CN112481147A - Yeast mutant with function deletion of glutamine synthetase gene and preparation method and application thereof - Google Patents

Abstract

The invention provides a yeast mutant with a function deletion of glutamine synthetase gene, wherein GLN1 gene of the yeast mutant is deleted with part or all of GLN1 gene and leads to the loss of the function of GLN1 gene. The invention further provides a preparation method and application of the yeast mutant. The yeast mutant with a function of the glutamine synthetase gene which is provided by the invention is difficult to screen even on a culture medium added with glutamine if a gene knockout method is directly adopted in yeast. According to the invention, the functional complementary gene can replace the function of yeast GLN1 by transforming the functional complementary gene, so that colonies with GLN1 knockout fragments can be easily screened.

Description

Yeast mutant with function deletion of glutamine synthetase gene and preparation method and application thereof

Technical Field

The invention relates to the field of biotechnology, in particular to a yeast technology for recombinant modification, and especially relates to a glutamine synthetase gene function-deficient yeast mutant and application thereof in the fields of research and development, medicines, chemical industry and the like.

Background

The defect strain of gene mutation can be obtained by mutagenesis screening of defect strain, site-directed gene knockout can be carried out, the defect strain can be efficiently obtained by screening, and the mutant defect strain with expected gene change can be obtained by homologous recombination accurate replacement of gene sequence.

Glutamine synthetase is a key enzyme for biological nitrogen metabolism, and takes glutamic acid as a substrate and NH4⁺Glutamine is synthesized and inorganic nitrogen is converted into organic nitrogen. Glutamine synthetase is a target protein of herbicide glufosinate-ammonium, glufosinate-ammonium occupies a reaction center of the glutamine synthetase through competition with substrate glutamic acid, so that glutamine synthesis reaction is terminated, cells cannot carry out nitrogen metabolism, and NH is caused in the cells₄ ⁺The accumulation of the herbicide can lead the cells to be poisoned by ammonium and not to survive, thus leading the plant body to die and achieving the weeding effect. Also, deletion of the glutamine synthetase gene function in yeast results in inability of yeast to grow and difficulty in selection on a corresponding defective medium. With the development of the gene directed evolution technology, the evolution of the glufosinate-ammonium-resistant gene GS also becomes possible, and the mutants of a large number of genes obtained by evolution need to be rapidly and effectively verified. Yeast is a unicellular eukaryote, and is often used as a model eukaryote for research and also for research and application fields of medicine, chemical engineering and the like due to convenient culture operation. In order to eliminate the influence of the endogenous GS gene of yeast, a glutamine synthetase gene function deletion mutant yeast strain is needed to verify the resistance and enzyme activity of the GS gene mutant.

Disclosure of Invention

Based on the above situation, the present invention aims to provide a yeast mutant with a key protein gene of glutamine synthetase gene function deletion, a preparation method of the yeast mutant with the glutamine synthetase gene function deletion and applications of the yeast mutant in research and development, medicine, chemical engineering and other fields.

The invention provides a yeast mutant with a function deletion function of a glutamine synthetase gene, wherein the GLN1 gene of the yeast mutant is deleted with part or all of GLN1 gene and causes the GLN1 gene to lose the function; preferably, the GLN1 gene of the yeast mutant lacks the deoxynucleotide sequence from the 961 st position to the 2113 rd position of the complete GLN1 gene, and the nucleotide sequence of the complete GLN1 gene is SEQ ID NO. 1.

In one embodiment according to the invention, the mutated GLN1 gene has the sequence SEQ ID NO 2.

In one embodiment according to the invention, the yeast mutant cell does not contain an exogenous plasmid.

The invention also provides a preparation method of the yeast mutant with the function deletion of the glutamine synthetase gene, which comprises the following steps:

1) selecting a target section of a GLN1 gene, determining a knockout technology for performing site-directed knockout on the target section, and designing a knockout vector based on an operation principle of the knockout technology; preferably, the knockout technique is selected from any of ZFN, teleen or CRISPR techniques; constructing a gene knockout vector, preferably by means of CRISPR;

2) constructing a functionally complementary gene vector based on the CDS of the GLN1 isogene in other species;

3) constructing a donor sequence containing a GLN1 homologous recombination donor sequence based on the GLN1 gene;

4) simultaneously transforming the excision vector, the function complementary gene vector and the donor sequence in the steps 1) to 3) into a yeast cell;

5) after several days of culture in SC-H + Q medium which is added with glutamine and resistance components corresponding to the resistance gene and does not contain histidine, the yeast strain with the deletion of the 961-2113 position of the GLN1 gene is identified and selected by PCR and stored, and the yeast mutant with the function deletion of the glutamine synthetase gene is obtained.

In one embodiment according to the present invention, the preparation method further comprises:

6) inoculating the yeast mutant strain stored in the step 4) into SC-H + Q culture without resistance components for several days, then separating and inoculating into an SC-H + Q solid culture medium, picking a plurality of single colonies in the SC-H + Q solid culture medium, inoculating each single colony into the SC-H + Q solid culture medium and the SC-H + Q solid culture medium containing the resistance components at the same time, and marking;

7) selecting and storing colonies which can grow on the SC-H + Q solid culture medium and can not grow on the SC-H + Q solid culture medium containing the resistance components after several days; thus obtaining the yeast mutant without the shearing vector plasmid.

In one embodiment according to the present invention, the preparation method further comprises:

8) inoculating the yeast mutant obtained in the step 7) on a YPAD + Q solid culture medium added with glutamine, selecting a single colony to be inoculated on another YPAD + Q solid culture medium added with glutamine again after culturing for several days, selecting a plurality of single colonies after subculturing for 3-5 generations, respectively washing and diluting the single colonies with sterile water, and then respectively inoculating the yeast of each single colony on an SC + Q solid culture medium added with glutamine and an SC-H + Q solid culture medium at the same time and marking; selecting and storing the bacterial strains which can grow on the SC + Q solid culture medium but can not grow on the SC-H + Q solid culture medium, thus obtaining the yeast mutant with the functional complementary gene vector plasmid removed.

In one embodiment according to the invention, the knockout technique in step 1) is selected from any of ZFN, teleen or CRISPR techniques; preferably CRISPR technology.

In one embodiment according to the invention, the GLN1 isogene in step 2) is the CDS sequence of the rice OsGS1 gene, preferably the OsGS1 gene, SEQ ID No. 5; preferably, the function-complementing gene vector comprises a His3 expression cassette (nucleotide sequence is shown as SEQ ID NO: 10), a TEF1 promoter (nucleotide sequence is shown as SEQ ID NO: 11), a CDS sequence (nucleotide sequence is shown as SEQ ID NO: 5) of an OsGS1 gene and an ADH1 terminator (nucleotide sequence is shown as SEQ ID NO: 12) which are connected in sequence.

In one embodiment according to the invention, the donor sequence in step 3) is prepared by a method comprising the following steps:

PCR amplification is carried out by taking genome DNA of a certain yeast strain as a template and using primers GLN1A-F (EQ ID NO:23) and GLN1A-R (EQ ID NO:24) to obtain a segment GLN1 Donor, PCR amplification is carried out by using primers GLN1B-F (SEQ ID NO:26) and GLN1B-R2(SEQ ID NO:27) to obtain a segment GLN1 Donor B, and then overlapping extension PCR amplification is carried out by using a mixture of GLN1-Donor and GLN1-Donor B as a template and using primers GLN1A-F and GLN1B-R2 to obtain a donor sequence.

The invention also provides the application of the yeast mutant with the function deletion of the glutamine synthetase gene or the yeast mutant with the function deletion of the glutamine synthetase gene prepared by the preparation method in the identification of the GS function of yeast, the identification of the resistance of the GS in the yeast to glufosinate-ammonium or the directed evolution identification of the GS.

The technical scheme provided by the invention has the following beneficial effects:

the method provided by the invention can accurately realize gene fragment deletion, so that the GLN1 gene function of the yeast is lost. Meanwhile, considering the situation that mutants are difficult to screen even on a culture medium added with glutamine after the GLN1 gene of the yeast is knocked out, the invention can replace the function of yeast GLN1 by transforming the function complementary gene, thereby screening mutant strains with the GLN1 knock-out fragments more easily.

Drawings

FIG. 1 shows a diagram of YCplac22 vector;

FIG. 2 shows a map of the PY24 vector;

FIG. 3 is a map of PY24-OsGS1 vector;

FIG. 4 shows a map of PY24-OsGS2 vector;

FIG. 5 is a diagram of the PY24-GLN1 vector;

FIG. 6 is a gel electrophoresis image of the identification of GLN1 mutant by PCR;

FIG. 7 is a graph showing the results of GLN1 function loss verification;wherein, 1, Wild Type (WT): yeast strain BY4741 with no endogenous GLN1 knockout; 2. BY4741_GLN1ΔEndogenous GLN1 knock-out yeast strain BY4741_GLN1Δ(ii) a 3. OsGS 1: yeast strain BY4741 after GLN1 knockout_GLN1ΔTransferring into PY24-OsGS1 vector; 4. OsGS 2: yeast strain BY4741 after GLN1 knockout_GLN1ΔTransferring into PY24-OsGS2 vector; 5. GLN 1: yeast strain BY4741 after GLN1 knockout_GLN1ΔTransferring into PY24-GLN1 vector.

Detailed Description

The following examples are intended to illustrate the present application and are not intended to limit the scope of the present application.

Specific embodiments of the present application will be described in more detail below with reference to the accompanying drawings. These embodiments are provided so that this disclosure will be thorough and complete, and will fully convey the scope of the disclosure to those skilled in the art.

In the following description and in the claims, the terms "include" and "comprise" are used in an open-ended fashion, and thus should be interpreted to mean "include, but not limited to. The description which follows is a preferred embodiment of the present application, but is made for the purpose of illustrating the general principles of the application and not for the purpose of limiting the scope of the application. The protection scope of the present application shall be subject to the definitions of the appended claims.

The experimental procedures in the following examples are conventional unless otherwise specified. Materials, reagents, instruments, and the like used in the following examples were purchased from conventional biochemical reagent suppliers, unless otherwise specified.

It should be understood that although yeast strain BY4741 is used in the examples of the present invention, it is for illustrative purposes only and is not intended to be limiting, and that it is within the scope of the present invention to use other types of yeast strains.

The yeast culture medium used in the invention:

YPAD medium:

10g/L yeast extract, 20g/L peptone, 0.1g/L adenine sulfate, 20g/L D-glucose, pH 5.6. Agar powder 20g/L was added to the solid medium.

YPAD + Q medium:

10g/L yeast extract, 20g/L peptone, 0.1g/L adenine sulfate, 20g/L D-glucose, 0.5 g/L-glutamine, pH 5.6. Agar powder 20g/L was added to the solid medium.

SC medium:

YNB (ammonium sulfate-containing nitrogen source without amino yeast), 6.7g/L, D-glucose 20g/L, L-glutamine 0.05g/L, L-isoleucine 0.05g/L, L-methionine 0.05g/L, L-phenylalanine 0.05g/L, L-proline 0.05g/L, L-serine 0.05g/L, L-tyrosine 0.05g/L, L-valine 0.05g/L, L-adenine 0.1g/L, L-arginine 0.1g/L, L-cysteine 0.1g/L, L-histidine 0.1g/L, L-leucine 0.1g/L, L-lysine 0.1g/L, L-threonine 0.1g/L, L-tryptophan 0.1g/L, l-uracil 0.1g/L, pH5.6. Agar powder 20g/L was added to the solid medium.

SC + Q medium:

YNB (ammonium sulfate-containing nitrogen source without amino yeast), 6.7g/L, D-glucose 20g/L, L-glutamine 0.05g/L, L-isoleucine 0.05g/L, L-methionine 0.05g/L, L-phenylalanine 0.05g/L, L-proline 0.05g/L, L-serine 0.05g/L, L-tyrosine 0.05g/L, L-valine 0.05g/L, L-adenine 0.1g/L, L-arginine 0.1g/L, L-cysteine 0.1g/L, L-histidine 0.1g/L, L-leucine 0.1g/L, L-lysine 0.1g/L, L-threonine 0.1g/L, L-tryptophan 0.1g/L, l-, uracil 0.1g/L, L-glutamine 0.5g/L, pH5.6. 20g/L agar powder is also added into the solid culture medium.

SC-H medium:

YNB (containing ammonium sulfate and without amino yeast nitrogen source) 6.7g/L, D-glucose 20g/L, L-glutamine 0.05g/L, L-isoleucine 0.05g/L, L-methionine 0.05g/L, L-phenylalanine 0.05g/L, L-proline 0.05g/L, L-serine 0.05g/L, L-tyrosine 0.05g/L, L-valine 0.05g/L, L-adenine 0.1g/L, L-arginine 0.1g/L, L-cysteine 0.1g/L, L-leucine 0.1g/L, L-lysine 0.1g/L, L-threonine 0.1g/L, L-tryptophan 0.1g/L, L-uracil 0.1g/L, pH 5.6. Agar powder 20g/L was added to the solid medium.

SC-H + Q medium:

YNB (containing ammonium sulfate and without amino yeast nitrogen source) 6.7g/L, D-glucose 20g/L, L-glutamine 0.05g/L, L-isoleucine 0.05g/L, L-methionine 0.05g/L, L-phenylalanine 0.05g/L, L-proline 0.05g/L, L-serine 0.05g/L, L-tyrosine 0.05g/L, L-valine 0.05g/L, L-adenine 0.1g/L, L-arginine 0.1g/L, L-cysteine 0.1g/L, L-leucine 0.1g/L, L-lysine 0.1g/L, L-threonine 0.1g/L, L-tryptophan 0.1g/L, L-uracil 0.1g/L, l-glutamine 0.5g/L, pH 5.6. Agar powder 20g/L was added to the solid medium.

Example 1: a yeast strain with deletion mutation of the function of glutamine synthetase gene GLN1 is prepared.

In this example, 1153 bases of the 961-th-2113 position of the GLN1 gene (nucleotide sequence shown in SEQ ID NO: 1) in yeast were all deleted by transforming a functional complementary gene and homologous recombination to obtain a GLN1 functional deletion mutant. The sequence of the final mutant GLN1 gene is shown in SEQ ID NO. 2. The specific experimental procedure is as follows:

construction of GLN1 Gene specific site knockout vector

The site-directed knockout method can be selected from, but not limited to, ZFN, TELEN or CRISPR and other gene knockout technologies, and can also be selected from other feasible knockout methods. Accurate recombination repair can be realized only by transforming the homologous recombination donor template in yeast, and when the homologous recombination donor template is transformed, the homologous recombination repair frequency can be increased by simultaneously transforming the gene site-specific knockout vector.

The method for selecting CRISPR in the research shows that two target spots GLN1sg3 and GLN1sg5 are designed on the GLN1 gene of the yeast (the target spot design is referred to http:// chopchop. A knockout vector PY10 is constructed and obtained by taking a pCAS (Addgene No. 60847) vector as a framework through a Gibson assembly method, PY10 contains G418 resistance, the specific steps are as follows,

the pCAS vector is subjected to double digestion by SmaI and BglII to recover a large fragment for later use, and PCR amplification is respectively carried out by using four pairs of primers with pCAS as a template, wherein the four pairs of primers comprise a pCas-gF1/GLN1sg3-R1 amplification product sequence A, a GLN1sg3-F1/P1sg1-R2 amplification product sequence B, a P1sg2-F1/GLN1sg5-R2 amplification product sequence C, and a GLN1sg5-F1/pCas-gR1 amplification product sequence D. The pCAS vector is prepared by using SmaI and BglII to carry out double enzyme digestion to recover a large fragment, then assembling the large fragment and A, B, C, D fragments through Gibson, and obtaining a vector PY10, wherein the PY10 contains two GLN1 target spots with the following sequence,

(SEQ ID NO:8)GLN1sg3 ATCATGTGTGAAACTGTTTG；

(SEQ ID NO:9)GLN1sg5 TATCTAGAACTGGACCAAAG。

construction of GLN1 function-complementing Gene vector

Transformation of the vector YCplac22(GenBank: X75455, shown in FIG. 1) firstly replaced Trp1 in YCplac22 by His3 expression cassette by Gibson assembly, and secondly linked TEF1 promoter and ADH1 terminator with YCplac22 to obtain the vector PY24 (shown in FIG. 2). Then, the rice Nipponbare cDNA is used as a template, a primer Y24 GS1-F/Y24 GS1-R is used for PCR amplification to obtain rice OsGS1 gene CDS, and the rice OsGS1 gene CDS is connected with a PY24 vector to obtain PY24-OsGS1 (shown in figure 3).

PCR method for preparing GLN1 homologous recombination Donor sequence GLN1 Donor

Taking yeast strain BY4741 genome DNA as a template, carrying out PCR amplification BY using primers GLN1A-F and GLN1A-R to obtain a fragment GLN1 Donor, carrying out PCR amplification BY using primers GLN1B-F and GLN1B-R2 to obtain a fragment GLN1 Donor B, and carrying out overlap extension PCR amplification BY using a mixture of GLN1-Donor and GLN1-Donor B as a template and using primers GLN1A-F and GLN1B-R2 to obtain GLN1 Donor, wherein the nucleotide sequence is shown as SEQ ID NO: 4.

4. Transformed yeast

Yeast BY4741 was co-transformed using 1ug of vector PY10, 1ug of vector PY24-OsGS1 and 5ug of GLN1 Donor heat shock method, and the transformed yeast was spread on SC-H + Q plates containing 200mg/L G418 and cultured at 30 ℃ for 3-5 days.

5. Screening of mutants

Selecting yeast colonies which grow for 3-5 days on the plate obtained in the step 4, picking 16 colonies with toothpicks to inoculate into 5mL of SC-H + Q medium containing 200mg/L G418, culturing for 1-2 days at 30 ℃, and extracting yeast genome DNA. Yeast genome DNA is used as a template, primer GLNA-F3/GLN1B-R2 is used for PCR amplification, and only colonies which can amplify to 243bp length and not to 243bp length, or colonies which can amplify to fragments with 243bp and 1396bp length simultaneously, or colonies which amplify to fragments with 1396bp length are discarded. The colony amplified to 243bp length is sequenced by using a primer GLNA-F3/GLN1B-R2, the same sequence as SEQ ID NO. 2 is screened from the sequence, the obtained colony is the yeast strain of which the 961-th and 2113-th bases of the GLN1 gene are completely deleted, and the strain is preserved.

6. Removal of sheared vector plasmids in Yeast

According to the screening results of step 5, colonies of the corresponding yeast mutants were picked from the SC-H + Q plates containing 200mg/L G418 in step 4, inoculated into 5mL of SC-H + Q medium, and cultured at 30 ℃ for 1-2 days. Overnight cultured broth was streaked onto SC-H + Q plates using a streaking method. Single colonies were picked from the SC-H + Q plate, inoculated into 5mL of SC-H + Q medium, and cultured at 30 ℃ for 1-2 days. The cultured bacterial suspension was applied simultaneously to SC-H + Q plates and SC-H + Q plates containing 200mg/L G418, respectively, by streaking. If growth was possible on SC-H + Q plates but not on SC-H + Q plates containing G418, it was confirmed that the sheared vector plasmid had been removed from the strain, and the selected yeast strain was preserved.

7. Removal of PY24-OsGS1 vector plasmid from yeast

According to the screening result of step 6, diluting the screened strain 1000 times, taking 50ul of coated YPAD + Q plate, culturing for 3-5 days at 30 ℃, picking up a single colony, scattering in 1000ml of sterile water, taking 50ul of coated YPAD + Q plate, culturing for 3-5 days at 30 ℃. Then, single colonies were picked from this YPAD + Q plate and scattered in 1000ml of sterile water, followed by culturing on 50ul of the spread YPAD + Q plate at 30 ℃ for 3-5 days. Subculture is needed for 3-5 generations, single colonies are picked and scattered with 200uL of sterile water, the single colonies are washed for 1-2 times with the sterile water and finally scattered in 50uL of sterile water, and 1uL of bacterial liquid is taken and respectively spotted on an SC + Q plate and an SC-H + Q plate. If the strain can grow on an SC + Q plate but cannot grow on an SC-H + Q plate, the strain is proved that the PY24-OsGS1 plasmid in the strain is removed, the obtained colony is the required yeast mutant which is 1153 basic groups of 961-2113 of GLN1 gene, and the screened yeast strain BY4741 which does not contain PY10 and PY24-OsGS1 plasmids and is mutated BY GLN1 gene is preserved_GLN1Δ。

Example 2: functional verification of GLN 1-deleted Yeast mutant obtained in example 1

In example 1, the rice-derived OsGS1 gene had been able to complement the function of yeast GLN1, and in order to further confirm the functional deletion of the GLN1 mutation, the rice-derived OsGS2 gene (SEQ ID NO: 6) and the yeast-endogenous gene GLN1 CDS (SEQ ID NO: 7) were selected for functional complementation verification, and the OsGS2 gene was a sequence from which the signal peptide was deleted.

Constructing a GLN1 function complementary vector, carrying out PCR amplification by using a primer Y24 GS2-F/Y24 GS2-R to obtain OsGS2, and carrying out PCR amplification by using Y24 GLN1-F/Y24 GLN1-R to obtain GLN 1. OsGS2 and GLN1 are Gibson assembled with PY24 to obtain vectors PY24-OsGS2 (shown in FIG. 4) and PY24-GLN1 (shown in FIG. 5), respectively.

The obtained vectors PY24-OsGS1, PY24-OsGS2 and PY24-GLN1 are respectively transformed into a yeast mutant strain BY4741 BY a heat shock method_GLN1ΔCoating an SC-H + Q plate, culturing for 3-5 days at 30 ℃, selecting a single colony to inoculate bacteria in 5mL of SC-H + Q culture medium, and culturing for 1-2 days at 30 ℃. 50ul of the bacterial solution was washed twice with sterile water and diluted to OD600 of about 0.1, and 1ul was spotted on YPAD, YPAD + Q, YPAD + Q + G418, SC + Q and SC-H plates, respectively, and cultured at 30 ℃ for 3 to 5 days to observe the results, as shown in FIG. 7.

The fig. 7 template is as follows:

1. wild Type (WT): yeast strain BY4741 with no endogenous GLN1 knockout;

2、BY4741_GLN1Δendogenous GLN1 knock-out yeast strain BY4741_GLN1Δ；

3. OsGS 1: yeast strain BY4741 after GLN1 knockout_GLN1ΔTransferring into PY24-OsGS1 vector;

4. OsGS 2: yeast strain BY4741 after GLN1 knockout_GLN1ΔTransferring into PY24-OsGS2 vector;

5. GLN 1: yeast strain BY4741 after GLN1 knockout_GLN1ΔTransferring into PY24-GLN1 vector.

After 3-5 days of culture at 30 ℃, all the bacteria can grow on YPAD + Q plates; BY4741 on YPAD PLATE_GLN1ΔNo growth occurs; all bacteria were unable to grow on YPAD + Q + G148 plates, demonstrating that PY10 had been removed; on SC plate only BY4741_GLN1ΔNo growth occurs; at SC + Q levelAll the bacteria on the plate can grow; growth of WT and BY4741 on SC-H plates_GLN1ΔNo growth was observed, demonstrating that PY24-OsGS1 had been removed. The combined colony growth conditions of OsGS1, OsGS2 and GLN1 can complement BY4741_GLN1ΔLoss of function. In addition, BY4741_GLN1ΔCan grow in liquid YPAD medium, but has a growth rate slower than that in YPAD + Q and SC + Q, BY4741_GLN1ΔCan grow in liquid YPAD + Q and SC + Q culture medium for 24-48 hr, and in liquid YPDA for 48-72 hr, at 30 deg.c and 220-250 rpm.

It should be noted that the above examples are only used to illustrate the technical solutions of the present invention and not to limit them. Although the present invention has been described in detail with reference to the examples given, those skilled in the art can modify the technical solution of the present invention as needed or equivalent substitutions without departing from the spirit and scope of the technical solution of the present invention.

Gene sequences related to the invention

SEQ ID NO 1 GLN1 genome sequence, 1000bp upstream of ATG and 500bp downstream of TAA;

AAACAGCCATTTTTCAATATGCGCTACCCGGCGGCGGAATATCGTCCCAGCTACATGATAGCCGCTTTTTTGTCTCTCTTTGTCCCACCTGTTCAAAGACATTTGGTAATCAGTTTGTCAGGACAATAGTAAACAAAAGTGCGCAAGTACACATGCGCTGCACGTGCGGCCGGAACAATGGCGCTTTTGGCTCGTCCGGATGATGCGAAAGGGAAAATAAAATCTCGCAATCGGAAAAACACTCGCGAGAACCAAAACAAGGATCCCCTAAACCCAGTACCCGCATACGGTTCTCCCGGGGAAAAGGGGGCGGAGGCCGGACGATGAGTGTTACCCGGATAGGACTACGGATCGCTTCGCACGTTTGTTTACAATTGATGACTGCGCTCCCCTAATAGATAAGATAAGCTCGCGAAGGCAGAAAAAAAAAAGTCTTCTACAGCAGTTGGTCCGCACAGACGATGCCAGACGGTGTTTTATCGAAAATTTTTTTCGCATCATAGTGCCATTTGTGGTCATTATTATTCCCCAAATATGCGAAAATAGTACACTATTTTTGGCAGGAGAGTAGGCTGATATGCCGCATTGATGTCCTGTGTAGCGAAACACAAACAAAAAAAGAAAAAGTAGGATGAAAAAAAGAAAAGTAATATGAAAAAAGAGTGAAAAATTAATTCATTTGTTAGTGTAAGCGGTCAGGTGTAAGTAGTAGGCTTGATAATGAATTAAAGATGACTCCGACGCATATTGTTTGCCATGTTTTTATTTTAGTTTGTAGATTTCTTTTTTTGTAATATATAAGGGAGTGATTCTATATATCGAATTCTCAGGCTTGGTTGGTTCGTAGGTTGTTCTGTCTTTGTTTTCGTTAGGTAAGAACATCACACAAAGATAACTATAGAATCACATACATATTTGTGAGAAATTAACTTCATTTCATTTATAGAAGAAGTTCAACCGAAACAAAAATTAAACATAATATAATATAATATAATCAAAAATGGCTGAAGCAAGCATCGAAAAGACTCAAATTTTACAAAAATATCTAGAACTGGACCAAAGAGGTAGAATAATTGCCGAATACGTTTGGATCGATGGTACTGGTAACTTACGTTCCAAAGGTAGAACTTTGAAGAAGAGAATCACATCCATTGACCAATTGCCAGAATGGAACTTCGACGGTTCTTCTACCAACCAAGCGCCAGGCCACGACTCTGACATCTATTTGAAACCCGTTGCTTACTACCCAGATCCCTTCAGGAGAGGTGACAACATTGTTGTCTTGGCCGCATGTTACAACAATGACGGTACTCCAAACAAGTTCAACCACAGACACGAAGCTGCCAAGCTATTTGCTGCTCATAAGGATGAAGAAATCTGGTTTGGTCTAGAACAAGAATACACTCTATTTGACATGTATGACGATGTTTACGGATGGCCAAAGGGTGGGTACCCAGCTCCACAAGGTCCTTACTACTGTGGTGTTGGTGCCGGTAAGGTTTATGCCAGAGACATGATCGAAGCTCACTACAGAGCTTGTTTGTATGCCGGATTAGAAATTTCTGGTATTAACGCTGAAGTCATGCCATCTCAATGGGAATTCCAAGTCGGTCCATGTACCGGTATTGACATGGGTGACCAATTATGGATGGCCAGATACTTTTTGCACAGAGTGGCAGAAGAGTTTGGTATCAAGATCTCATTCCATCCAAAGCCATTGAAGGGTGACTGGAACGGTGCCGGTTGTCACACTAACGTTTCCACCAAGGAAATGAGACAACCAGGTGGTATGAAATACATCGAACAAGCCATCGAGAAGTTATCCAAGAGACACGCTGAACACATTAAGTTGTACGGTAGCGATAACGACATGAGATTAACTGGTAGACATGAAACCGCTTCCATGACTGCCTTTTCTTCTGGTGTCGCCAACAGAGGTAGCTCAATTAGAATCCCAAGATCCGTCGCCAAGGAAGGTTACGGTTACTTTGAAGACCGTAGACCAGCTTCCAACATCGACCCATACTTGGTTACAGGTATCATGTGTGAAACTGTTTGCGGTGCTATTGACAATGCTGACATGACGAAGGAATTTGAAAGAGAATCTTCATAAGCATAATACAATGGTGCAAAATTTTTTTTAGGCAGGAACTAATCTACTAATAAACTAACAATAATGCACAGGAAATATTAATGATTTATTTATTTATTTTACTACTATATTACATTACTTTTTTACATAAAAAATTTCCCATCTCACGATCAAAAACAGGCATGAGAAAAAATCAAAATTTATAAAATTAATTTCTAATAAATTAACTGTAATGACATAAAATAAGAGGCTGCGACAGTCGAATTTTTTCTTTTTTTTTTTCTGCAAAGCGACGCTGTGTTGTATATTGCTCTAAAATAATTTTCTATTGTTTTCCTCATGCCATTACCCTACCTACCCGTGCATAATTACACGAGGGGGAGAGCTTTTTCTTCCCAAACCAGACCAGGAAAAAAAAAAAGGTTTGATAATGAAAAAAAAAAAAAGTATTGTATATGACTGTTTTCCTGATAAAAGAATGCCTGCAATAATTCAAAGACAAGAGATATAAAAGTGCACTG

2 GLN1 KO genome sequence Precisely knocked out CDS region sequence

AAACAGCCATTTTTCAATATGCGCTACCCGGCGGCGGAATATCGTCCCAGCTACATGATAGCCGCTTTTTTGTCTCTCTTTGTCCCACCTGTTCAAAGACATTTGGTAATCAGTTTGTCAGGACAATAGTAAACAAAAGTGCGCAAGTACACATGCGCTGCACGTGCGGCCGGAACAATGGCGCTTTTGGCTCGTCCGGATGATGCGAAAGGGAAAATAAAATCTCGCAATCGGAAAAACACTCGCGAGAACCAAAACAAGGATCCCCTAAACCCAGTACCCGCATACGGTTCTCCCGGGGAAAAGGGGGCGGAGGCCGGACGATGAGTGTTACCCGGATAGGACTACGGATCGCTTCGCACGTTTGTTTACAATTGATGACTGCGCTCCCCTAATAGATAAGATAAGCTCGCGAAGGCAGAAAAAAAAAAGTCTTCTACAGCAGTTGGTCCGCACAGACGATGCCAGACGGTGTTTTATCGAAAATTTTTTTCGCATCATAGTGCCATTTGTGGTCATTATTATTCCCCAAATATGCGAAAATAGTACACTATTTTTGGCAGGAGAGTAGGCTGATATGCCGCATTGATGTCCTGTGTAGCGAAACACAAACAAAAAAAGAAAAAGTAGGATGAAAAAAAGAAAAGTAATATGAAAAAAGAGTGAAAAATTAATTCATTTGTTAGTGTAAGCGGTCAGGTGTAAGTAGTAGGCTTGATAATGAATTAAAGATGACTCCGACGCATATTGTTTGCCATGTTTTTATTTTAGTTTGTAGATTTCTTTTTTTGTAATATATAAGGGAGTGATTCTATATATCGAATTCTCAGGCTTGGTTGGTTCGTAGGTTGTTCTGTCTTTGTTTTCGTTAGGTAAGAACATCACACAAAGATAACTATAGAATCACATACATATTTGTGAGAAATTAACTTCATTTCATTTATAGAAGAAGTTCAACCGGCATAATACAATGGTGCAAAATTTTTTTTAGGCAGGAACTAATCTACTAATAAACTAACAATAATGCACAGGAAATATTAATGATTTATTTATTTATTTTACTACTATATTACATTACTTTTTTACATAAAAAATTTCCCATCTCACGATCAAAAACAGGCATGAGAAAAAATCAAAATTTATAAAATTAATTTCTAATAAATTAACTGTAATGACATAAAATAAGAGGCTGCGACAGTCGAATTTTTTCTTTTTTTTTTTCTGCAAAGCGACGCTGTGTTGTATATTGCTCTAAAATAATTTTCTATTGTTTTCCTCATGCCATTACCCTACCTACCCGTGCATAATTACACGAGGGGGAGAGCTTTTTCTTCCCAAACCAGACCAGGAAAAAAAAAAAGGTTTGATAATGAAAAAAAAAAAAAGTATTGTATATGACTGTTTTCCTGATAAAAGAATGCCTGCAATAATTCAAAGACAAGAGATATAAAAGTGCACTG

1153bp of sequence knocked out by SEQ ID NO 3 GLN1 genome sequence

AAACAAAAATTAAACATAATATAATATAATATAATCAAAAATGGCTGAAGCAAGCATCGAAAAGACTCAAATTTTACAAAAATATCTAGAACTGGACCAAAGAGGTAGAATAATTGCCGAATACGTTTGGATCGATGGTACTGGTAACTTACGTTCCAAAGGTAGAACTTTGAAGAAGAGAATCACATCCATTGACCAATTGCCAGAATGGAACTTCGACGGTTCTTCTACCAACCAAGCGCCAGGCCACGACTCTGACATCTATTTGAAACCCGTTGCTTACTACCCAGATCCCTTCAGGAGAGGTGACAACATTGTTGTCTTGGCCGCATGTTACAACAATGACGGTACTCCAAACAAGTTCAACCACAGACACGAAGCTGCCAAGCTATTTGCTGCTCATAAGGATGAAGAAATCTGGTTTGGTCTAGAACAAGAATACACTCTATTTGACATGTATGACGATGTTTACGGATGGCCAAAGGGTGGGTACCCAGCTCCACAAGGTCCTTACTACTGTGGTGTTGGTGCCGGTAAGGTTTATGCCAGAGACATGATCGAAGCTCACTACAGAGCTTGTTTGTATGCCGGATTAGAAATTTCTGGTATTAACGCTGAAGTCATGCCATCTCAATGGGAATTCCAAGTCGGTCCATGTACCGGTATTGACATGGGTGACCAATTATGGATGGCCAGATACTTTTTGCACAGAGTGGCAGAAGAGTTTGGTATCAAGATCTCATTCCATCCAAAGCCATTGAAGGGTGACTGGAACGGTGCCGGTTGTCACACTAACGTTTCCACCAAGGAAATGAGACAACCAGGTGGTATGAAATACATCGAACAAGCCATCGAGAAGTTATCCAAGAGACACGCTGAACACATTAAGTTGTACGGTAGCGATAACGACATGAGATTAACTGGTAGACATGAAACCGCTTCCATGACTGCCTTTTCTTCTGGTGTCGCCAACAGAGGTAGCTCAATTAGAATCCCAAGATCCGTCGCCAAGGAAGGTTACGGTTACTTTGAAGACCGTAGACCAGCTTCCAACATCGACCCATACTTGGTTACAGGTATCATGTGTGAAACTGTTTGCGGTGCTATTGACAATGCTGACATGACGAAGGAATTTGAAAGAGAATCTTCATAA

Donor sequence for recombinant knockout of SEQ ID NO 4 GLN1 Donor

GGCTTGGTTGGTTCGTAGGTTGTTCTGTCTTTGTTTTCGTTAGGTAAGAACATCACACAAAGATAACTATAGAATCACATACATATTTGTGAGAAATTAACTTCATTTCATTTATAGAAGAAGTTCAACCGGCATAATACAATGGTGCAAAATTTTTTTTAGGCAGGAACTAATCTACTAATAAACTAACAATAATGCACAGGAA

5 Rice OsGS1 Gene CDS sequence

ATGGCTTCTCTCACCGATCTCGTCAACCTCAACCTCTCCGACACCACGGAGAAGATCATCGCCGAGTACATATGGATCGGTGGATCTGGCATGGATCTCAGGAGCAAGGCTAGGACTCTCTCCGGCCCTGTGACTGATCCCAGCAAGCTGCCCAAGTGGAACTACGATGGCTCCAGCACCGGCCAGGCCCCCGGCGAGGACAGTGAGGTCATCCTGTACCCACAGGCTATCTTCAAGGACCCATTCAGGAAGGGAAACAACATCCTTGTCATGTGCGATTGCTACACGCCAGCCGGAGAACCGATCCCCACCAACAAGAGGCACAATGCTGCCAAGATCTTCAGCTCCCCTGAGGTTGCTTCTGAGGAGCCCTGGTACGGTATTGAGCAAGAGTACACCCTCCTCCAGAAGGACATCAACTGGCCCCTTGGCTGGCCTGTTGGTGGCTTCCCTGGTCCTCAGGGTCCTTACTACTGTGGTATCGGTGCTGACAAGTCTTTTGGGCGTGATATTGTTGACTCCCACTACAAGGCTTGCCTCTATGCCGGCATCAACATCAGTGGAATCAACGGCGAGGTCATGCCAGGACAGTGGGAGTTCCAAGTTGGCCCGTCTGTCGGCATTTCTGCCGGTGATCAGGTGTGGGTTGCTCGCTACATTCTTGAGAGGATCACCGAGATCGCCGGAGTCGTCGTCTCATTTGACCCCAAGCCCATCCCGGGAGACTGGAACGGTGCTGGTGCTCACACCAACTACAGCACCAAGTCGATGAGGAACGATGGTGGCTACGAGATCATCAAGTCCGCCATTGAGAAGCTCAAGCTCAGGCACAAGGAGCACATCTCCGCCTACGGCGAGGGCAACGAGCGCCGGCTCACCGGCAGGCACGAGACCGCCGACATCAACACCTTCAGCTGGGGAGTTGCCAACCGCGGCGCCTCGGTCCGCGTCGGCCGGGAGACGGAGCAGAACGGCAAGGGCTACTTCGAGGATCGCCGGCCGGCGTCCAACATGGACCCTTACATCGTCACCTCCATGATCGCCGAGACCACCATCATCTGGAAGCCCTGA

6 Rice OsGS2 Gene CDS sequence Signal peptide sequence removed

ATGGCGCAGGCGGTGGTGCCGGCGATGCAGTGCCAGGTCGGGGCCGTGCGGGCGAGGCCGGCGGCGGCTGCGGCGGCGGCGGGGGGGAGGGTGTGGGGAGTCAGGAGGACCGGGCGCGGCACGTCGGGGTTCAGGGTGATGGCCGTGAGCACGGAGACCACCGGGGTGGTGACGCGGATGGAGCAGCTGCTCAACATGGACACCACCCCCTTCACCGACAAGATCATCGCCGAGTACATCTGGGTTGGAGGAACTGGAATTGACCTCAGAAGCAAATCAAGGACAATATCAAAACCAGTGGAGGACCCCTCGGAGCTACCAAAATGGAACTACGATGGATCAAGCACAGGGCAAGCTCCAGGAGAAGATAGTGAAGTCATCTTATACCCACAGGCTATATTCAAGGACCCATTTCGAGGTGGCAACAACATATTGGTTATGTGTGATACCTACACACCAGCTGGGGAACCCATCCCTACTAACAAACGTAACAGGGCTGCACAAGTATTCAGTGATCCAAAGGTTGTCAGCCAAGTGCCATGGTTTGGAATAGAACAGGAGTACACTTTGCTCCAGAGAGACGTAAACTGGCCTCTTGGCTGGCCCGTTGGAGGCTACCCTGGGCCCCAGGGTCCATACTACTGCGCTGTAGGATCGGACAAATCGTTTGGCCGTGACATATCAGATGCTCACTACAAGGCATGTCTTTATGCTGGAATTAACATTAGTGGAACAAATGGAGAGGTCATGCCTGGTCAGTGGGAGTACCAGGTTGGACCTAGTGTCGGTATTGAAGCTGGAGACCACATATGGATTTCAAGATATATTCTTGAGAGAATAACGGAGCAGGCTGGTGTAGTGCTTACCCTTGACCCCAAACCAATTCAGGGAGACTGGAATGGAGCTGGGTGCCACACAAACTACAGCACCAAGAGTATGCGTGAAGATGGAGGATTTGAGGTGATCAAGAAGGCAATCCTAAACCTATCACTTCGCCATGACTTGCATATAAGTGCATATGGTGAAGGAAATGAAAGGAGGTTGACAGGTTTACACGAGACAGCTAGCATTGACAATTTCTCATGGGGTGTGGCAAACCGTGGATGCTCTATTCGGGTGGGGCGAGACACCGAGGCGAAGGGAAAAGGCTACTTGGAAGACCGTCGCCCGGCATCAAACATGGACCCGTACGTCGTGACAGCGCTATTGGCTGAAACCACAATTCTTTGGGAGCCAACCCTCGAAGCGGAGGTTCTTGCTGCTAAGAAGTTGGCCCTGAAGGTATGA

CDS sequence of yeast GLN1 gene of SEQ ID NO 7

ATGGCTGAAGCAAGCATCGAAAAGACTCAAATTTTACAAAAATATCTAGAACTGGACCAAAGAGGTAGAATAATTGCCGAATACGTTTGGATCGATGGTACTGGTAACTTACGTTCCAAAGGTAGAACTTTGAAGAAGAGAATCACATCCATTGACCAATTGCCAGAATGGAACTTCGACGGTTCTTCTACCAACCAAGCGCCAGGCCACGACTCTGACATCTATTTGAAACCCGTTGCTTACTACCCAGATCCCTTCAGGAGAGGTGACAACATTGTTGTCTTGGCCGCATGTTACAACAATGACGGTACTCCAAACAAGTTCAACCACAGACACGAAGCTGCCAAGCTATTTGCTGCTCATAAGGATGAAGAAATCTGGTTTGGTCTAGAACAAGAATACACTCTATTTGACATGTATGACGATGTTTACGGATGGCCAAAGGGTGGGTACCCAGCTCCACAAGGTCCTTACTACTGTGGTGTTGGTGCCGGTAAGGTTTATGCCAGAGACATGATCGAAGCTCACTACAGAGCTTGTTTGTATGCCGGATTAGAAATTTCTGGTATTAACGCTGAAGTCATGCCATCTCAATGGGAATTCCAAGTCGGTCCATGTACCGGTATTGACATGGGTGACCAATTATGGATGGCCAGATACTTTTTGCACAGAGTGGCAGAAGAGTTTGGTATCAAGATCTCATTCCATCCAAAGCCATTGAAGGGTGACTGGAACGGTGCCGGTTGTCACACTAACGTTTCCACCAAGGAAATGAGACAACCAGGTGGTATGAAATACATCGAACAAGCCATCGAGAAGTTATCCAAGAGACACGCTGAACACATTAAGTTGTACGGTAGCGATAACGACATGAGATTAACTGGTAGACATGAAACCGCTTCCATGACTGCCTTTTCTTCTGGTGTCGCCAACAGAGGTAGCTCAATTAGAATCCCAAGATCCGTCGCCAAGGAAGGTTACGGTTACTTTGAAGACCGTAGACCAGCTTCCAACATCGACCCATACTTGGTTACAGGTATCATGTGTGAAACTGTTTGCGGTGCTATTGACAATGCTGACATGACGAAGGAATTTGAAAGAGAATCTTCATAA

Target sequence of SEQ ID NO 8 GLN1sg3

ATCATGTGTGAAACTGTTTG

Target sequence of SEQ ID NO 9 GLN1sg5

TATCTAGAACTGGACCAAAG

10 His3 expression cassette sequence

TCGAGTTCAAGAGAAAAAAAAAGAAAAAGCAAAAAGAAAAAAGGAAAGCGCGCCTCGTTCAGAATGACACGTATAGAATGATGCATTACCTTGTCATCTTCAGTATCATACTGTTCGTATACATACTTACTGACATTCATAGGTATACATATATACACATGTATATATATCGTATGCTGCAGCTTTAAATAATCGGTGTCACTACATAAGAACACCTTTGGTGGAGGGAACATCGTTGGTACCATTGGGCGAGGTGGCTTCTCTTATGGCAACCGCAAGAGCCTTGAACGCACTCTCACTACGGTGATGATCATTCTTGCCTCGCAGACAATCAACGTGGAGGGTAATTCTGCTAGCCTCTGCAAAGCTTTCAAGAAAATGCGGGATCATCTCGCAAGAGAGATCTCCTACTTTCTCCCTTTGCAAACCAAGTTCGACAACTGCGTACGGCCTGTTCGAAAGATCTACCACCGCTCTGGAAAGTGCCTCATCCAAAGGCGCAAATCCTGATCCAAACCTTTTTACTCCACGCACGGCCCCTAGGGCCTCTTTAAAAGCTTGACCGAGAGCAATCCCGCAGTCTTCAGTGGTGTGATGGTCGTCTATGTGTAAGTCACCAATGCACTCAACGATTAGCGACCAGCCGGAATGCTTGGCCAGAGCATGTATCATATGGTCCAGAAACCCTATACCTGTGTGGACGTTAATCACTTGCGATTGTGTGGCCTGTTCTGCTACTGCTTCTGCCTCTTTTTCTGGGAAGATCGAGTGCTCTATCGCTAGGGGACCACCCTTTAAAGAGATCGCAATCTGAATCTTGGTTTCATTTGTAATACGCTTTACTAGGGCTTTCTGCTCTGTCATCTTTGCCTTCGTTTATCTTGCCTGCTCATTTTTTAGTATATTCTTCGAAGAAATCACATTACTTTATATAATGTATAATTCATTATGTGATAATGCCAATCGCTAAGAAAAAAAAAGAGTCATCCGCTAGGTGGAAAAAAAAAAATGAAAATCATTACCGAGGCATAAAAAAATATAGAGTGTACTAGAGGAGGCCAAGAGTAATAGAAAAAGAAAATTGCGGGAAAGGACTGTGTTATGACTTCCCTGACTAATGCCGTGTTCAAACGATACCTGGCAGTGACTCCTAGCGCTCACCAAGCTCTTAAAACGGGAATT

11 TEF1 promoter sequence

CACACACCATAGCTTCAAAATGTTTCTACTCCTTTTTTACTCTTCCAGATTTTCTCGGACTCCGCGCATCGCCGTACCACTTCAAAACACCCAAGCACAGCATACTAAATTTCCCCTCTTTCTTCCTCTAGGGTGTCGTTAATTACCCGTACTAAAGGTTTGGAAAAGAAAAAAGAGACCGCCTCGTTTCTTTTTCTTCGTCGAAAAAGGCAATAAAAATTTTTATCACGTTTCTTTTTCTTGAAAATTTTTTTTTTTGATTTTTTTCTCTTTCGATGACCTCCCATTGATATTTAAGTTAATAAACGGTCTTCAATTTCTCAAGTTTCAGTTTCATTTTTCTTGTTCTATTACAACTTTTTTTACTTCTTGCTCATTAGAAAGAAAGCATAGCAATCTAATCTAAGTTTTAATTACAAA

12 ADH1 terminator sequence

CGAATTTCTTATGATTTATGATTTTTATTATTAAATAAGTTATAAAAAAAATAAGTGTATACAAATTTTAAAGTGACTCTTAGGTTTTAAAACGAAAATTCTTATTCTTGAGTAACTCTTTCCTGTAGGTCAGGTTGCTTTCTCAGGTATAGCATGAGGTCGCTC

Primer name and primer nucleotide sequence (5 '-3')

SEQ ID NO:13 Y24 GS1-F

CAAACTCTAGAGGATCCCCATGGCTTCTCTCACCGATCTCGTCA

SEQ ID NO:14 Y24 GS1-R

ATTCGCGAGCTCGGTACCCTCAGGGCTTCCAGATGATGGTGGTCT

SEQ ID NO:15 pCas-gF1

GGGCGTTCGACTCGCCCCCGGGAGAGATGGCCGGCATGGTCCCA

SEQ ID NO:16 GLN1sg3-R1

CAAACAGTTTCACACATGATAAAGTCCCATTCGCCACCCGAAGGTG

SEQ ID NO:17 GLN1sg3-F1

ATCATGTGTGAAACTGTTTGGTTTTAGAGCTAGAAATAGCAAGTT

SEQ ID NO:18 P1sg1-R2

GCCGGCCATCAAAAGCACCGACTCGGTGCCACTTTTTC

SEQ ID NO:19 P1sg2-F1

CGGTGCTTTTGATGGCCGGCATGGTCCCAGCCTCCT

SEQ ID NO:20 GLN1sg5-R2

CTTTGGTCCAGTTCTAGATAAAAGTCCCATTCGCCACCCGAAGGTG

SEQ ID NO:21 GLN1sg5-F1

TATCTAGAACTGGACCAAAGGTTTTAGAGCTAGAAATAGCAAGTT

SEQ ID NO:22 pCas-gR1

GGACGAGGCAAGCTAAACAGATCTCTAGACCTATATCCACTAGAC

SEQ ID NO:23 GLN1A-F

GGCTTGGTTGGTTCGTAGGTTGT

SEQ ID NO:24 GLN1A-R

TGTATTATGCCGGTTGAACTTCTTCTATAAATGAAATG

SEQ ID NO:25 GLNA-F3

TAATATATAAGGGAGTGATTCTATATATC

SEQ ID NO:26 GLN1B-F

AGTTCAACCGGCATAATACAATGGTGCAAAATTTTTTTTAG

SEQ ID NO:27 GLN1B-R2

TTCCTGTGCATTATTGTTAGTTTATTAG

SEQ ID NO:28 Y24 GS2-F

caaactctagaggatccccATGGCCGTGAGCACGGAGACCACCG

SEQ ID NO:29 Y24 GS2-R

attcgcgagctcggtacccTCATACCTTCAGGGCCAACTTCTTAG

SEQ ID NO:30 Y24 GLN1-F

caaactctagaggatccccATGGCTGAAGCAAGCATCGAAAAGACTCAA

SEQ ID NO:31 Y24 GLN1-R

attcgcgagctcggtacccCTATGAAGATTCTCTTTCAAATTCCTTCGT

Sequence listing

<110> Kochia-Davida Biotechnology Ltd

<120> yeast mutant with function deletion of glutamine synthetase gene and preparation method and application thereof

<160> 31

<170> SIPOSequenceListing 1.0

<210> 1

<211> 2613

<212> DNA

<213> Saccharomyces cerevisiae

<400> 1

aaacagccat ttttcaatat gcgctacccg gcggcggaat atcgtcccag ctacatgata 60

gccgcttttt tgtctctctt tgtcccacct gttcaaagac atttggtaat cagtttgtca 120

ggacaatagt aaacaaaagt gcgcaagtac acatgcgctg cacgtgcggc cggaacaatg 180

gcgcttttgg ctcgtccgga tgatgcgaaa gggaaaataa aatctcgcaa tcggaaaaac 240

actcgcgaga accaaaacaa ggatccccta aacccagtac ccgcatacgg ttctcccggg 300

gaaaaggggg cggaggccgg acgatgagtg ttacccggat aggactacgg atcgcttcgc 360

acgtttgttt acaattgatg actgcgctcc cctaatagat aagataagct cgcgaaggca 420

gaaaaaaaaa agtcttctac agcagttggt ccgcacagac gatgccagac ggtgttttat 480

cgaaaatttt tttcgcatca tagtgccatt tgtggtcatt attattcccc aaatatgcga 540

aaatagtaca ctatttttgg caggagagta ggctgatatg ccgcattgat gtcctgtgta 600

gcgaaacaca aacaaaaaaa gaaaaagtag gatgaaaaaa agaaaagtaa tatgaaaaaa 660

gagtgaaaaa ttaattcatt tgttagtgta agcggtcagg tgtaagtagt aggcttgata 720

atgaattaaa gatgactccg acgcatattg tttgccatgt ttttatttta gtttgtagat 780

ttcttttttt gtaatatata agggagtgat tctatatatc gaattctcag gcttggttgg 840

ttcgtaggtt gttctgtctt tgttttcgtt aggtaagaac atcacacaaa gataactata 900

gaatcacata catatttgtg agaaattaac ttcatttcat ttatagaaga agttcaaccg 960

aaacaaaaat taaacataat ataatataat ataatcaaaa atggctgaag caagcatcga 1020

aaagactcaa attttacaaa aatatctaga actggaccaa agaggtagaa taattgccga 1080

atacgtttgg atcgatggta ctggtaactt acgttccaaa ggtagaactt tgaagaagag 1140

aatcacatcc attgaccaat tgccagaatg gaacttcgac ggttcttcta ccaaccaagc 1200

gccaggccac gactctgaca tctatttgaa acccgttgct tactacccag atcccttcag 1260

gagaggtgac aacattgttg tcttggccgc atgttacaac aatgacggta ctccaaacaa 1320

gttcaaccac agacacgaag ctgccaagct atttgctgct cataaggatg aagaaatctg 1380

gtttggtcta gaacaagaat acactctatt tgacatgtat gacgatgttt acggatggcc 1440

aaagggtggg tacccagctc cacaaggtcc ttactactgt ggtgttggtg ccggtaaggt 1500

ttatgccaga gacatgatcg aagctcacta cagagcttgt ttgtatgccg gattagaaat 1560

ttctggtatt aacgctgaag tcatgccatc tcaatgggaa ttccaagtcg gtccatgtac 1620

cggtattgac atgggtgacc aattatggat ggccagatac tttttgcaca gagtggcaga 1680

agagtttggt atcaagatct cattccatcc aaagccattg aagggtgact ggaacggtgc 1740

cggttgtcac actaacgttt ccaccaagga aatgagacaa ccaggtggta tgaaatacat 1800

cgaacaagcc atcgagaagt tatccaagag acacgctgaa cacattaagt tgtacggtag 1860

cgataacgac atgagattaa ctggtagaca tgaaaccgct tccatgactg ccttttcttc 1920

tggtgtcgcc aacagaggta gctcaattag aatcccaaga tccgtcgcca aggaaggtta 1980

cggttacttt gaagaccgta gaccagcttc caacatcgac ccatacttgg ttacaggtat 2040

catgtgtgaa actgtttgcg gtgctattga caatgctgac atgacgaagg aatttgaaag 2100

agaatcttca taagcataat acaatggtgc aaaatttttt ttaggcagga actaatctac 2160

taataaacta acaataatgc acaggaaata ttaatgattt atttatttat tttactacta 2220

tattacatta cttttttaca taaaaaattt cccatctcac gatcaaaaac aggcatgaga 2280

aaaaatcaaa atttataaaa ttaatttcta ataaattaac tgtaatgaca taaaataaga 2340

ggctgcgaca gtcgaatttt ttcttttttt ttttctgcaa agcgacgctg tgttgtatat 2400

tgctctaaaa taattttcta ttgttttcct catgccatta ccctacctac ccgtgcataa 2460

ttacacgagg gggagagctt tttcttccca aaccagacca ggaaaaaaaa aaaggtttga 2520

taatgaaaaa aaaaaaaagt attgtatatg actgttttcc tgataaaaga atgcctgcaa 2580

taattcaaag acaagagata taaaagtgca ctg 2613

<210> 2

<211> 1460

<212> DNA

<213> Saccharomyces cerevisiae

<400> 2

aaacagccat ttttcaatat gcgctacccg gcggcggaat atcgtcccag ctacatgata 60

gccgcttttt tgtctctctt tgtcccacct gttcaaagac atttggtaat cagtttgtca 120

ggacaatagt aaacaaaagt gcgcaagtac acatgcgctg cacgtgcggc cggaacaatg 180

gcgcttttgg ctcgtccgga tgatgcgaaa gggaaaataa aatctcgcaa tcggaaaaac 240

actcgcgaga accaaaacaa ggatccccta aacccagtac ccgcatacgg ttctcccggg 300

gaaaaggggg cggaggccgg acgatgagtg ttacccggat aggactacgg atcgcttcgc 360

acgtttgttt acaattgatg actgcgctcc cctaatagat aagataagct cgcgaaggca 420

gaaaaaaaaa agtcttctac agcagttggt ccgcacagac gatgccagac ggtgttttat 480

cgaaaatttt tttcgcatca tagtgccatt tgtggtcatt attattcccc aaatatgcga 540

aaatagtaca ctatttttgg caggagagta ggctgatatg ccgcattgat gtcctgtgta 600

gcgaaacaca aacaaaaaaa gaaaaagtag gatgaaaaaa agaaaagtaa tatgaaaaaa 660

gagtgaaaaa ttaattcatt tgttagtgta agcggtcagg tgtaagtagt aggcttgata 720

atgaattaaa gatgactccg acgcatattg tttgccatgt ttttatttta gtttgtagat 780

ttcttttttt gtaatatata agggagtgat tctatatatc gaattctcag gcttggttgg 840

ttcgtaggtt gttctgtctt tgttttcgtt aggtaagaac atcacacaaa gataactata 900

gaatcacata catatttgtg agaaattaac ttcatttcat ttatagaaga agttcaaccg 960

gcataataca atggtgcaaa atttttttta ggcaggaact aatctactaa taaactaaca 1020

ataatgcaca ggaaatatta atgatttatt tatttatttt actactatat tacattactt 1080

ttttacataa aaaatttccc atctcacgat caaaaacagg catgagaaaa aatcaaaatt 1140

tataaaatta atttctaata aattaactgt aatgacataa aataagaggc tgcgacagtc 1200

gaattttttc tttttttttt tctgcaaagc gacgctgtgt tgtatattgc tctaaaataa 1260

ttttctattg ttttcctcat gccattaccc tacctacccg tgcataatta cacgaggggg 1320

agagcttttt cttcccaaac cagaccagga aaaaaaaaaa ggtttgataa tgaaaaaaaa 1380

aaaaagtatt gtatatgact gttttcctga taaaagaatg cctgcaataa ttcaaagaca 1440

agagatataa aagtgcactg 1460

<210> 3

<211> 1153

<212> DNA

<213> Saccharomyces cerevisiae

<400> 3

aaacaaaaat taaacataat ataatataat ataatcaaaa atggctgaag caagcatcga 60

aaagactcaa attttacaaa aatatctaga actggaccaa agaggtagaa taattgccga 120

atacgtttgg atcgatggta ctggtaactt acgttccaaa ggtagaactt tgaagaagag 180

aatcacatcc attgaccaat tgccagaatg gaacttcgac ggttcttcta ccaaccaagc 240

gccaggccac gactctgaca tctatttgaa acccgttgct tactacccag atcccttcag 300

gagaggtgac aacattgttg tcttggccgc atgttacaac aatgacggta ctccaaacaa 360

gttcaaccac agacacgaag ctgccaagct atttgctgct cataaggatg aagaaatctg 420

gtttggtcta gaacaagaat acactctatt tgacatgtat gacgatgttt acggatggcc 480

aaagggtggg tacccagctc cacaaggtcc ttactactgt ggtgttggtg ccggtaaggt 540

ttatgccaga gacatgatcg aagctcacta cagagcttgt ttgtatgccg gattagaaat 600

ttctggtatt aacgctgaag tcatgccatc tcaatgggaa ttccaagtcg gtccatgtac 660

cggtattgac atgggtgacc aattatggat ggccagatac tttttgcaca gagtggcaga 720

agagtttggt atcaagatct cattccatcc aaagccattg aagggtgact ggaacggtgc 780

cggttgtcac actaacgttt ccaccaagga aatgagacaa ccaggtggta tgaaatacat 840

cgaacaagcc atcgagaagt tatccaagag acacgctgaa cacattaagt tgtacggtag 900

cgataacgac atgagattaa ctggtagaca tgaaaccgct tccatgactg ccttttcttc 960

tggtgtcgcc aacagaggta gctcaattag aatcccaaga tccgtcgcca aggaaggtta 1020

cggttacttt gaagaccgta gaccagcttc caacatcgac ccatacttgg ttacaggtat 1080

catgtgtgaa actgtttgcg gtgctattga caatgctgac atgacgaagg aatttgaaag 1140

agaatcttca taa 1153

<210> 4

<211> 205

<212> DNA

<213> Saccharomyces cerevisiae

<400> 4

ggcttggttg gttcgtaggt tgttctgtct ttgttttcgt taggtaagaa catcacacaa 60

agataactat agaatcacat acatatttgt gagaaattaa cttcatttca tttatagaag 120

aagttcaacc ggcataatac aatggtgcaa aatttttttt aggcaggaac taatctacta 180

ataaactaac aataatgcac aggaa 205

<210> 5

<211> 1071

<212> DNA

<213> Rice (Oryza sativa L.)

<400> 5

atggcttctc tcaccgatct cgtcaacctc aacctctccg acaccacgga gaagatcatc 60

gccgagtaca tatggatcgg tggatctggc atggatctca ggagcaaggc taggactctc 120

tccggccctg tgactgatcc cagcaagctg cccaagtgga actacgatgg ctccagcacc 180

ggccaggccc ccggcgagga cagtgaggtc atcctgtacc cacaggctat cttcaaggac 240

ccattcagga agggaaacaa catccttgtc atgtgcgatt gctacacgcc agccggagaa 300

ccgatcccca ccaacaagag gcacaatgct gccaagatct tcagctcccc tgaggttgct 360

tctgaggagc cctggtacgg tattgagcaa gagtacaccc tcctccagaa ggacatcaac 420

tggccccttg gctggcctgt tggtggcttc cctggtcctc agggtcctta ctactgtggt 480

atcggtgctg acaagtcttt tgggcgtgat attgttgact cccactacaa ggcttgcctc 540

tatgccggca tcaacatcag tggaatcaac ggcgaggtca tgccaggaca gtgggagttc 600

caagttggcc cgtctgtcgg catttctgcc ggtgatcagg tgtgggttgc tcgctacatt 660

cttgagagga tcaccgagat cgccggagtc gtcgtctcat ttgaccccaa gcccatcccg 720

ggagactgga acggtgctgg tgctcacacc aactacagca ccaagtcgat gaggaacgat 780

ggtggctacg agatcatcaa gtccgccatt gagaagctca agctcaggca caaggagcac 840

atctccgcct acggcgaggg caacgagcgc cggctcaccg gcaggcacga gaccgccgac 900

atcaacacct tcagctgggg agttgccaac cgcggcgcct cggtccgcgt cggccgggag 960

acggagcaga acggcaaggg ctacttcgag gatcgccggc cggcgtccaa catggaccct 1020

tacatcgtca cctccatgat cgccgagacc accatcatct ggaagccctg a 1071

<210> 6

<211> 1287

<212> DNA

<213> Rice (Oryza sativa L.)

<400> 6

atggcgcagg cggtggtgcc ggcgatgcag tgccaggtcg gggccgtgcg ggcgaggccg 60

gcggcggctg cggcggcggc gggggggagg gtgtggggag tcaggaggac cgggcgcggc 120

acgtcggggt tcagggtgat ggccgtgagc acggagacca ccggggtggt gacgcggatg 180

gagcagctgc tcaacatgga caccaccccc ttcaccgaca agatcatcgc cgagtacatc 240

tgggttggag gaactggaat tgacctcaga agcaaatcaa ggacaatatc aaaaccagtg 300

gaggacccct cggagctacc aaaatggaac tacgatggat caagcacagg gcaagctcca 360

ggagaagata gtgaagtcat cttataccca caggctatat tcaaggaccc atttcgaggt 420

ggcaacaaca tattggttat gtgtgatacc tacacaccag ctggggaacc catccctact 480

aacaaacgta acagggctgc acaagtattc agtgatccaa aggttgtcag ccaagtgcca 540

tggtttggaa tagaacagga gtacactttg ctccagagag acgtaaactg gcctcttggc 600

tggcccgttg gaggctaccc tgggccccag ggtccatact actgcgctgt aggatcggac 660

aaatcgtttg gccgtgacat atcagatgct cactacaagg catgtcttta tgctggaatt 720

aacattagtg gaacaaatgg agaggtcatg cctggtcagt gggagtacca ggttggacct 780

agtgtcggta ttgaagctgg agaccacata tggatttcaa gatatattct tgagagaata 840

acggagcagg ctggtgtagt gcttaccctt gaccccaaac caattcaggg agactggaat 900

ggagctgggt gccacacaaa ctacagcacc aagagtatgc gtgaagatgg aggatttgag 960

gtgatcaaga aggcaatcct aaacctatca cttcgccatg acttgcatat aagtgcatat 1020

ggtgaaggaa atgaaaggag gttgacaggt ttacacgaga cagctagcat tgacaatttc 1080

tcatggggtg tggcaaaccg tggatgctct attcgggtgg ggcgagacac cgaggcgaag 1140

ggaaaaggct acttggaaga ccgtcgcccg gcatcaaaca tggacccgta cgtcgtgaca 1200

gcgctattgg ctgaaaccac aattctttgg gagccaaccc tcgaagcgga ggttcttgct 1260

gctaagaagt tggccctgaa ggtatga 1287

<210> 7

<211> 1113

<212> DNA

<213> Saccharomyces cerevisiae

<400> 7

atggctgaag caagcatcga aaagactcaa attttacaaa aatatctaga actggaccaa 60

agaggtagaa taattgccga atacgtttgg atcgatggta ctggtaactt acgttccaaa 120

ggtagaactt tgaagaagag aatcacatcc attgaccaat tgccagaatg gaacttcgac 180

ggttcttcta ccaaccaagc gccaggccac gactctgaca tctatttgaa acccgttgct 240

tactacccag atcccttcag gagaggtgac aacattgttg tcttggccgc atgttacaac 300

aatgacggta ctccaaacaa gttcaaccac agacacgaag ctgccaagct atttgctgct 360

cataaggatg aagaaatctg gtttggtcta gaacaagaat acactctatt tgacatgtat 420

gacgatgttt acggatggcc aaagggtggg tacccagctc cacaaggtcc ttactactgt 480

ggtgttggtg ccggtaaggt ttatgccaga gacatgatcg aagctcacta cagagcttgt 540

ttgtatgccg gattagaaat ttctggtatt aacgctgaag tcatgccatc tcaatgggaa 600

ttccaagtcg gtccatgtac cggtattgac atgggtgacc aattatggat ggccagatac 660

tttttgcaca gagtggcaga agagtttggt atcaagatct cattccatcc aaagccattg 720

aagggtgact ggaacggtgc cggttgtcac actaacgttt ccaccaagga aatgagacaa 780

ccaggtggta tgaaatacat cgaacaagcc atcgagaagt tatccaagag acacgctgaa 840

cacattaagt tgtacggtag cgataacgac atgagattaa ctggtagaca tgaaaccgct 900

tccatgactg ccttttcttc tggtgtcgcc aacagaggta gctcaattag aatcccaaga 960

tccgtcgcca aggaaggtta cggttacttt gaagaccgta gaccagcttc caacatcgac 1020

ccatacttgg ttacaggtat catgtgtgaa actgtttgcg gtgctattga caatgctgac 1080

atgacgaagg aatttgaaag agaatcttca taa 1113

<210> 8

<211> 20

<212> DNA

<213> Saccharomyces cerevisiae

<400> 8

atcatgtgtg aaactgtttg 20

<210> 9

<211> 20

<212> DNA

<213> Saccharomyces cerevisiae

<400> 9

tatctagaac tggaccaaag 20

<210> 10

<211> 1182

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 10

tcgagttcaa gagaaaaaaa aagaaaaagc aaaaagaaaa aaggaaagcg cgcctcgttc 60

agaatgacac gtatagaatg atgcattacc ttgtcatctt cagtatcata ctgttcgtat 120

acatacttac tgacattcat aggtatacat atatacacat gtatatatat cgtatgctgc 180

agctttaaat aatcggtgtc actacataag aacacctttg gtggagggaa catcgttggt 240

accattgggc gaggtggctt ctcttatggc aaccgcaaga gccttgaacg cactctcact 300

acggtgatga tcattcttgc ctcgcagaca atcaacgtgg agggtaattc tgctagcctc 360

tgcaaagctt tcaagaaaat gcgggatcat ctcgcaagag agatctccta ctttctccct 420

ttgcaaacca agttcgacaa ctgcgtacgg cctgttcgaa agatctacca ccgctctgga 480

aagtgcctca tccaaaggcg caaatcctga tccaaacctt tttactccac gcacggcccc 540

tagggcctct ttaaaagctt gaccgagagc aatcccgcag tcttcagtgg tgtgatggtc 600

gtctatgtgt aagtcaccaa tgcactcaac gattagcgac cagccggaat gcttggccag 660

agcatgtatc atatggtcca gaaaccctat acctgtgtgg acgttaatca cttgcgattg 720

tgtggcctgt tctgctactg cttctgcctc tttttctggg aagatcgagt gctctatcgc 780

taggggacca ccctttaaag agatcgcaat ctgaatcttg gtttcatttg taatacgctt 840

tactagggct ttctgctctg tcatctttgc cttcgtttat cttgcctgct cattttttag 900

tatattcttc gaagaaatca cattacttta tataatgtat aattcattat gtgataatgc 960

caatcgctaa gaaaaaaaaa gagtcatccg ctaggtggaa aaaaaaaaat gaaaatcatt 1020

accgaggcat aaaaaaatat agagtgtact agaggaggcc aagagtaata gaaaaagaaa 1080

attgcgggaa aggactgtgt tatgacttcc ctgactaatg ccgtgttcaa acgatacctg 1140

gcagtgactc ctagcgctca ccaagctctt aaaacgggaa tt 1182

<210> 11

<211> 420

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 11

cacacaccat agcttcaaaa tgtttctact ccttttttac tcttccagat tttctcggac 60

tccgcgcatc gccgtaccac ttcaaaacac ccaagcacag catactaaat ttcccctctt 120

tcttcctcta gggtgtcgtt aattacccgt actaaaggtt tggaaaagaa aaaagagacc 180

gcctcgtttc tttttcttcg tcgaaaaagg caataaaaat ttttatcacg tttctttttc 240

ttgaaaattt ttttttttga tttttttctc tttcgatgac ctcccattga tatttaagtt 300

aataaacggt cttcaatttc tcaagtttca gtttcatttt tcttgttcta ttacaacttt 360

ttttacttct tgctcattag aaagaaagca tagcaatcta atctaagttt taattacaaa 420

<210> 12

<211> 165

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 12

cgaatttctt atgatttatg atttttatta ttaaataagt tataaaaaaa ataagtgtat 60

acaaatttta aagtgactct taggttttaa aacgaaaatt cttattcttg agtaactctt 120

tcctgtaggt caggttgctt tctcaggtat agcatgaggt cgctc 165

<210> 13

<211> 44

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 13

caaactctag aggatcccca tggcttctct caccgatctc gtca 44

<210> 14

<211> 45

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 14

attcgcgagc tcggtaccct cagggcttcc agatgatggt ggtct 45

<210> 15

<211> 44

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 15

gggcgttcga ctcgcccccg ggagagatgg ccggcatggt ccca 44

<210> 16

<211> 46

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 16

caaacagttt cacacatgat aaagtcccat tcgccacccg aaggtg 46

<210> 17

<211> 45

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 17

atcatgtgtg aaactgtttg gttttagagc tagaaatagc aagtt 45

<210> 18

<211> 38

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 18

gccggccatc aaaagcaccg actcggtgcc actttttc 38

<210> 19

<211> 36

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 19

cggtgctttt gatggccggc atggtcccag cctcct 36

<210> 20

<211> 46

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 20

ctttggtcca gttctagata aaagtcccat tcgccacccg aaggtg 46

<210> 21

<211> 45

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 21

tatctagaac tggaccaaag gttttagagc tagaaatagc aagtt 45

<210> 22

<211> 45

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 22

ggacgaggca agctaaacag atctctagac ctatatccac tagac 45

<210> 23

<211> 23

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 23

ggcttggttg gttcgtaggt tgt 23

<210> 24

<211> 38

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 24

tgtattatgc cggttgaact tcttctataa atgaaatg 38

<210> 25

<211> 29

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 25

taatatataa gggagtgatt ctatatatc 29

<210> 26

<211> 41

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 26

agttcaaccg gcataataca atggtgcaaa atttttttta g 41

<210> 27

<211> 28

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 27

ttcctgtgca ttattgttag tttattag 28

<210> 28

<211> 44

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 28

caaactctag aggatcccca tggccgtgag cacggagacc accg 44

<210> 29

<211> 45

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 29

attcgcgagc tcggtaccct cataccttca gggccaactt cttag 45

<210> 30

<211> 49

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 30

caaactctag aggatcccca tggctgaagc aagcatcgaa aagactcaa 49

<210> 31

<211> 49

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 31

attcgcgagc tcggtacccc tatgaagatt ctctttcaaa ttccttcgt 49

Claims (10)

1. A yeast mutant with a function deletion of glutamine synthetase gene, which is characterized in that the GLN1 gene of the yeast mutant is deleted of part or all of GLN1 gene and leads to the loss of the function of GLN1 gene; preferably, the GLN1 gene of the yeast mutant lacks the deoxynucleotide sequence from the 961 st position to the 2113 rd position of the complete GLN1 gene, and the nucleotide sequence of the complete GLN1 gene is SEQ ID NO. 1.

2. The yeast mutant according to claim 1, wherein the mutated GLN1 gene has the sequence of SEQ ID NO 2.

3. The yeast mutant according to claim 1 or 2, wherein the yeast mutant cell does not contain an exogenous plasmid.

4. A method for producing a yeast mutant according to any one of claims 1 to 3, comprising:

1) selecting a target section of a GLN1 gene, determining a knockout technology for performing site-directed knockout on the target section, and designing a knockout vector based on an operation principle of the knockout technology; preferably, a gene knockout vector is constructed by a CRISPR method;

2) constructing a functionally complementary gene vector based on the CDS of the GLN1 isogene in other species;

3) constructing a donor sequence containing a GLN1 homologous recombination donor sequence based on the GLN1 gene;

4) simultaneously transforming the excision vector, the function complementary gene vector and the donor sequence in the steps 1) to 3) into a yeast cell;

5) after several days of culture in SC-H + Q medium which is added with glutamine and resistance components corresponding to the resistance genes and does not contain histidine, selecting a yeast strain with the 961-2113 knockout of the GLN1 gene for preservation through PCR identification, and obtaining the yeast mutant with the glutamine synthetase gene function deletion as claimed in any one of claims 1-3.

5. The method of claim 4, further comprising:

6) inoculating the yeast mutant strain stored in the step 5) into an SC-H + Q culture medium without a resistance component for several days, then separating and inoculating the yeast mutant strain into the SC-H + Q solid culture medium, picking a plurality of single colonies in the SC-H + Q solid culture medium, inoculating each single colony into the SC-H + Q solid culture medium and the SC-H + Q solid culture medium containing the resistance component at the same time, and marking;

7) selecting and storing colonies which can grow on the SC-H + Q solid culture medium and can not grow on the SC-H + Q solid culture medium containing the resistance components after several days; thus obtaining the yeast mutant without the shearing vector plasmid.

6. The method of claim 5, further comprising:

8) inoculating the yeast mutant obtained in the step 7) on a YPAD + Q solid culture medium added with glutamine, selecting a single colony to be inoculated on another YPAD + Q solid culture medium added with glutamine again after culturing for several days, selecting a plurality of single colonies after subculturing for 3-5 generations, respectively washing and diluting the single colonies with sterile water, and then respectively inoculating the yeast of each single colony on an SC + Q solid culture medium added with glutamine and an SC-H + Q solid culture medium at the same time and marking; selecting and storing the bacterial strains which can grow on the SC + Q solid culture medium but can not grow on the SC-H + Q solid culture medium, thus obtaining the yeast mutant with the functional complementary gene vector plasmid removed.

7. The method of preparation of claim 4, wherein the knockout technique in step 1) is selected from any of ZFN, teleen or CRISPR techniques; preferably, the gene knockout vector is constructed by the method of CRISPR.

8. The method according to claim 4, wherein the GLN1 isogene in step 2) is a CDS sequence of rice OsGS1 gene, preferably OsGS1 gene, SEQ ID NO: 5; preferably, the function-complementing gene vector comprises a His3 expression cassette, a TEF1 promoter, a CDS sequence of an OsGS1 gene and an ADH1 terminator which are connected in sequence.

9. The method of claim 4, wherein the donor sequence of step 3) is prepared by a method comprising:

PCR amplification is carried out by taking genome DNA of a certain yeast strain as a template and using primers GLN1A-F (EQ ID NO:23) and GLN1A-R (EQ ID NO:24) to obtain a segment GLN1 Donor, PCR amplification is carried out by using primers GLN1B-F (SEQ ID NO:26) and GLN1B-R2(SEQ ID NO:27) to obtain a segment GLN1 Donor B, and then overlapping extension PCR amplification is carried out by using a mixture of GLN1-Donor and GLN1-Donor B as a template and using primers GLN1A-F and GLN1B-R2 to obtain a donor sequence.

10. Use of the yeast mutant deficient in glutamine synthetase gene function according to any one of claims 1 to 3 or the yeast mutant deficient in glutamine synthetase gene function prepared by the preparation method according to any one of claims 4 to 9 for the identification of GS function in yeast, the identification of resistance of GS to glufosinate ammonium in yeast or the directed evolution identification of GS.

Images