CN114774455A - CRISPR/Cas9 vector suitable for fusarium verticillioides and construction method and application thereof - Google Patents

CRISPR/Cas9 vector suitable for fusarium verticillioides and construction method and application thereof Download PDF

Info

Publication number
CN114774455A
CN114774455A CN202210411872.1A CN202210411872A CN114774455A CN 114774455 A CN114774455 A CN 114774455A CN 202210411872 A CN202210411872 A CN 202210411872A CN 114774455 A CN114774455 A CN 114774455A
Authority
CN
China
Prior art keywords
seq
crispr
fusarium
sequences shown
nucleotide sequences
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN202210411872.1A
Other languages
Chinese (zh)
Inventor
郭维
唐婷婷
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Institute of Food Science and Technology of CAAS
Original Assignee
Institute of Food Science and Technology of CAAS
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Institute of Food Science and Technology of CAAS filed Critical Institute of Food Science and Technology of CAAS
Priority to CN202210411872.1A priority Critical patent/CN114774455A/en
Publication of CN114774455A publication Critical patent/CN114774455A/en
Pending legal-status Critical Current

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/80—Vectors or expression systems specially adapted for eukaryotic hosts for fungi
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C12N15/1137—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against enzymes
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/10—Transferases (2.)
    • C12N9/1048—Glycosyltransferases (2.4)
    • C12N9/1077—Pentosyltransferases (2.4.2)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/88—Lyases (4.)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P17/00—Preparation of heterocyclic carbon compounds with only O, N, S, Se or Te as ring hetero atoms
    • C12P17/10—Nitrogen as only ring hetero atom
    • C12P17/12—Nitrogen as only ring hetero atom containing a six-membered hetero ring
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y204/00—Glycosyltransferases (2.4)
    • C12Y204/02—Pentosyltransferases (2.4.2)
    • C12Y204/0201—Orotate phosphoribosyltransferase (2.4.2.10)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y401/00—Carbon-carbon lyases (4.1)
    • C12Y401/01—Carboxy-lyases (4.1.1)
    • C12Y401/01023—Orotidine-5'-phosphate decarboxylase (4.1.1.23)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/10—Type of nucleic acid
    • C12N2310/20—Type of nucleic acid involving clustered regularly interspaced short palindromic repeats [CRISPRs]

Abstract

The invention discloses a CRISPR/Cas9 vector suitable for fusarium verticillioides and a construction method and application thereof. The invention constructs the mutant fusarium verticillium with the damaged uracil biosynthesis related gene by using the CRISPR/Cas9 technology, and lays a molecular biological foundation for the research of the uracil biosynthesis related gene function in the fusarium verticillium. The invention utilizes CRISPR/Cas9 technology to destroy uracil biosynthesis related genes in Fusarium verticillium and establishes a CRISPR/Cas9 gene editing system suitable for Fusarium verticillium, thereby promoting the gene function research of Fusarium verticillium and laying a molecular biology foundation for exploring more genes with biological functions.

Description

CRISPR/Cas9 vector suitable for fusarium verticillioides and construction method and application thereof
Technical Field
The invention relates to a CRISPR/Cas9 vector applicable to fusarium verticillioides and a construction method and application thereof.
Background
The fusarium verticillioides is a plant pathogenic fungus which occurs in the global range, can cause the reduction of the yield of corns through the infection of pathogenic bacteria, can produce various mycotoxins, pollutes crops and agricultural and sideline products, and has influence on the health of people and livestock. Therefore, the research on the functional genome thereof to search a drug target for developing related pesticides has important economic significance. At present, the functional genome research of the fusarium verticillioides is limited by low research method efficiency and small quantity of resistance selection markers, and the progress is relatively slow, so that the development of a new gene editing technology has important significance on the basic research, metabolic engineering, synthetic biology research and the like of the fusarium verticillioides.
The uracil biosynthesis related gene can be used as an auxotroph screening marker to be applied to the gene function research of filamentous fungi. The orotidine-5' -phosphate decarboxylase coded by pyrG gene and the orotate phosphoribosyl transferase coded by pyrE gene play an important role in the de novo uracil synthesis pathway, and the uracil auxotrophic strain produced by the deletion of any one gene cannot normally synthesize uracil necessary for growth, and can grow only under the condition of exogenous uracil supplementation, and the mutant can be reversely screened by 5-fluoroorotic acid (5-FOA). The mechanism of 5-FOA screening is as follows: 5-FOA can enter a uracil de novo synthesis pathway as an orotic acid analog, and 5-fluorouracil with cytotoxicity is finally produced, so that the growth of a wild strain is inhibited, while an auxotrophic strain cannot convert 5-FOA into a toxic substance due to lack of a uracil synthesis pathway, and thus can grow. These properties give the pyrG and pyrE genes the potential to be developed as resistance selection marker genes. Research on uracil biosynthesis related genes in fusarium verticillium can promote the discovery of genetic transformation screening markers in the pathogens.
CRISPR/Cas9 is a gene editing technology that has been developed rapidly in recent years, and mainly comprises two parts: a Cas9 protein with DNA double strand cleavage function and a sgRNA capable of recognizing a target site. The sgRNA consists of crRNA capable of being combined with a target DNA sequence and tracRNA capable of being combined with Cas9 protein, wherein the crRNA guides the Cas9 protein to a target gene through the tracRNA to cut a DNA double strand, and the aims of gene damage, gene knockout, gene knock-in, single base editing and the like can be realized by combining a DNA repair mechanism of an organism and artificially designing an experiment. The CRISPR/Cas9 system has the advantages of simple principle, simple operation, high knockout efficiency, low cost and the like, and is widely applied to organisms such as animals, plants, bacteria, fungi and the like.
Disclosure of Invention
The invention aims to provide a CRISPR/Cas9 vector suitable for Fusarium verticillioides and a construction method and application thereof, solves the problems of low efficiency and small quantity of resistance selection markers of the existing Fusarium verticillioides genome function research method, accelerates research progress, and has important significance on basic research, metabolic engineering, synthetic biology research and the like of Fusarium verticillioides.
In order to achieve the purpose, the CRISPR/Cas9 vector applicable to Fusarium verticillium and the construction method and application thereof provided by the invention have the following technical scheme:
a construction method of CRISPR/Cas9 vector suitable for Fusarium verticillium comprises the following steps:
s1, respectively selecting target sites locus505 and locus86 with nucleic acid sequences shown as SEQ ID NO.1 and SEQ ID NO.2 according to exon sequences of genes pyrG and pyrE related to uracil biosynthesis;
s2, carrying out PCR by using a pFC334 vector as a template and adopting primer pairs with nucleotide sequences shown as SEQ ID NO.3 and SEQ ID NO.6, SEQ ID NO.5 and SEQ ID NO.4, and respectively amplifying to obtain fragments with nucleotide sequences shown as SEQ ID NO.9 and SEQ ID NO. 10; taking a pFC334 vector as a template, carrying out PCR by using primer pairs with nucleotide sequences shown as SEQ ID NO.3 and SEQ ID NO.8, SEQ ID NO.7 and SEQ ID NO.4, and amplifying to obtain fragments with nucleotide sequences shown as SEQ ID NO.11 and SEQ ID NO. 12; respectively taking fragments with nucleotide sequences shown as SEQ ID NO.9 and SEQ ID NO.10, SEQ ID NO.11 and SEQ ID NO.12 as templates, carrying out fusion PCR by using primer pairs with nucleotide sequences shown as SEQ ID NO.3 and SEQ ID NO.4, and amplifying to obtain sgRNA expression frames with nucleotide sequences shown as SEQ ID NO.13 and SEQ ID NO. 14;
s3, singly digesting the pFC332 vector by using a restriction enzyme PacI, respectively connecting sgRNA expression frame fragments obtained in the step S2 to the pFC332 vector by using a one-step cloning method, transforming the connection products into TG-1 escherichia coli competent cells, and obtaining the CRISPR/Cas9 vector suitable for fusarium verticillioides after ampicillin resistance screening, colony PCR screening and sequencing verification.
The invention also provides a CRISPR/Cas9 vector which is constructed by the construction method and is suitable for the fusarium verticillioides.
The invention also provides application of the CRISPR/Cas9 vector applicable to the fusarium verticillioides in research of uracil biosynthesis genes of the fusarium verticillioides.
Preferably, the application comprises the steps of:
introducing the CRISPR/Cas9 vector into a protoplast of Fusarium verticillium by a polyethylene glycol (PEG) mediated protoplast transformation method, screening by a hygromycin (Hyg) resistant plate, screening by a 5-fluoroorotic acid (5-FOA) resistant plate, picking a transformant, amplifying and culturing, extracting a genome, comparing with a sequence of a wild strain after sequencing, analyzing a mutation site of a target gene, and verifying the function of a uracil biosynthesis related gene by combining with the observation of the phenotype of the mutant.
The CRISPR/Cas9 vector suitable for Fusarium verticillioides and the construction method and application thereof solve the problems of low efficiency and small quantity of resistance selection markers of the current Fusarium verticillioides genome function research method, and have the following advantages:
the CRISPR/Cas9 vector suitable for F.verticillium lodiclodes is constructed, related genes for uracil biosynthesis are damaged, the function of a target gene is further verified through phenotype observation, and a technical basis is laid for functional genome research of the F.verticillium lodiclodiclodes and the discovery of novel drug targets.
Drawings
FIG. 1 is a diagram of the construction of the CRISPR/Cas9 vectors pFC332_ pyrG _ sgRNA505 and pFC332_ pyrE _ sgRNA86 targeting uracil biosynthesis-associated genes pyrG and pyrE of the present invention; wherein, A in the figure is a fusion amplification figure of sgRNA expression frame fragments corresponding to target sites locus505 and locus86, lanes 1-2 are the sgRNA expression frame fusion of locus505, and lanes 3-4 are the sgRNA expression frame fusion of locus 86; b in the figure is a colony PCR screening chart of a CRISPR/Cas9 vector pFC332_ pyrG _ sgRNA505, and a lane 1/4/5/7/8 is a positive clone; c in the figure is a colony PCR screening chart of CRISPR/Cas9 vector pFC332_ pyrE _ sgRNA86, and lanes 1-4/6-8 are positive clones; m in the figure represents a 1kb DNA ladder.
FIG. 2 is a diagram of protoplast preparation according to the invention; wherein, A in the figure is a young plant body detected by a microscope, and the state that spores germinate but do not completely grow into hyphae is the young plant body; in the figure, B is a picture of microscopic protoplast.
FIG. 3 is a diagram of the genotypes of pFC332_ pyrG _ sgRNA505 and pFC332_ pyrE _ sgRNA86, which are introduced into Fusarium verticillium protoplast for pyrG and pyrE gene disruption, respectively, of CRISPR/Cas9 vectors of the invention; wherein the numbers in parentheses indicate the number of mutants in which such a genotype change has occurred.
FIG. 4 is a phenotype diagram of the CRISPR/Cas9 vectors pFC332_ pyrG _ sgRNA505 and pFC332_ pyrE _ sgRNA86 respectively introduced into Fusarium verticillioides protoplast for pyrG and pyrE gene disruption; wherein, MM is minimum Medium; UU is 0.7g/L uracil +1.5 g/Luridine; 5-FOA is 1.5 g/L5-FOA; hyg is 50 μ g/mL Hygromycin; WT is wild type Fusarium verticillium; dis-pyrG is a disrupted mutant of the pyrG gene; dis-pyrE is a disrupted mutant of the pyrE gene.
Detailed Description
The technical solutions in the embodiments of the present invention will be described clearly and completely below, and it is obvious that the described embodiments are only a part of the embodiments of the present invention, and not all of the embodiments. All other embodiments, which can be obtained by a person skilled in the art without making any creative effort based on the embodiments in the present invention, belong to the protection scope of the present invention.
The experimental procedures in the examples are all conventional procedures unless otherwise specified.
The experimental materials used in the examples are all conventional biochemical reagents unless otherwise specified.
EXAMPLE 1 target site selection
Sequence information of genes pyrG (Gene ID: FVEG-04828) and pyrE (Gene ID: FVEG-06123) related to biosynthesis of fusarium verticillioides uracil is obtained on an EnsemblFungi website, a target site locus505 is selected from the 5 ' end of an exon region of the pyrG Gene, a target site locus86 is selected from the 5 ' end of the exon region of the pyrE Gene, and the selected target sites are located in a 20bp sequence at the 5 ' end of a PAM site (NGG). And (3) comparing the target site with the whole genome sequence of the fusarium verticillioides by utilizing a BLAST online comparison tool of an EnsemblFungi website, and performing subsequent operation after checking the specificity of the target site.
Sequence of locus505 (SEQ id No. 1):
5’-GTCGCCTTGAGGGTAGGATG-3’；
sequence of locus86 (SEQ ID NO. 2):
5’-GCAAGAATTCTTGCTTGTAG-3’。
example 2 construction of CRISPR/Cas9 vector
PCR was performed using pFC334 vector as template and pFC334_ PacI _ F/pyrG _ sgRNA505_ R, pyrG _ sgRNA505_ F/pFC334_ PacI _ R as primer pair using PrimeSTAR Max Premix (2X) to obtain fragments pyrG _ sgRNA505_1 and pyrG _ sgRNA505_ 2.
Using pFC334 vector as template, pFC334_ PacI _ F/pyrE _ sgRNA86_ R, pyrE _ sgRNA86_ F/pFC334_ PacI _ R as primer pair, PrimeSTAR Max Premix (2X) was used to perform PCR, and then pyrE _ sgRNA86_1 and pyrE _ sgRNA86_2 fragments were obtained by amplification.
Fusion PCR was performed using PrimeSTAR Max Premix (2X) using fragments of pyrG _ sgRNA505_1 and pyrG _ sgRNA505_2, pyrE _ sgRNA86_1 and pyrE _ sgRNA86_2 as templates, and pFC334_ PacI _ F/pFC334_ PacI _ R as primer pairs, respectively, to amplify the expression cassettes of pyrG _ sgRNA505 and pyrE _ sgRNA 86. Each sgRNA expression cassette includes: the amplified expression cassette product was subjected to agarose electrophoresis as shown in a in fig. 1, wherein the sgRNA expression cassette fusion in lanes 1-2 is that of locus505, the sgRNA expression cassette fusion in lanes 3-4 is that of locus86, and M is 1kb DNAladder.
The pFC332 vector is singly cut by restriction enzyme PacI, then the expression frames of pyrG _ sgRNA505 and pyrE _ sgRNA86 are respectively connected into the pFC332 vector by a one-step cloning method, the connection product is transformed into TG-1 escherichia coli by heat shock at 42 ℃, after Amp resistance screening and colony PCR screening by pFC334_ PacI _ F/pFC334_ PacI _ R primer pair, the amplification product is subjected to agarose electrophoresis, and the results are respectively shown as B and C in figure 1, wherein B in figure 1 is a colony PCR screening chart of pFC332_ pyrG _ sgRNA505, and a lane 1/4/5/7/8 is a positive clone; in FIG. 1, C is a colony PCR spot map of pFC332_ pyrE _ sgRNA86, lanes 1-4/6-8 are positive clones, and M is 1kb DNAsladder. Respectively selecting a positive clone shake bacteria, sending the positive clone shake bacteria to a biological engineering company Limited for sequencing, and obtaining CRISPR/Cas9 vectors pFC332_ pyrG _ sgRNA505 and pFC332_ pyrE _ sgRNA86 for gene disruption after sequence comparison confirms no errors; coli containing the vectors pFC332_ pyrG _ sgRNA505 and pFC332_ pyrE _ sgRNA86 were shaken to extract plasmids.
Wherein the primer sequences used are as follows (5 '→ 3'):
pFC334_PacI_F(SEQ IDNO.3)：
TAGCTGTTTCCGCTGAGGGTTTAATGCGTAAGCTCCCTAATTGGC；
pFC334_PacI_R(SEQ IDNO.4)：
CTGCTGTCTCGGCTGAGGTCTTAATGAGCCAAGAGCGGATTCCTC；
pyrG_sgRNA505_F(SEQ IDNO.5)：
TGAGGACGAAACGAGTAAGCTCGTCGTCGCCTTGAGGGTAGGATGGTTTTAGAGC；
pyrG_sgRNA505_R(SEQ IDNO.6)：
GACGAGCTTACTCGTTTCGTCCTCACGGACTCATCAGGTCGCCCGGTGATGT；
pyrE_sgRNA86_F(SEQ IDNO.7)：
TGAGGACGAAACGAGTAAGCTCGTCGCAAGAATTCTTGCTTGTAGGTTTTAGAGC；
pyrE_sgRNA86_R(SEQ IDNO.8)：
GACGAGCTTACTCGTTTCGTCCTCACGGACTCATCAGGCAAGACGGTGATGT。
the nucleotide sequence of the resulting PCR product was as follows (5 '→ 3'):
fragment pyrG _ sgRNA505-1 (SEQ ID NO. 9):
TAGCTGTTTCCGCTGAGGGTTTAATGCGTAAGCTCCCTAATTGGCCCATCCGGCATCTGTAGGGCGTCCAAATATCGTGCCTCTCCTGCTTTGCCCGGTGTATGAAACCGGAAAGGCCGCTCAGGAGCTGGCCAGCGGCGCAGACCGGGAACACAAGCTGGCAGTCGACCCATCCGGTGCTCTACACTCGACCTGCTGAGGTCCCTCAGTCCCTGGTAGGCAGCTTTGCCCCGTCTGTCCGCCCGGTGTGTCGGCGGGGTTGACAAGGTCGTTGCGTCAGTCCAACATTTGTTGCCATATTTTCCTGCTCTCCCCACCAGCTGCTCTTTTCTTTTCTCTTTCTTTTCCCATCTTCAGTATATTCATCTTCCCATCCAAGAACCTTTATTTCCCCTAAGTAAGTACTTTGCTACATCCATACTCCATCCTTCCCATCCCTTATTCCTTTGAACCTTTCAGTTCGAGCTTTCCCACTTCATCGCAGCTTGACTAACAGCTACCCCGCTTGAGCAGACATCACCGGGCGACCTGATGAGTCCGTGAGGACGAAACGAGTAAGCTCGTC；
fragment pyrG _ sgRNA505-2 (SEQ ID NO. 10):
TGAGGACGAAACGAGTAAGCTCGTCGTCGCCTTGAGGGTAGGATGGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTGGCCGGCATGGTCCCAGCCTCCTCGCTGGCGCCGGCTGGGCAACATGCTTCGGCATGGCGAATGGGACTGATTTAATAGCTCCATGTCAACAAGAATAAAACGCGTTTCGGGTTTACCTCTTCCAGATACAGCTCATCTGCAATGCATTAATGCATTGGACCTCGCAACCCTAGTACGCCCTTCAGGCTCCGGCGAAGCAGAAGAATAGCTTAGCAGAGTCTATTTTCATTTTCGGGAGACGAGATCAAGCAGATCAACGGTCGTCAAGAGACCTACGAGACTGAGGAATCCGCTCTTGGCTCATTAAGACCTCAGCCGAGACAGCAG；
fragment pyrE _ sgRNA86-1 (SEQ ID NO. 11):
TAGCTGTTTCCGCTGAGGGTTTAATGCGTAAGCTCCCTAATTGGCCCATCCGGCATCTGTAGGGCGTCCAAATATCGTGCCTCTCCTGCTTTGCCCGGTGTATGAAACCGGAAAGGCCGCTCAGGAGCTGGCCAGCGGCGCAGACCGGGAACACAAGCTGGCAGTCGACCCATCCGGTGCTCTACACTCGACCTGCTGAGGTCCCTCAGTCCCTGGTAGGCAGCTTTGCCCCGTCTGTCCGCCCGGTGTGTCGGCGGGGTTGACAAGGTCGTTGCGTCAGTCCAACATTTGTTGCCATATTTTCCTGCTCTCCCCACCAGCTGCTCTTTTCTTTTCTCTTTCTTTTCCCATCTTCAGTATATTCATCTTCCCATCCAAGAACCTTTATTTCCCCTAAGTAAGTACTTTGCTACATCCATACTCCATCCTTCCCATCCCTTATTCCTTTGAACCTTTCAGTTCGAGCTTTCCCACTTCATCGCAGCTTGACTAACAGCTACCCCGCTTGAGCAGACATCACCGTCTTGCCTGATGAGTCCGTGAGGACGAAACGAGTAAGCTCGTC；
fragment pyrE _ sgRNA86-2 (SEQ ID NO. 12):
TGAGGACGAAACGAGTAAGCTCGTCGCAAGAATTCTTGCTTGTAGGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTGGCCGGCATGGTCCCAGCCTCCTCGCTGGCGCCGGCTGGGCAACATGCTTCGGCATGGCGAATGGGACTGATTTAATAGCTCCATGTCAACAAGAATAAAACGCGTTTCGGGTTTACCTCTTCCAGATACAGCTCATCTGCAATGCATTAATGCATTGGACCTCGCAACCCTAGTACGCCCTTCAGGCTCCGGCGAAGCAGAAGAATAGCTTAGCAGAGTCTATTTTCATTTTCGGGAGACGAGATCAAGCAGATCAACGGTCGTCAAGAGACCTACGAGACTGAGGAATCCGCTCTTGGCTCATTAAGACCTCAGCCGAGACAGCAG；
pyrG _ sgRNA505 expression cassette (SEQ ID NO.13)
TCCGCATCGGAGGTTTAATGCGTAAGCTCCTCCGGCATTGATCGCATCGGCATGGGCGTCCAAATCAATGCATGCGTCCAATGGCATCGGCAGGCAGACCGGAACACAAAGCTGGCAGTCGACCGCAGTCGACCGCAGTCGACCGCAGTCGACCTCCGTGGCAGTCGACCTCGACCTCGACCTCGACTGCAGTCGACCTCGACTCAGTTGAGGCAGCTTTGCCCTGCCGCCCGTCCTGGCCCTGGCCCGCCCGTGCCCTGGCAGCTTCCGGTCGGCATTCGACCTGAAGGTCGACCTCGACCTCGACCTCCAAGCTTCGACCTCGACCTGATTCACCTCCGTCGACCTCGACCTGAAGCATCAAGCCTCTCTGATTCACCTCTGATCAATCAATCAATTCTGAAGCCCTGATTCTGATTCTGAAGCATTCTGATTCTGCAGTATTCGACCTGAAGCATTCGACCTGAAGCATTCTGCAAGTCTGATTCGATGATTCGATGAAGCATTCGACCTGATTCGACCTGCAAGTCGATGAAGTATTCGACCTGCAAGTCGATGAAGCATTCTGCAAGTCTGATTCTGATTCTGCAAGTCGACCTGATTCGACCTGCAAGTCGATCGATGCAAGTCGATCGACCTGATTCGATGATTCGATCGACCTGCAAGTCGATGATTCGATCGATGCAAGTCGACCTGATTCGATCGATCGACCTGCAAGTCGATCGATCGATGATCAAGTCGACCTGATCAAGTCGATCGATCGACCTGATCAAGTCGATCGATCGACCTGATCAAGTCGACCTGATCAAGTCGACCTGATCAAGTCGACCTGATCAAGTCGATCGATCGATCGACCTGATCAAGTCGACCTGATCAAGTCGACCTGATCAAGTCGACCTGATCAAGTCGACCTGATCAAGTCGACCTGATCAAGTCGACCTGATCAAGTCGACCTGATCAAGTCGACCTGATCAAGTCGATCGATCGATCGACCTGCAAGTCGATCGACCTGCAAGTCGACCTGATCAAGTCGACCTGATCAAGTCGATCGACCTGATCAAGTCGATCGATCGATCGATCGATCGATCGACCTGATCAAGTCGACCTGATCAAGTCGACCTGATCAAGTCGACCTGCAAGTCGATCGACCTGATCAAGTCGACCTGATCAAGTCGACCTGATTCGACCTGATTCGACCTGATCCTGATCAAGTCGACCTGATCAAGTCGACCTGATCAAGTCGATCGATGATTCGATCGACCTGATCAAGTCTCTCTCGACCTGCAAGTCGACCTGATCAAGTCGACCTGCAAGTCTCTCTCGACCTGCAAGTCGACCTGCAAGTCGACCTGATCCTGATCCTGATCCTGATCAAGTCGATCTCTCTCTCTCTCTCGACCTGATCAAGTCGACCTGCAAGTCTCGACCTGCAAGTCTCTCGACCTGCAAGTCTCTCTCTCGACCTGCAAGTCGACCTGCAAGTCGACCTGCAAGTCTCTCTCGACCTGCAAGTCGACCTGCAAGTCGACCTGCAAGTCGACCTGCAAGTCTCTCTCGACCTGCAAGTCTCGACCTGCAAGTCGATGCAAGTCGACCTGCAAGTCGACCTGCAAGTCGACCTGCAAGTCGACCTGCAAGTCTCGACCTGCAAGTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCGACCTGCACCTGCAAGTCTCTCTCTCTCGACCTGCAAGTCTCTCTCTCTCTCTCTCTCGACCTGCAAGTCGACCTGCAGTCCTGCACCTGCACCTGCAAGTCTCTCTCTCTCTCTCTCTCGACCTGCAAGTCGACCTGCAAGTCGACCTGCAAGTCGACCTGCAAGTCGACCTGCACCTGCAGTCCTGCAAGTCGACCTGCAAGTCGACCTGCAAGTCTCGACCTGCAGTCCTGCAAGTCGACCTGCACCTGCACCTGCACCTGCACCTGCAAGTCTCTCTCTCTCTCTCTCTCTCGACCTG
TAGCTGTTTCCGCTGAGGGTTTAATGCGTAAGCTCCCTAATTGGCCCATCCGGCATCTGTAGGGCGTCCAAATATCGTGCCTCTCCTGCTTTGCCCGGTGTATGAAACCGGAAAGGCCGCTCAGGAGCTGGCCAGCGGCGCAGACCGGGAACACAAGCTGGCAGTCGACCCATCCGGTGCTCTACACTCGACCTGCTGAGGTCCCTCAGTCCCTGGTAGGCAGCTTTGCCCCGTCTGTCCGCCCGGTGTGTCGGCGGGGTTGACAAGGTCGTTGCGTCAGTCCAACATTTGTTGCCATATTTTCCTGCTCTCCCCACCAGCTGCTCTTTTCTTTTCTCTTTCTTTTCCCATCTTCAGTATATTCATCTTCCCATCCAAGAACCTTTATTTCCCCTAAGTAAGTACTTTGCTACATCCATACTCCATCCTTCCCATCCCTTATTCCTTTGAACCTTTCAGTTCGAGCTTTCCCACTTCATCGCAGCTTGACTAACAGCTACCCCGCTTGAGCAGACATCACCGTCTTGCCTGATGAGTCCGTGAGGACGAAACGAGTAAGCTCGTCGCAAGAATTCTTGCTTGTAGGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTGGCCGGCATGGTCCCAGCCTCCTCGCTGGCGCCGGCTGGGCAACATGCTTCGGCATGGCGAATGGGACTGATTTAATAGCTCCATGTCAACAAGAATAAAACGCGTTTCGGGTTTACCTCTTCCAGATACAGCTCATCTGCAATGCATTAATGCATTGGACCTCGCAACCCTAGTACGCCCTTCAGGCTCCGGCGAAGCAGAAGAATAGCTTAGCAGAGTCTATTTTCATTTTCGGGAGACGAGATCAAGCAGATCAACGGTCGTCAAGAGACCTACGAGACTGAGGAATCCGCTCTTGGCTCATTAAGACCTCAGCCGAGACAGCAG example 3 disruption of uracil biosynthesis-associated genes pyrG and pyrE in Fusarium verticillium
The CRISPR/Cas9 vectors pFC332_ pyrG _ sgRNA505 and pFC332_ pyrE _ sgRNA86 used for disruption of the uracil biosynthesis-associated genes pyrG and pyrE were introduced into Fusarium verticillium protoplasts as follows:
inoculating wild fusarium verticillioides LNF15-11 strain to a PDA (personal digital assistant) plate, culturing for 7 days at 25 ℃, sucking 3mL of yeast extract peptone glucose (YEPD) liquid culture medium by using a liquid transfer gun, blowing hyphae, washing the spores, placing the spores in 150mLYEPD liquid culture medium, and shaking and culturing for 10 hours at 25 ℃ and 150rpm overnight; microscopic examination shows that the spore is germinated and grown into young plants, the microscopic examination result of the young plants is shown in A of figure 2, and the state that the spore is germinated but not completely grown into hyphae is the young plants; centrifuging at 8000rpm for 5min to collect young plant, and discarding supernatant; resuspending with 10mL of 0.7M NaCl, centrifuging at 8000rpm for 5min, discarding the supernatant, and resuspending with 2mL of 0.7M NaCl for use; weighing 0.1g of lyase (Lysing enzymes) and 0.05g of crash enzyme (Driselase) dissolved in 15mL of 0.7M NaCl, and passing through a 0.22M bacterial filter; mixing the young plant with the two enzymes, diluting to 20mL with 0.7M NaCl, and shake culturing at 28 deg.C and 100rpm for 3 h; microscopic examination is carried out, the condition that all the juvenile plants are cracked into protoplasts is confirmed, and the microscopic examination result is shown as B in figure 2; centrifuging at 4 deg.C and 2500rpm for 5min to collect protoplast, and removing supernatant; resuspending with 10mL of pre-chilled 0.7M NaCl, centrifuging at 4 deg.C and 2500rpm for 5min, removing supernatant, resuspending with 1mL of pre-chilled 0.7M NaCl to obtain protoplast stock solution, and adjusting the concentration to 108Per mL; each 100. mu.L of the suspension was dispensed into 1.5mL centrifuge tubes and kept on ice until use.
Adding 10 μ g of pFC332_ pyrG _ sgRNA505 and pFC332_ pyrE _ sgRNA86 vectors into 100 μ L of protoplast, mixing uniformly, and standing on ice for 20 min; dropwise adding 100 μ L of 40% PEG3350 solution, mixing, and standing on ice for 30 min; adding 800 μ LFRB solution (Fusarium Regeneration Broth, 1M sucrose, 0.02% yeast extract), and shaking overnight at 25 deg.C and 150rpm for 12h for multi-wall culture; dissolving 50mLFRA solid culture medium (Fusarium RegenerationAgar, 1M sucrose, 0.02% yeast extract and 1.5% agar powder), adding the solution after wall cladding when the temperature is cooled but the solution is not solidified, simultaneously adding 50 mu g/mL Hyg resistance, pouring the plate, solidifying and placing at 25 ℃ to culture until a single transformant grows out; plates were covered with water agar (containing 1.5g/L of 5-FOA, 0.7g/L of uracil and 1.5g/L of uridine), and cultured at 25 ℃ until transformants grew on the surface of the water agar; the transformants were picked on a single PDA screening medium (containing 1.5g/L of 5-FOA, 0.7g/L of uracil and 1.5g/L of uradine), 8 transformants were picked per plate, cultured at 25 ℃ for 4 days, and the transformants capable of growing were individually transferred to a single PDA medium (containing 0.7g/L of uracil and 1.5g/L of uradine), and cultured at 25 ℃ for 7 days; the glycerol strain is preserved, and the residual hyphae are used for extracting genome DNA and extracting the genome DNA of wild type fusarium verticillioides LNF 15-11.
Using transformant and wild type fusarium verticillioides LNF15-11 genome DNA as templates, respectively designing and synthesizing a primer pair pyrG _ CRI _ Seq _ F/pyrG _ CRI _ Seq _ R, pyrE _ CRI _ Seq _ F/pyrE _ CRI _ Seq _ R, amplifying a sequence containing a target site by using the primer pair and sending the sequence to engineering biology engineering limited company for sequencing, and the sequencing comparison result shows that pyrG and pyrE genes are successfully destroyed, as shown in FIG. 3, a CRISPR/Cas9 vector pFC332_ pyrG _ sgRNA505 and pFC332_ pyrE _ sgRNA86 are respectively introduced into fusarium verticillioides protoplast for pyrG and pyrE gene destruction genotype map, wherein the numbers in parentheses represent the number of mutants which have such genotype change; the mutants after sequencing verification are respectively transferred to MM, MM _ UU +5-FOA and MM _ UU + Hyg culture media for phenotypic observation (wherein, MM: minimedium; UU: 0.7g/L uracil +1.5g/L uridine; 5-FOA: 1.5 g/L5-FOA; Hyg: 50. mu.g/mL Hyg), the results of the phenotypic graphs of pyrG and pyrE gene disruption are shown in figure 4, and the results show that the wild type Fusarium verticillioides strain can normally grow on the common MM culture media and the culture media added with UU nutrients; and growth is inhibited by 5-FOA antibiotics; both pyrG and pyrE gene disruption mutants appeared to be unable to grow normally on normal MM medium, only in the presence of exogenously added UU nutrients, and showed resistance to 5-FOA, with the growth of both wild type strains and both disruption mutants being inhibited by Hyg antibiotics, indicating that the CRISPR/Cas9 plasmid in this system has been lost from the mutant strains in the absence of resistance selection pressure. Phenotypic observations further indicate that the pyrG and pyrE genes are successfully disrupted, and that both pyrG and pyrE play important roles in uracil biosynthesis.
The primer sequences used were as follows (5 '→ 3'):
pyrG_CRI_Seq_F(SEQ IDNO.15)：
AATAAGATCTTCACCCCTCGTTCC；
pyrG_CRI_Seq_R(SEQ IDNO.16)：
CGCTATCCTCGTCCAGTTGG；
pyrE_CRI_Seq_F(SEQ IDNO.17)：
ACGGACGGAGAGAGAAAGTG；
pyrE_CRI_Seq_R(SEQ IDNO.18)：
CAATACCGACAACGATACCGC。
while the present invention has been described in detail with reference to the preferred embodiments, it should be understood that the above description should not be taken as limiting the invention. Various modifications and alterations to this invention will become apparent to those skilled in the art upon reading the foregoing description. Accordingly, the scope of the invention should be limited only by the attached claims.
Sequence listing
<110> institute for agricultural product processing of Chinese academy of agricultural sciences
<120> CRISPR/Cas9 vector applicable to Fusarium verticillium and construction method and application thereof
<160> 18
<170> SIPOSequenceListing 1.0
<210> 1
<211> 20
<212> DNA
<213> locus505
<400> 1
gtcgccttga gggtaggatg 20
<210> 2
<211> 20
<212> DNA
<213> locus86
<400> 2
gcaagaattc ttgcttgtag 20
<210> 3
<211> 45
<212> DNA
<213> Artificial Sequence
<400> 3
tagctgtttc cgctgagggt ttaatgcgta agctccctaa ttggc 45
<210> 4
<211> 45
<212> DNA
<213> Artificial Sequence
<400> 4
ctgctgtctc ggctgaggtc ttaatgagcc aagagcggat tcctc 45
<210> 5
<211> 55
<212> DNA
<213> Artificial Sequence
<400> 5
tgaggacgaa acgagtaagc tcgtcgtcgc cttgagggta ggatggtttt agagc 55
<210> 6
<211> 52
<212> DNA
<213> Artificial Sequence
<400> 6
gacgagctta ctcgtttcgt cctcacggac tcatcaggtc gcccggtgat gt 52
<210> 7
<211> 55
<212> DNA
<213> Artificial Sequence
<400> 7
tgaggacgaa acgagtaagc tcgtcgcaag aattcttgct tgtaggtttt agagc 55
<210> 8
<211> 52
<212> DNA
<213> Artificial Sequence
<400> 8
gacgagctta ctcgtttcgt cctcacggac tcatcaggca agacggtgat gt 52
<210> 9
<211> 565
<212> DNA
<213> pyrG_sgRNA505-1
<400> 9
tagctgtttc cgctgagggt ttaatgcgta agctccctaa ttggcccatc cggcatctgt 60
agggcgtcca aatatcgtgc ctctcctgct ttgcccggtg tatgaaaccg gaaaggccgc 120
tcaggagctg gccagcggcg cagaccggga acacaagctg gcagtcgacc catccggtgc 180
tctacactcg acctgctgag gtccctcagt ccctggtagg cagctttgcc ccgtctgtcc 240
gcccggtgtg tcggcggggt tgacaaggtc gttgcgtcag tccaacattt gttgccatat 300
tttcctgctc tccccaccag ctgctctttt cttttctctt tcttttccca tcttcagtat 360
attcatcttc ccatccaaga acctttattt cccctaagta agtactttgc tacatccata 420
ctccatcctt cccatccctt attcctttga acctttcagt tcgagctttc ccacttcatc 480
gcagcttgac taacagctac cccgcttgag cagacatcac cgggcgacct gatgagtccg 540
tgaggacgaa acgagtaagc tcgtc 565
<210> 10
<211> 453
<212> DNA
<213> pyrG_sgRNA505-2
<400> 10
tgaggacgaa acgagtaagc tcgtcgtcgc cttgagggta ggatggtttt agagctagaa 60
atagcaagtt aaaataaggc tagtccgtta tcaacttgaa aaagtggcac cgagtcggtg 120
cttttggccg gcatggtccc agcctcctcg ctggcgccgg ctgggcaaca tgcttcggca 180
tggcgaatgg gactgattta atagctccat gtcaacaaga ataaaacgcg tttcgggttt 240
acctcttcca gatacagctc atctgcaatg cattaatgca ttggacctcg caaccctagt 300
acgcccttca ggctccggcg aagcagaaga atagcttagc agagtctatt ttcattttcg 360
ggagacgaga tcaagcagat caacggtcgt caagagacct acgagactga ggaatccgct 420
cttggctcat taagacctca gccgagacag cag 453
<210> 11
<211> 565
<212> DNA
<213> pyrE_sgRNA86-1
<400> 11
tagctgtttc cgctgagggt ttaatgcgta agctccctaa ttggcccatc cggcatctgt 60
agggcgtcca aatatcgtgc ctctcctgct ttgcccggtg tatgaaaccg gaaaggccgc 120
tcaggagctg gccagcggcg cagaccggga acacaagctg gcagtcgacc catccggtgc 180
tctacactcg acctgctgag gtccctcagt ccctggtagg cagctttgcc ccgtctgtcc 240
gcccggtgtg tcggcggggt tgacaaggtc gttgcgtcag tccaacattt gttgccatat 300
tttcctgctc tccccaccag ctgctctttt cttttctctt tcttttccca tcttcagtat 360
attcatcttc ccatccaaga acctttattt cccctaagta agtactttgc tacatccata 420
ctccatcctt cccatccctt attcctttga acctttcagt tcgagctttc ccacttcatc 480
gcagcttgac taacagctac cccgcttgag cagacatcac cgtcttgcct gatgagtccg 540
tgaggacgaa acgagtaagc tcgtc 565
<210> 12
<211> 453
<212> DNA
<213> pyrE_sgRNA86-2
<400> 12
tgaggacgaa acgagtaagc tcgtcgcaag aattcttgct tgtaggtttt agagctagaa 60
atagcaagtt aaaataaggc tagtccgtta tcaacttgaa aaagtggcac cgagtcggtg 120
cttttggccg gcatggtccc agcctcctcg ctggcgccgg ctgggcaaca tgcttcggca 180
tggcgaatgg gactgattta atagctccat gtcaacaaga ataaaacgcg tttcgggttt 240
acctcttcca gatacagctc atctgcaatg cattaatgca ttggacctcg caaccctagt 300
acgcccttca ggctccggcg aagcagaaga atagcttagc agagtctatt ttcattttcg 360
ggagacgaga tcaagcagat caacggtcgt caagagacct acgagactga ggaatccgct 420
cttggctcat taagacctca gccgagacag cag 453
<210> 13
<211> 993
<212> DNA
<213> pyrG _ sgRNA505 (expression box)
<400> 13
tagctgtttc cgctgagggt ttaatgcgta agctccctaa ttggcccatc cggcatctgt 60
agggcgtcca aatatcgtgc ctctcctgct ttgcccggtg tatgaaaccg gaaaggccgc 120
tcaggagctg gccagcggcg cagaccggga acacaagctg gcagtcgacc catccggtgc 180
tctacactcg acctgctgag gtccctcagt ccctggtagg cagctttgcc ccgtctgtcc 240
gcccggtgtg tcggcggggt tgacaaggtc gttgcgtcag tccaacattt gttgccatat 300
tttcctgctc tccccaccag ctgctctttt cttttctctt tcttttccca tcttcagtat 360
attcatcttc ccatccaaga acctttattt cccctaagta agtactttgc tacatccata 420
ctccatcctt cccatccctt attcctttga acctttcagt tcgagctttc ccacttcatc 480
gcagcttgac taacagctac cccgcttgag cagacatcac cgggcgacct gatgagtccg 540
tgaggacgaa acgagtaagc tcgtcgtcgc cttgagggta ggatggtttt agagctagaa 600
atagcaagtt aaaataaggc tagtccgtta tcaacttgaa aaagtggcac cgagtcggtg 660
cttttggccg gcatggtccc agcctcctcg ctggcgccgg ctgggcaaca tgcttcggca 720
tggcgaatgg gactgattta atagctccat gtcaacaaga ataaaacgcg tttcgggttt 780
acctcttcca gatacagctc atctgcaatg cattaatgca ttggacctcg caaccctagt 840
acgcccttca ggctccggcg aagcagaaga atagcttagc agagtctatt ttcattttcg 900
ggagacgaga tcaagcagat caacggtcgt caagagacct acgagactga ggaatccgct 960
cttggctcat taagacctca gccgagacag cag 993
<210> 14
<211> 993
<212> DNA
<213> pyrG _ sgRNA86 (expression box)
<400> 14
tagctgtttc cgctgagggt ttaatgcgta agctccctaa ttggcccatc cggcatctgt 60
agggcgtcca aatatcgtgc ctctcctgct ttgcccggtg tatgaaaccg gaaaggccgc 120
tcaggagctg gccagcggcg cagaccggga acacaagctg gcagtcgacc catccggtgc 180
tctacactcg acctgctgag gtccctcagt ccctggtagg cagctttgcc ccgtctgtcc 240
gcccggtgtg tcggcggggt tgacaaggtc gttgcgtcag tccaacattt gttgccatat 300
tttcctgctc tccccaccag ctgctctttt cttttctctt tcttttccca tcttcagtat 360
attcatcttc ccatccaaga acctttattt cccctaagta agtactttgc tacatccata 420
ctccatcctt cccatccctt attcctttga acctttcagt tcgagctttc ccacttcatc 480
gcagcttgac taacagctac cccgcttgag cagacatcac cgtcttgcct gatgagtccg 540
tgaggacgaa acgagtaagc tcgtcgcaag aattcttgct tgtaggtttt agagctagaa 600
atagcaagtt aaaataaggc tagtccgtta tcaacttgaa aaagtggcac cgagtcggtg 660
cttttggccg gcatggtccc agcctcctcg ctggcgccgg ctgggcaaca tgcttcggca 720
tggcgaatgg gactgattta atagctccat gtcaacaaga ataaaacgcg tttcgggttt 780
acctcttcca gatacagctc atctgcaatg cattaatgca ttggacctcg caaccctagt 840
acgcccttca ggctccggcg aagcagaaga atagcttagc agagtctatt ttcattttcg 900
ggagacgaga tcaagcagat caacggtcgt caagagacct acgagactga ggaatccgct 960
cttggctcat taagacctca gccgagacag cag 993
<210> 15
<211> 24
<212> DNA
<213> Artificial Sequence
<400> 15
aataagatct tcacccctcg ttcc 24
<210> 16
<211> 20
<212> DNA
<213> Artificial Sequence
<400> 16
cgctatcctc gtccagttgg 20
<210> 17
<211> 20
<212> DNA
<213> Artificial Sequence
<400> 17
acggacggag agagaaagtg 20
<210> 18
<211> 21
<212> DNA
<213> Artificial Sequence
<400> 18
caataccgac aacgataccg c 21

Claims (4)

1. A construction method of a CRISPR/Cas9 vector suitable for Fusarium verticillium is characterized by comprising the following steps:
s1, respectively selecting target sites locus505 and locus86 with nucleic acid sequences shown as SEQ ID NO.1 and SEQ ID NO.2 according to exon sequences of genes pyrG and pyrE related to uracil biosynthesis;
s2, taking a pFC334 carrier as a template, carrying out PCR by using primer pairs with nucleotide sequences shown as SEQ ID NO.3 and SEQ ID NO.6, SEQ ID NO.5 and SEQ ID NO.4, and respectively amplifying to obtain fragments with nucleotide sequences shown as SEQ ID NO.9 and SEQ ID NO. 10; taking a pFC334 carrier as a template, and adopting a primer pair with nucleotide sequences shown as SEQ ID NO.3 and SEQ ID NO.8, SEQ ID NO.7 and SEQ ID NO.4 to carry out PCR, and amplifying to obtain fragments with nucleotide sequences shown as SEQ ID NO.11 and SEQ ID NO. 12; respectively taking fragments with nucleotide sequences shown as SEQ ID NO.9 and SEQ ID NO.10, SEQ ID NO.11 and SEQ ID NO.12 as templates, carrying out fusion PCR by using primer pairs with nucleotide sequences shown as SEQ ID NO.3 and SEQ ID NO.4, and amplifying to obtain sgRNA expression frames with nucleotide sequences shown as SEQ ID NO.13 and SEQ ID NO. 14;
s3, singly digesting a pFC332 vector by using a restriction enzyme PacI, respectively connecting sgRNA expression frame fragments obtained in the step S2 to the pFC332 vector by using a one-step cloning method, transforming the connection products into TG-1 escherichia coli competent cells, and obtaining the CRISPR/Cas9 vector suitable for fusarium verticillioides after ampicillin resistance screening, colony PCR screening and sequencing verification.
2. The CRISPR/Cas9 vector applicable to Fusarium verticillium and constructed according to the construction method of claim 1.
3. The use of the CRISPR/Cas9 vector for Fusarium verticillioides of claim 2 in the research of uracil biosynthesis genes of Fusarium verticillioides.
4. Use according to claim 3, characterized in that it comprises the following steps:
introducing the CRISPR/Cas9 vector suitable for Fusarium verticillioides of claim 2 into protoplast of Fusarium verticillioides by polyethylene glycol-mediated protoplast transformation method, screening with hygromycin-resistant plate, screening with 5-fluoroorotic acid-resistant plate, picking transformant, amplifying, culturing, extracting genome, sequencing, comparing with sequence of wild strain, analyzing mutation site of target gene, observing phenotype of mutant, and verifying function of uracil biosynthesis-related gene.
CN202210411872.1A 2022-04-19 2022-04-19 CRISPR/Cas9 vector suitable for fusarium verticillioides and construction method and application thereof Pending CN114774455A (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN202210411872.1A CN114774455A (en) 2022-04-19 2022-04-19 CRISPR/Cas9 vector suitable for fusarium verticillioides and construction method and application thereof

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202210411872.1A CN114774455A (en) 2022-04-19 2022-04-19 CRISPR/Cas9 vector suitable for fusarium verticillioides and construction method and application thereof

Publications (1)

Publication Number Publication Date
CN114774455A true CN114774455A (en) 2022-07-22

Family

ID=82430660

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202210411872.1A Pending CN114774455A (en) 2022-04-19 2022-04-19 CRISPR/Cas9 vector suitable for fusarium verticillioides and construction method and application thereof

Country Status (1)

Country Link
CN (1) CN114774455A (en)

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN110719956A (en) * 2017-06-06 2020-01-21 齐默尔根公司 High throughput genome engineering platform for improving fungal strains
CN110869502A (en) * 2017-06-06 2020-03-06 齐默尔根公司 High throughput transposon mutagenesis
CN112166180A (en) * 2018-06-06 2021-01-01 齐默尔根公司 Manipulation of genes involved in signal transduction to control fungal morphology during fermentation and production

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN110719956A (en) * 2017-06-06 2020-01-21 齐默尔根公司 High throughput genome engineering platform for improving fungal strains
CN110869502A (en) * 2017-06-06 2020-03-06 齐默尔根公司 High throughput transposon mutagenesis
CN112166180A (en) * 2018-06-06 2021-01-01 齐默尔根公司 Manipulation of genes involved in signal transduction to control fungal morphology during fermentation and production

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
HUAXIANG DENG ET AL.: ""CRISPR system in filamentous fungi: Current achievements and future directions"", 《GENE》, vol. 627, pages 212 - 221, XP085144954, DOI: 10.1016/j.gene.2017.06.019 *
JAKOB B. HOOF ET AL.: ""Genome Editing: CRISPR-Cas9"", 《FUNGAL GENOMICS： METHODS AND PROTOCOLS, METHODS IN MOLECULAR BIOLOGY》, pages 119 - 132 *
JENNIFER PETSCHE ET AL.: ""Construction of a target-specifi CRISPR-Cas9 vector for the purpose of introducing mutations into the FUM1 gene of Fusarium verticillioides"", 《UNI SCHOLARWORKS：HONORS PROGRAM THESES》, pages 1 - 24 *

Similar Documents

Publication Publication Date Title
Chen et al. CRISPR/Cas9-mediated efficient genome editing via blastospore-based transformation in entomopathogenic fungus Beauveria bassiana
JP2019517261A (en) Hybrid nucleic acid sequences for genome manipulation
CN110317828B (en) Method for cultivating broad-spectrum bacterial leaf blight resistant rice by modifying rice OsSWEET gene promoter
US20230151347A1 (en) A genetically modified bacillus subtilis strain, optimized vectors, and uses thereof
WO2018098935A1 (en) Vector for plant genome site-directed base substitution
CN109161480B (en) Preparation method and gene knockout method of protoplast of phomopsis
JP7181542B2 (en) A novel strain of Pseudozyma antactica
CN110029113B (en) Encoding gene related to rice grain type growth and development and application thereof
Králová et al. CRISPR/Cas9 genome editing in ergot fungus Claviceps purpurea
CN111057654B (en) Cas9 gene knockout vector applicable to morinda officinalis endophytic fungus A761 and construction method and application thereof
Chen et al. Characterization of two polyketide synthases involved in sorbicillinoid biosynthesis by Acremonium chrysogenum using the CRISPR/Cas9 system
US6703200B1 (en) Methods and materials for the rapid and high volume production of a gene knock-out library in an organism
JP2003502015A (en) Methods and materials for rapid and mass production of gene knockout libraries in organisms
CN114774455A (en) CRISPR/Cas9 vector suitable for fusarium verticillioides and construction method and application thereof
CN114686456B (en) Base editing system based on bimolecular deaminase complementation and application thereof
Casas-Flores et al. Three decades of fungal transformation: novel technologies
Chen et al. Development of a CRISPR/Cpf1 system for multiplex gene editing in Aspergillus oryzae
JP6858191B2 (en) Gene cassette for homologous recombination knockout of yeast cells
CN113528540A (en) Rice grain type gene OsMKK3 encoding gene and application thereof
CN108929882B (en) Gene editing method and application of bacillus licheniformis
CN114107373A (en) Method for preparing arabidopsis autophagy gene mutant and application
AU785214B2 (en) Mutant bank
CN106636177A (en) FLP/FRT gene knockout method of Candida amazonensis
CN112481147B (en) Yeast mutant with function deletion of glutamine synthetase gene and preparation method and application thereof
CN115725533B (en) Method for obtaining glyphosate-resistant rice and double-base fusion editing system used by same

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination