)₁₈3’、5’biotin-Cn-Oligo(dT)₂₅VN 3 'and 5' biotin-Cn-oligo (dU)₃₀VN 3', wherein the molecular weight of PEG is 100-600, preferably 100-200; cn represents a linear alkylene group having n carbon atoms, n is preferably 2 to 12;

or

The microsphere connecting group is carboxyl, and the 5' modified non-nucleotide unit is amino; preferably, the microsphere connecting group is used for covalently combining the magnetic polymer microsphere with carboxyl and the aminated intermediate probe with the 5' modified non-nucleotide unit through an EDC one-step method, an EDC/NHS two-step method or an EDC/SNHS two-step method; more preferably, the intermediate probe is selected from the group consisting of 5' NH₂-Cn-Oligo(dT)₁₈ 3’、5’NH₂-PEG-Oligo(dT)₂₅3 'and 5' NH₂-PEG-Oligo(dT)₂₃VN 3', wherein the molecular weight of PEG is 100-600, preferably 100-200; cn represents a linear alkylene group having n carbon atoms, n is preferably 2 to 12;

or

The microsphere connecting group is amino, and the 5' modified non-nucleotide unit is carboxyl.

7. The virus inactivation, capture and real-time fluorescent isothermal amplification detection kit of any one of claims 4 to 6, wherein:

the binding capacity of the magnetic polymer microsphere is at least 100pmol/mg, at least 200pmol/mg, at least 300pmol/mg, at least 400pmol/mg, at least 500pmol/mg, more preferably, the binding capacity of the magnetic polymer microsphere is at least 750pmol/mg, and most preferably, the binding capacity of the magnetic polymer microsphere is at least 1200 pmol/mg;

the molar ratio of the intermediate probe to the capture probe is 50: 1-2: 1, more preferably 25: 1-3: 1, and most preferably 20: 1-4: 1; and/or

The amount of intermediate probe not bound to the capture probe is greater than 100pmol/mg, more preferably greater than 200 pmol/mg.

8. The virus inactivation, capture and real-time fluorescent isothermal amplification detection kit of any one of claims 1 to 7, wherein the target nucleic acid capture kit comprises a binding buffer, a preservation solution, a wash solution W1, a wash solution W2, an eluent, and a target nucleic acid magnetic capture reagent;

the binding buffer solution consists of lithium chloride, lithium dodecyl sulfate, Triton X-100, ethylene diamine tetraacetic acid, citric acid and water, the pH range is 6.0-8.0, and the content of each component is preferably as follows: 0.02-5M lithium chloride, 0.02-5% lithium dodecyl sulfate, 0.05-5% Triton X-1000, 1-100mM EDTA, 0.02-0.2M citric acid, and the balance water;

the preservation solution is prepared from BSA and NaN₃And the binding buffer;

the wash W1 contained 100mM succinate, 0.5% lithium dodecyl sulfate, 100mM LiOH, 15mM 2,2' -dithiodipyridine, 0.2M LiCl, 5mM EDTA, 5mM EGTA, 3% (v/v) absolute ethanol, pH 6.5;

the washing solution W2 contains 20mM HEPES, 7.5mM NaOH, 1mM EDTA, 0.3% (v/v) absolute ethyl alcohol, 0.02% (W/v) methylparaben, 0.01% (W/v) propylparaben, 50mM lithium chloride, 0.1% sodium dodecyl sulfate, pH 7.5;

the eluent comprises 1mM EDTA and 2mM sodium acetate, pH 6.5;

the target nucleic acid magnetic capture reagent is the target nucleic acid magnetic capture reagent of any one of claims 3 to 6.

9. The virus inactivation, capture and real-time fluorescent isothermal amplification detection kit of any one of claims 1 to 8, wherein:

the real-time fluorescent isothermal nucleic acid amplification detection kit comprises a primer pair for amplifying and detecting a target nucleic acid, wherein the primer pair comprises a forward primer based on an RNA polymerase promoter sequence and a reverse primer based on a non-RNA polymerase promoter sequence, the forward primer comprises an RNA polymerase promoter sequence at the 5 'end and a forward target nucleic acid binding sequence at the 3' end, and the reverse primer comprises a reverse target nucleic acid binding sequence;

preferably, the RNA polymerase promoter sequence is selected from the group consisting of an sp6 RNA polymerase promoter sequence, a T3 RNA polymerase promoter sequence, and a T7 RNA polymerase promoter sequence;

preferably, the forward primer comprises a T7 RNA polymerase promoter sequence at the 5 'end and a forward target nucleic acid binding sequence at the 3' end;

more preferably, the promoter sequence of the T7 RNA polymerase at the 5' end is the sequence shown in SEQ ID NO. 5;

further preferably, the forward primer of the primer pair is shown as SEQ ID NO.6, and the reverse primer is shown as SEQ ID NO.7, or the forward primer of the primer pair is shown as SEQ ID NO.8, and the reverse primer is shown as SEQ ID NO. 9.

10. The virus inactivation, capture and real-time fluorescent isothermal amplification detection kit of any one of claims 3 to 9, wherein:

the real-time fluorescent nucleic acid isothermal amplification detection kit comprises: (i) amplification reaction reagents; (ii) mixing enzyme reagents; and (iii) amplification detection reagents;

the detection reagent comprises Tris, EDTA, a primer pair for amplifying the target nucleic acid and a probe for detecting the target nucleic acid, wherein the primer pair for amplifying the target nucleic acid is the primer pair of claim 9;